ID: 1078119397

View in Genome Browser
Species Human (GRCh38)
Location 11:8490823-8490845
Sequence CTCCAACACACCTGCAGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8305
Summary {0: 3, 1: 142, 2: 3919, 3: 2916, 4: 1325}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078119393_1078119397 14 Left 1078119393 11:8490786-8490808 CCCAGGGAAACACGGTCTGGAGT 0: 3
1: 70
2: 3312
3: 2281
4: 1086
Right 1078119397 11:8490823-8490845 CTCCAACACACCTGCAGCTAAGG 0: 3
1: 142
2: 3919
3: 2916
4: 1325
1078119392_1078119397 15 Left 1078119392 11:8490785-8490807 CCCCAGGGAAACACGGTCTGGAG 0: 1
1: 0
2: 7
3: 19
4: 164
Right 1078119397 11:8490823-8490845 CTCCAACACACCTGCAGCTAAGG 0: 3
1: 142
2: 3919
3: 2916
4: 1325
1078119389_1078119397 29 Left 1078119389 11:8490771-8490793 CCTCTGCTGGTGATCCCCAGGGA 0: 1
1: 13
2: 761
3: 1678
4: 2368
Right 1078119397 11:8490823-8490845 CTCCAACACACCTGCAGCTAAGG 0: 3
1: 142
2: 3919
3: 2916
4: 1325
1078119394_1078119397 13 Left 1078119394 11:8490787-8490809 CCAGGGAAACACGGTCTGGAGTA 0: 1
1: 6
2: 161
3: 3473
4: 2380
Right 1078119397 11:8490823-8490845 CTCCAACACACCTGCAGCTAAGG 0: 3
1: 142
2: 3919
3: 2916
4: 1325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078119397 Original CRISPR CTCCAACACACCTGCAGCTA AGG Intronic
Too many off-targets to display for this crispr