ID: 1078119351

View in Genome Browser
Species Human (GRCh38)
Location 11:8490537-8490559
Sequence CTCTTCACAGCTGTGAGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6943
Summary {0: 1, 1: 1, 2: 98, 3: 4816, 4: 2027}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078119351_1078119355 -1 Left 1078119351 11:8490537-8490559 CCCCGTCTCACAGCTGTGAAGAG 0: 1
1: 1
2: 98
3: 4816
4: 2027
Right 1078119355 11:8490559-8490581 GAGCAGTGGTTCTCCCAGCATGG 0: 354
1: 791
2: 515
3: 258
4: 382
1078119351_1078119358 19 Left 1078119351 11:8490537-8490559 CCCCGTCTCACAGCTGTGAAGAG 0: 1
1: 1
2: 98
3: 4816
4: 2027
Right 1078119358 11:8490579-8490601 TGGTGTTTGAGCTCTGAGAACGG 0: 100
1: 160
2: 491
3: 542
4: 926

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078119351 Original CRISPR CTCTTCACAGCTGTGAGACG GGG (reversed) Intronic
Too many off-targets to display for this crispr