ID: 1078124272

View in Genome Browser
Species Human (GRCh38)
Location 11:8544163-8544185
Sequence CCGTGCCTGTCGGGGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3347
Summary {0: 1, 1: 2, 2: 46, 3: 519, 4: 2779}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078124272 Original CRISPR CCGTGCCTGTCGGGGGATGG GGG (reversed) Intronic
Too many off-targets to display for this crispr