ID: 1078125741

View in Genome Browser
Species Human (GRCh38)
Location 11:8561144-8561166
Sequence ATGAAGAAGCAGAGATAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 944
Summary {0: 1, 1: 1, 2: 4, 3: 88, 4: 850}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078125741_1078125745 27 Left 1078125741 11:8561144-8561166 CCTTCCTATCTCTGCTTCTTCAT 0: 1
1: 1
2: 4
3: 88
4: 850
Right 1078125745 11:8561194-8561216 GATGATTAATTTTACTCATGAGG 0: 1
1: 0
2: 1
3: 19
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078125741 Original CRISPR ATGAAGAAGCAGAGATAGGA AGG (reversed) Intronic
900558857 1:3293795-3293817 ATGGAGAAGCCGACAAAGGATGG - Intronic
900672065 1:3860563-3860585 AGGAAGTTGCACAGATAGGAAGG + Intronic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
901112522 1:6809906-6809928 ATAAAGGAGTAGAGATAGGGTGG + Intronic
901197914 1:7450518-7450540 ATGCAGAAGTAGAGACAGGTGGG + Intronic
902542107 1:17162922-17162944 AAGAAGAAGCAGGGATGAGAAGG + Intergenic
902936361 1:19767661-19767683 ATGAAGAAGCAATGAGAGAAAGG + Intronic
904517556 1:31068029-31068051 ATGAAAGAGCAGAAATGGGAAGG + Intergenic
904767184 1:32859237-32859259 CTGGAGAAGCAGAGATAGGGAGG - Intergenic
904904109 1:33881607-33881629 ATGAAGGAGCTGAGTTGGGATGG + Intronic
905190184 1:36227735-36227757 AGCAAGAAGCAGAGATTGGAGGG + Intronic
905893414 1:41530839-41530861 ATGGAGAGAGAGAGATAGGAAGG + Intronic
906220807 1:44077692-44077714 TTGAAGAAGCAGAGATCACACGG - Intergenic
906542021 1:46594282-46594304 TTGAAAAAGCAGAAATAGAAAGG + Intronic
906815738 1:48876408-48876430 ATCAAGAGGCAGCGAGAGGAAGG + Intronic
906835252 1:49076414-49076436 ATGCAGAACCAGAGACAGGGAGG + Intronic
907182680 1:52584598-52584620 ATGAAGAAGCATGGAGAGGAAGG + Intergenic
907355381 1:53868385-53868407 ATGAGGAAACTGAGACAGGAAGG - Intronic
908822781 1:68104954-68104976 ACAAAGAACCAGAGACAGGAGGG - Intronic
909785086 1:79601299-79601321 AAGAAGAAGCAGAGAAAAAAGGG + Intergenic
910061470 1:83098088-83098110 GTCAAGAAGCAGAGGTTGGATGG + Intergenic
910325835 1:86005844-86005866 ATGAATAAGCAGTTATAGCAAGG + Intronic
910979621 1:92946645-92946667 ATCAAGAAACAGAGGTAGGCTGG + Intronic
911203538 1:95070299-95070321 ATGAAGACCCAGAGATACAAGGG - Intronic
912169507 1:107081498-107081520 ATGAAGAAGAATGGAAAGGAAGG + Intergenic
912226572 1:107741020-107741042 ATGAAAAAGAGGAGAGAGGAGGG + Intronic
912827398 1:112918254-112918276 ATTAGGAAGCAGTCATAGGAGGG - Intronic
913074900 1:115333756-115333778 ATGAAGAAAGAGAGAGAGGGGGG - Intronic
913125525 1:115784148-115784170 CTGAAAGAGCAGAGAGAGGAGGG + Intergenic
913288090 1:117245901-117245923 AAAAAAAAGCAGAGATGGGAGGG - Intergenic
913716430 1:121538826-121538848 AAGAAAAAGCAGAGAAAGCAGGG - Intergenic
914827660 1:151146915-151146937 ATACAGAAGCAGAGACAGGCTGG + Intergenic
915001655 1:152599953-152599975 ATGAACAAGCAGAGGTGGGCAGG + Intronic
916178715 1:162065270-162065292 ATGCAGAAGGAGAGACAGCACGG - Intergenic
916295333 1:163212909-163212931 ATAAAGACACAGATATAGGAGGG - Intronic
916838141 1:168570439-168570461 ATGAAGAATGAGAGAGAGCATGG - Intergenic
916889239 1:169100570-169100592 CTGAAGAAGCAGAGAAAGTCAGG + Intergenic
917334870 1:173916505-173916527 CTGAAGAAGCAGAGAGAGAGAGG + Intronic
917452076 1:175155704-175155726 AGGAAGAAACTGAGAAAGGAGGG - Intergenic
917624983 1:176836610-176836632 AAGAAGAAGAAGAAATAGAAGGG - Intronic
917706719 1:177642203-177642225 ATGTAGAAACACAGATAAGAAGG - Intergenic
917834433 1:178930152-178930174 ATGAAGCAGCAGAGAGAGCCTGG + Intergenic
918083776 1:181227988-181228010 ATGAAGAAGGAGAAATGGGATGG - Intergenic
918107532 1:181426999-181427021 GTGAAGAAGCTGAGGTGGGAAGG - Intronic
918462957 1:184795163-184795185 AGGAACAAGAAGAGATGGGAGGG - Exonic
919062508 1:192651605-192651627 AGGAAGAAGCAAAAGTAGGAGGG + Intronic
919148332 1:193663092-193663114 ATGAAGAAATAGAGCTAGTAAGG + Intergenic
919261056 1:195194642-195194664 AAGAAGGAGAAGAGATAGAATGG - Intergenic
919427417 1:197449935-197449957 TTGAAGAACCAGAGAAAAGAGGG - Intronic
919496791 1:198282704-198282726 ATGAAGATGCAGAGAAAGAAAGG + Intronic
919588229 1:199465551-199465573 ATGAAGGAAGAGAGACAGGAGGG + Intergenic
920059893 1:203219917-203219939 ATCCAGAGGCAGAGCTAGGAGGG + Intronic
920114465 1:203610174-203610196 ATGAAGAAGCAGAGGCCAGAGGG + Intergenic
920133889 1:203754064-203754086 AAGAAGAAAGAGAGAAAGGAAGG + Intergenic
920257849 1:204668287-204668309 ATGCAGCAGTAGAGATAGCACGG + Intronic
920375038 1:205503773-205503795 AGGAGGAAGCAGAGATGAGAGGG + Intergenic
920574336 1:207046951-207046973 CTGAAGTAGCAAAGAAAGGAAGG + Exonic
920654547 1:207866096-207866118 ATGAAGAAGAAGAGATAATTTGG - Intergenic
920696283 1:208183487-208183509 ATGAAGGGGCAGAGATGGGAGGG + Intronic
920955546 1:210617383-210617405 TTGATGAAGTAGAGAGAGGAAGG + Intronic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
921031315 1:211337434-211337456 ATGGAGAGGCAGAGAAACGAAGG + Intronic
921306723 1:213804307-213804329 AAGAAATAGCAGAGATTGGAAGG - Intergenic
921443051 1:215211464-215211486 ATGAAAATGCAGAGCTGGGAAGG - Intronic
921557086 1:216611900-216611922 ATGAAGAAGCAGAAATATGGAGG + Intronic
921713202 1:218393663-218393685 AGGAAGTAGAAAAGATAGGAAGG + Intronic
921950099 1:220920656-220920678 ATGAGGAAGCAGGGAGAGGAAGG + Intergenic
922201170 1:223402732-223402754 ATGAAGACTCTGAGATATGATGG - Intergenic
922297724 1:224266232-224266254 AGAAAGAAGCAGAGAGAGGGGGG - Intronic
923293285 1:232568241-232568263 ATGAAGCAGCAGAGAAAGGAAGG + Intergenic
923357632 1:233176339-233176361 AGGAAGAAGGAGAGAAAGGAAGG - Intronic
923374117 1:233342903-233342925 ATGAAGAATCCGATTTAGGATGG - Intronic
923436291 1:233970726-233970748 ATGAAGAGACAGAGAGAAGACGG + Intronic
923566502 1:235080387-235080409 ATGAAGAAAGAGAGAAAGGAAGG + Intergenic
924014462 1:239705383-239705405 ATAAAGTAGCAGAGACTGGAAGG + Intronic
924196014 1:241607591-241607613 AGGAAGAAAGAGAGAAAGGAGGG + Intronic
924196021 1:241607671-241607693 AGGAAGAAAGAGAGAAAGGAGGG + Intronic
1062995798 10:1865441-1865463 AAGAAGCAGCAGAGATAGAGAGG + Intergenic
1063507054 10:6609137-6609159 CTGAGGTAGCAGAGAAAGGAGGG + Intergenic
1063672342 10:8109430-8109452 ATGAAGACGCAGAGATAAGAAGG - Intergenic
1063673226 10:8116691-8116713 AAGAAGTAGCAGAGATTGGCAGG - Intergenic
1064464945 10:15569548-15569570 AGTAAGAAGCAGACAGAGGATGG - Intronic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1065199893 10:23302421-23302443 ATGAAGAGGCAGAGACAGGGTGG - Intronic
1065277696 10:24102172-24102194 ATGAAGAAGCAATTATAGCAAGG + Intronic
1065734596 10:28740234-28740256 AAGAAGAAAGAGAGAGAGGAAGG - Intergenic
1065792483 10:29274166-29274188 ATGAAGATGGGGAGATAAGATGG + Intergenic
1065866449 10:29919189-29919211 AGGAAGAAGAGGAGAGAGGAGGG - Intergenic
1065905596 10:30248442-30248464 AAGAAGAAGAAGAGAAGGGAAGG + Intergenic
1066290511 10:34010368-34010390 AGGAAGAAAGAGAGAAAGGAAGG + Intergenic
1066546012 10:36501491-36501513 ATGAAGAAGCAGATATATAAGGG - Intergenic
1066977418 10:42381851-42381873 ATTAAGAAGCACAGACAGCAAGG - Intergenic
1067748786 10:48956513-48956535 AGCAAGAAGCAGAGGGAGGAGGG - Intronic
1068022328 10:51600962-51600984 AGGAAGAAGGAGAGAAAGGGAGG + Intronic
1068981918 10:63071415-63071437 ATAAAAATGCAGAGATAGGCTGG + Intergenic
1069069023 10:63975197-63975219 CTGCAGAAGCAGTGATAGGCTGG - Intergenic
1069249308 10:66247209-66247231 AAGAAGAAGTAGAGAATGGAAGG + Intronic
1069277892 10:66615454-66615476 AAGAAGAAGGAGACACAGGAAGG + Intronic
1069298473 10:66877101-66877123 ATGAAGTAGGAGTGAGAGGAGGG - Intronic
1070376953 10:75841923-75841945 ATGAAGAAACAGAGACAGAGGGG - Intronic
1070742209 10:78910621-78910643 AGGAAGAAGCAGTGATGTGAGGG - Intergenic
1070803243 10:79255626-79255648 ATGCAGAGACAGAGATAGGCAGG - Intronic
1071477849 10:86040087-86040109 CTGAAAAAGCAGAGTTAAGATGG + Intronic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1071675734 10:87654424-87654446 AGGAAGAACCAGAAATAGCAGGG + Intergenic
1071822331 10:89291214-89291236 ATGAGGAAGAAGAGAATGGAGGG - Intronic
1071888043 10:89972034-89972056 ATGGAGAAGTAGAGATGGGGAGG + Intergenic
1072222317 10:93336855-93336877 AGGAAGAAGGAAAGAAAGGAAGG + Intronic
1072252753 10:93594581-93594603 ATTAATAAGCAGAATTAGGATGG - Intronic
1072723264 10:97793919-97793941 ATAAAGAAAAAGAGAGAGGAAGG - Intergenic
1073615556 10:104991401-104991423 ATGAAGATGCAGAGAGAAGCTGG - Intronic
1074125371 10:110524934-110524956 ATGAAGAAGGAGAGACAAAATGG + Intergenic
1074723367 10:116283241-116283263 TTCTAGAAGCAGAGATAGAAAGG + Intergenic
1075265602 10:120997858-120997880 TTGAAGAAGCACAGCTGGGAAGG - Intergenic
1075575041 10:123571817-123571839 AGGAAGAATCAGAGATGAGAAGG - Intergenic
1075697251 10:124446303-124446325 GTGAACAAGCAGAGATTGTAAGG - Intergenic
1075725103 10:124606956-124606978 AGGATGAAGCAGAGAAAAGAGGG - Intronic
1075765262 10:124887844-124887866 ATGAAGACGCAGAGGAAGGGAGG + Intergenic
1075951497 10:126481715-126481737 ATGAACGGGGAGAGATAGGAGGG - Intronic
1076238479 10:128884051-128884073 GTGAAGAGGCAGAGAAAGGGGGG - Intergenic
1076534704 10:131169192-131169214 ATGAGGAGGCAGAGATGGGGTGG - Intronic
1076850946 10:133092728-133092750 ATGAAGAAGGAGAAATAGGGAGG + Intronic
1077190406 11:1253707-1253729 AGGCAGAGGCAGAGATCGGAGGG - Intronic
1077310148 11:1884825-1884847 ATGCAGAAGCATTGATAGGATGG - Intronic
1077731746 11:4738217-4738239 TTGCAGAAGCAGACACAGGAAGG - Intronic
1078053217 11:7985277-7985299 ATGAAGAAGCAGAGATGAATTGG - Intronic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1078511459 11:11987417-11987439 ATGAGAAATCAGAGATGGGAGGG - Intronic
1078767578 11:14313661-14313683 AGGCAGAGGCAGAGATTGGAGGG + Intronic
1079366627 11:19815597-19815619 ATGAAGAAGAAGTTCTAGGATGG - Intronic
1080067987 11:28042342-28042364 ATGAATATGCAGAGACAGTAGGG - Intronic
1080421507 11:32115271-32115293 AAGAAGAAGCAAAGAGTGGAAGG - Intergenic
1080463646 11:32477126-32477148 TTGAAGAAGCAGAGTCAGGCCGG + Intergenic
1080556604 11:33422587-33422609 AGGAAGAAGGAAAGAAAGGAGGG - Intergenic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1081183026 11:40007248-40007270 ATGAAGAGACAGAGAGAAGATGG - Intergenic
1081248059 11:40794471-40794493 ATGGAGAATCAGAGATTTGATGG - Intronic
1081451730 11:43177342-43177364 AGGAAGGAACAGATATAGGATGG - Intergenic
1082813917 11:57495883-57495905 ATGAGAAAGCAGAGCTTGGAGGG + Intronic
1084041234 11:66543828-66543850 ATGAAGCAGCAGGCACAGGAAGG + Exonic
1084165783 11:67374072-67374094 ATGAGGAGGCAGAGGTAGGGTGG - Intronic
1084297088 11:68219622-68219644 AAGAAGAAGAGGAGAGAGGAAGG - Intergenic
1084370668 11:68740530-68740552 CTGAAACAGCAGAGAAAGGAAGG + Intronic
1084465199 11:69319250-69319272 ATGAAGAATATGAGAGAGGAAGG - Intronic
1084508833 11:69589089-69589111 GTGTACAAGCATAGATAGGAAGG + Intergenic
1084851339 11:71943671-71943693 ATGAAGAAGCAGAGATTTCAGGG + Intronic
1085027265 11:73243512-73243534 ATCCAGAAGCAGAGGTAAGATGG + Intergenic
1085187009 11:74584097-74584119 ATGACGAAGAAGACAGAGGAGGG + Intronic
1085484899 11:76854658-76854680 ATGAAGATACAGAGATAGAGTGG + Intergenic
1085646291 11:78225194-78225216 AGGAAGAAGCTGACAGAGGAAGG + Exonic
1086004275 11:82017932-82017954 ATGAAGAAACAGAGATACAGAGG + Intergenic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1086564161 11:88205982-88206004 ATGTAGCAGTGGAGATAGGAGGG + Intergenic
1086825525 11:91490363-91490385 AGGAAGGAGCAGAAAGAGGAAGG - Intergenic
1086855112 11:91856470-91856492 ATGAGAAAGCAGACAAAGGAGGG + Intergenic
1086909608 11:92457301-92457323 ATGAATAGGCAGAGATACAATGG + Intronic
1086934380 11:92728794-92728816 AGGAAGAAACAGAGATTAGAGGG - Intronic
1087271270 11:96114470-96114492 TTGCAAAAGCAGAGATAGGTGGG - Intronic
1087624940 11:100585477-100585499 AAGCAGAGGCAGAGAGAGGATGG - Intergenic
1088058444 11:105612652-105612674 AGGAAGAAGCAAAGAGAGGGAGG - Intronic
1088101761 11:106163733-106163755 ATGAAGATGCAAAGATACAAGGG - Intergenic
1088838648 11:113603410-113603432 AGTCAGAAGCAGAGATTGGAGGG + Intergenic
1089148097 11:116345086-116345108 AAAAAGAAGCAAAGACAGGAAGG + Intergenic
1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG + Intronic
1089436983 11:118477214-118477236 ATGAAGGAGCAGGGGAAGGAAGG + Intronic
1090056657 11:123430297-123430319 AGGAAGAGGCAGTGGTAGGAGGG - Intergenic
1090259595 11:125309167-125309189 AGGAAGAAAGAGAGAGAGGAAGG - Intronic
1090599811 11:128358562-128358584 ATGTAGATGCAGGGAGAGGATGG - Intergenic
1090617184 11:128525853-128525875 ATGGAAAATTAGAGATAGGAAGG + Intronic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1091661655 12:2388528-2388550 ATGAAGAATCTGAGAGAGGTAGG + Intronic
1092139794 12:6175676-6175698 ATAAAGAAGTAGAGAAATGAGGG + Intergenic
1093029738 12:14277244-14277266 GTGGAGAAACAGAGATAGAAGGG - Intergenic
1093111701 12:15160519-15160541 ATGAAGAAACTGAGATTGAAAGG - Intronic
1093370919 12:18364095-18364117 GTAAAGATGCAGAGATAGGTAGG - Intronic
1093425149 12:19020289-19020311 GTGAAGAAGGAGCGAGAGGAAGG - Intergenic
1093454999 12:19356409-19356431 CTCAAGAAGCTGAGATAGGGTGG + Intronic
1093636521 12:21477499-21477521 ATAAAGATGGAGAGAAAGGATGG - Intronic
1093755906 12:22851608-22851630 AGAAAGAAAGAGAGATAGGAAGG - Intergenic
1093947743 12:25129649-25129671 ATGGAGAAGTTTAGATAGGAAGG - Intronic
1093977842 12:25442100-25442122 ATGAAGGAGCAGGAATATGAGGG - Intronic
1094498127 12:31001984-31002006 AAGAACAAGCAGAGACAGGGTGG + Intergenic
1094575078 12:31677719-31677741 ATGAAGGGTAAGAGATAGGAGGG - Intronic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1094818438 12:34207669-34207691 ACCAAGAAACAGAGAAAGGAAGG - Intergenic
1095403912 12:41846224-41846246 AGGCAAAAGCAGAGATTGGAGGG - Intergenic
1096000307 12:48124199-48124221 ATGAAGAAACTGAGGAAGGAGGG + Intronic
1096091880 12:48907569-48907591 GTGAAGAAGTAGAGATAGTGAGG - Intronic
1096692977 12:53332597-53332619 AAAAAGAAGCAGAAATAGGCAGG + Intronic
1096738582 12:53675686-53675708 AAGAGAAAGCAGAGATAGGAGGG + Intronic
1096741615 12:53697577-53697599 GTGAAGAGCCAGAGAAAGGAAGG - Intergenic
1096983563 12:55742921-55742943 ATGAAGAGACAGAGATATGAGGG - Intergenic
1096984393 12:55746320-55746342 ATGCAGAGGCAGTGATAGAAAGG - Intronic
1097254629 12:57664457-57664479 AGGAAGAAGGAAAGAAAGGAAGG - Intergenic
1097395067 12:59063442-59063464 ATTAAGAAGCAGAGATGGGGAGG + Intergenic
1097507498 12:60494290-60494312 ATGGAGAAGCAGAGGAAGCAGGG + Intergenic
1098341939 12:69460680-69460702 ATGAAGGAGAAGAGAAAGGATGG + Intergenic
1098384297 12:69902424-69902446 ATGGAGAAACAGTGGTAGGAGGG - Intronic
1098460806 12:70731089-70731111 AGGAGGAAGGAGAGAGAGGAAGG + Intronic
1099610490 12:84862183-84862205 AGAAAGAAGCAGAAATTGGAAGG - Intronic
1100420253 12:94425297-94425319 ATTAAGAAGCAGACATTGCATGG + Intronic
1100446563 12:94666001-94666023 ATGGAGAAGCAGGGAAAGGCTGG - Intergenic
1100598219 12:96089703-96089725 AGAAAGAAGGAGAGAAAGGAAGG - Intergenic
1100916002 12:99422673-99422695 AGGAAGAAGAAGAGAGAGAATGG + Intronic
1101065911 12:101020512-101020534 ATGATGATACAGAGATAGGCTGG + Intronic
1101358401 12:104003045-104003067 AAGAAGAAGAAGAGGTAGGGAGG + Intronic
1101541138 12:105666548-105666570 ATGAGGAAACAGACATAGAAAGG + Intergenic
1101581728 12:106047922-106047944 ATGAGGGAACAGAAATAGGAAGG - Intergenic
1101803060 12:108039366-108039388 ATGAAGACGAAGAGAAAGGTGGG - Intergenic
1101814084 12:108131736-108131758 ATGAGAAAGCAGAGAGAGGGCGG - Exonic
1102115787 12:110402255-110402277 ATGAAGTCGCAGAGAGTGGAGGG + Intronic
1102210719 12:111124997-111125019 ATGAGGGACCAGAGACAGGAGGG + Intronic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1102735955 12:115159662-115159684 ACGAAGAAACAGTGATAGCAAGG - Intergenic
1102868604 12:116394334-116394356 AGACAGAAGCAGAGATGGGAGGG - Intergenic
1103041771 12:117701753-117701775 AGACAGAAGCAGAGATTGGAAGG + Intronic
1103480856 12:121248902-121248924 ATGAAGACGGAGAGACAGGACGG + Intronic
1103662072 12:122528227-122528249 ATGAAGAAGGAGGGACAGGTTGG - Intronic
1103898031 12:124286769-124286791 ATGAAAATGCAGAGATGGCAAGG - Intronic
1104083397 12:125453259-125453281 AGGAAAAAGAAGAGATATGATGG - Intronic
1104428372 12:128696364-128696386 AAGGAGAATCAGAGGTAGGATGG - Intronic
1104769105 12:131349571-131349593 AGGAAGAAACAGAGACAGGTAGG - Intergenic
1104915892 12:132264357-132264379 ATGAAGAAGCCGAGCCGGGATGG + Intronic
1105717858 13:23085049-23085071 ATGAGGAGCCAGAGACAGGAGGG - Intergenic
1105775469 13:23655457-23655479 CTGAAGAAGTGGAAATAGGAAGG - Intronic
1106007625 13:25785834-25785856 ATGAGGAAGAAGATAAAGGAAGG + Intronic
1106762650 13:32882197-32882219 ATGAAGAAACTGAGATAGGCTGG + Intergenic
1106764216 13:32897702-32897724 ATGAGGAAGCAGAGCTCGCAGGG - Intergenic
1106777983 13:33026892-33026914 ATCAAGAAGCAGAGAGAAGCTGG - Intronic
1106947031 13:34840149-34840171 AGGAAGAAGAAGAGAAGGGAAGG + Intergenic
1107666924 13:42700159-42700181 CTGAAGAAGTAAAGACAGGAAGG + Intergenic
1108420610 13:50245311-50245333 ATGAAGAAGCAGAATTAGAGAGG - Intronic
1108575531 13:51787193-51787215 ATGAAAAGGAAGAGATAGCAAGG + Intronic
1108647334 13:52443430-52443452 AAGAAGAGGAAGAGACAGGAGGG + Intronic
1108811227 13:54225515-54225537 ATGAGGGGCCAGAGATAGGAGGG + Intergenic
1108894849 13:55313363-55313385 ATGAAGTCGGAGAGATAGGTTGG - Intergenic
1108979377 13:56491522-56491544 ATGAAGAAACAGAGAGAAGGGGG + Intergenic
1109214318 13:59570554-59570576 AGGAAGAAGGAGAGAAGGGATGG + Intergenic
1109689963 13:65873566-65873588 ATGAAGAAGGAAAGGAAGGAAGG + Intergenic
1109764682 13:66878808-66878830 ATAAAAAAGCAGAGATCAGAAGG + Intronic
1109977231 13:69854337-69854359 ATGAAGAAAGAGAGAGAGCATGG + Intronic
1110399791 13:75076585-75076607 CTGAGGAAGCAGAGCTAGAAGGG + Intergenic
1111048303 13:82846367-82846389 AGGAAGAAACAAAGGTAGGAAGG + Intergenic
1112126267 13:96471753-96471775 TTTAAGAAGCAGAGGTTGGAGGG + Intronic
1112698729 13:101979602-101979624 ATCTAGAAGCTGGGATAGGATGG + Intronic
1112892460 13:104255111-104255133 TTGAAGAAGCAGCGATAAGTGGG + Intergenic
1112995406 13:105568583-105568605 ATGAGGAAGCAGAAACAGTAGGG + Intergenic
1113213483 13:108010642-108010664 ATGAAGAAGCAGTAATACAAAGG - Intergenic
1113222025 13:108115870-108115892 AACCAGAAGCAGAGATAAGATGG + Intergenic
1113883426 13:113642743-113642765 ATGAAGGAGAAGAGAAAGAAAGG + Intergenic
1113991164 14:16029376-16029398 AGCAAGAAACAGAGAGAGGAAGG - Intergenic
1114263930 14:21060074-21060096 ATAAGGAGGCAGAGATAGCATGG - Intronic
1114367787 14:22048449-22048471 ATGAAGACACAGGGATATGATGG - Intergenic
1114673092 14:24423451-24423473 AGGAGGAAGCAGAGATGGGGAGG + Intergenic
1115500183 14:34042712-34042734 GTGAAGAAGTGCAGATAGGAGGG + Intronic
1115724694 14:36200330-36200352 ATTCAGAAACTGAGATAGGAGGG + Intergenic
1117296281 14:54382616-54382638 ATGAAGAAGGAGAGAGATGGGGG - Intergenic
1117434414 14:55702448-55702470 ATGAAGAGGAAGAGGTAGGTTGG + Intergenic
1117564704 14:56981281-56981303 AATGTGAAGCAGAGATAGGATGG - Intergenic
1117601556 14:57381148-57381170 AGGAAGAAGGAAAGAAAGGAAGG + Intergenic
1117824036 14:59682082-59682104 ATGAAGATGGGGAGATGGGAAGG - Intronic
1117896967 14:60497042-60497064 ATGAAGATGGAGAGATAGGTAGG - Intronic
1118231036 14:63950116-63950138 TGGAAGAAGCACAGAGAGGAAGG - Intronic
1118294794 14:64559092-64559114 ATAAATAAACAGAGAAAGGAAGG + Intronic
1118489956 14:66249309-66249331 AGGGAGAAGAAGAGAAAGGAAGG - Intergenic
1118918648 14:70129782-70129804 TTCAAGAGGCAGAGAAAGGAGGG + Intronic
1118921069 14:70150516-70150538 ATCATCAAGCAGTGATAGGAGGG + Intronic
1119470545 14:74895192-74895214 ATGAAAAGGCAAAGATAGGCTGG + Intronic
1119531886 14:75367557-75367579 ATGAAGAAGGAAAAAAAGGAAGG + Intergenic
1119547902 14:75486432-75486454 AGGAAGAAAGAAAGATAGGAAGG + Intergenic
1119676892 14:76562540-76562562 AGGAAGAAGGAGAGCCAGGAGGG + Intergenic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120056075 14:79925640-79925662 AGGAAGAAAGAGAGAAAGGAAGG + Intergenic
1120680681 14:87477412-87477434 AGCAGGAAGCAGAGAGAGGAGGG + Intergenic
1121059715 14:90895534-90895556 GTGGAGAAGAAGAGAAAGGATGG - Intronic
1121080438 14:91103515-91103537 ATGCAGAAGTAGATGTAGGAAGG - Intronic
1121718515 14:96093008-96093030 TTTCAGAATCAGAGATAGGATGG - Exonic
1122101520 14:99414140-99414162 ATGAAGAAGCAGATTTATGGCGG - Intronic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1123945342 15:25236276-25236298 ACGAAGGAGCAGAGACAGGTTGG - Intergenic
1124152699 15:27196171-27196193 ATGTATAAGCAGGGCTAGGATGG - Intronic
1124196204 15:27632052-27632074 GTGAAAAAGCTGAGATAGAAAGG - Intergenic
1124347430 15:28932018-28932040 ATGCAGCAGCACAGAAAGGAGGG - Intronic
1125299183 15:38236082-38236104 CTGAAGAAGCACAGATAGGCTGG + Intergenic
1125303454 15:38282613-38282635 ATGGATAAGCAGTGGTAGGATGG + Intronic
1125778573 15:42242361-42242383 ATGAAGAAGCTGAAGTAGGGTGG + Intronic
1126146364 15:45476440-45476462 ATAAAGAAGCAAAAAGAGGATGG + Intergenic
1126432128 15:48597557-48597579 AAGAGGAAGCAGAAGTAGGAGGG - Intronic
1126922022 15:53537540-53537562 ATGAAGAAACAGAGACAGAAAGG - Intronic
1127044309 15:55010069-55010091 TTGAAGAAGAAGAGAAATGATGG - Intergenic
1127736879 15:61849395-61849417 AGGAAGAAGTAGAGATAGAGAGG + Intergenic
1127869609 15:63060347-63060369 TGGAAGAACCAGAGAGAGGAAGG - Intronic
1128187524 15:65655667-65655689 CTGAAGATGAAAAGATAGGACGG + Exonic
1128440303 15:67701133-67701155 ATGAAGAAATGGAGAGAGGAAGG + Intronic
1129191576 15:73940881-73940903 ATGAAATAGCCTAGATAGGAAGG + Intronic
1130272401 15:82458862-82458884 AGGGAGAAGCAGGGATAGGTGGG + Intergenic
1130285500 15:82551098-82551120 ATAAAGAAGCAGAGAAGGTAGGG + Intronic
1130380082 15:83364103-83364125 ATGAAGAAGCACAGTTAGCGAGG + Intergenic
1130464752 15:84186215-84186237 AGGGAGAAGCAGGGATAGGTGGG + Intergenic
1130487933 15:84408589-84408611 AGGGAGAAGCAGGGATAGGTGGG - Intergenic
1130499514 15:84487322-84487344 AGGGAGAAGCAGGGATAGGTGGG - Intergenic
1130587044 15:85190829-85190851 AGGGAGAAGCAGGGATAGGTGGG + Intergenic
1131172350 15:90187435-90187457 ATGAAAAAGCTGAGTTAGGCAGG + Intronic
1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG + Intergenic
1131351193 15:91701424-91701446 ATGAAGGAGGAGAGGAAGGAAGG + Intergenic
1131357434 15:91757912-91757934 AGGAAGAAGCAAAGAGGGGAGGG - Intergenic
1131871616 15:96769905-96769927 AGGAAGAAGCACAGACATGAAGG - Intergenic
1131994688 15:98122754-98122776 ATGAAGACTCAGAGAGAAGATGG - Intergenic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133489466 16:6253064-6253086 ATCAAGAAGGAGAGATGGCAGGG - Intronic
1133848862 16:9482927-9482949 ATGAAAAGCTAGAGATAGGAGGG + Intergenic
1134013470 16:10872063-10872085 AAAAAGAAGTAGATATAGGAAGG - Intergenic
1134309125 16:13059968-13059990 ATAAAGAACCACAGACAGGATGG - Intronic
1134347506 16:13404600-13404622 ATGAAGCTGCAGAGATGGGTAGG + Intergenic
1135187171 16:20325099-20325121 ATGAAGAGGCAGAGAAGTGAAGG + Intronic
1135387715 16:22058467-22058489 ATGAAGAAGAAAGGATTGGAAGG + Intronic
1135494369 16:22938647-22938669 ATCAAGAAGCAGAGTTTGGCTGG - Intergenic
1136909563 16:34134887-34134909 AGCAAGAAACAGAGAAAGGAAGG - Intergenic
1136910349 16:34140508-34140530 AGCAAGAAACAGAGAGAGGAAGG - Intergenic
1137065297 16:35835015-35835037 ATGCAGAGTCAGAGATATGAGGG - Intergenic
1137088808 16:36162619-36162641 ATAAAGAGGCAAAGAAAGGAAGG + Intergenic
1137756887 16:50909405-50909427 ATGAGGAAGCAGAGAAGAGAAGG - Intergenic
1138041946 16:53680840-53680862 AGGGAGAAGGAGAAATAGGAGGG + Intronic
1138060369 16:53883805-53883827 TTGAAGAATCAGAGATTGGGGGG - Intronic
1138149287 16:54641060-54641082 AGGAAGAAACAGAGAAAGGTAGG - Intergenic
1138852151 16:60641965-60641987 ATGAATCAGCAGAGTTAGGAAGG + Intergenic
1138894232 16:61183469-61183491 ATGAGGCACCAGAGACAGGAGGG + Intergenic
1139249322 16:65479880-65479902 CTGAAGAAATAGAGGTAGGAGGG + Intergenic
1139313794 16:66050502-66050524 TTGTAGAACCAGAGAAAGGATGG + Intergenic
1139364471 16:66425516-66425538 ATGAAGGATCAGAGAAAGGAGGG - Intergenic
1140132200 16:72173121-72173143 ATGAAGCCTCAGAGATATGAAGG - Intronic
1140737695 16:77912867-77912889 ATGAGGAAGCAGTGAGAAGACGG - Intronic
1140818364 16:78640952-78640974 AAGAAGAAGAAAAGAAAGGAAGG + Intronic
1140908388 16:79429522-79429544 AGGAAGCAGCAGAGAGAGGGAGG + Intergenic
1141051959 16:80774842-80774864 ATGAAGAGGCCAGGATAGGAAGG + Intronic
1141223018 16:82089465-82089487 ATGAAGGAGCAAAGACAGTAGGG - Intronic
1141332735 16:83126959-83126981 ATGAAGGAGTAGAGGGAGGAGGG + Intronic
1141369027 16:83470350-83470372 AAGAAGCAGCAGAGATTGGCTGG - Intronic
1141458866 16:84164395-84164417 ATGAAGAAGCAGAGCACAGAGGG - Intronic
1141623299 16:85248489-85248511 AGGAAGAGGCAGAGAAAGGGAGG - Intergenic
1141662302 16:85448007-85448029 AGGGAGAAGCAGAGCTGGGAAGG + Intergenic
1142653379 17:1372496-1372518 ATGATGAAGCTGAGTCAGGAAGG - Intronic
1142858647 17:2748240-2748262 TTCAAGAGGCAGAGATAGGGTGG - Intergenic
1143249427 17:5511811-5511833 ATGAAGAAAAAGAGGAAGGAAGG - Intronic
1143448774 17:7023507-7023529 ATGAACAAGAAGAATTAGGAGGG + Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1143818378 17:9539246-9539268 ATGAGGAAGAAGAGAAAAGAGGG + Intronic
1144101213 17:11943779-11943801 ATAAGGAAGGAGAGACAGGAGGG + Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144193492 17:12868195-12868217 ATGAAGACGCAGAGAGAAGATGG - Intronic
1144262610 17:13537405-13537427 ATGGAGGAGCTGAGAAAGGAAGG - Intronic
1144391701 17:14799434-14799456 ATGAAGAGCCAGAGACAGGTGGG + Intergenic
1145081439 17:19897714-19897736 ATGAAGAAATAGAGAGATGAAGG + Intergenic
1145302418 17:21649896-21649918 AGGAAGAAGCAGAGGGAGGGAGG - Intergenic
1145347902 17:22053416-22053438 AGGAAGAAGCAGAGGGAGGGAGG + Intergenic
1145415691 17:22711966-22711988 AGGAAGAAGCAGAGGGAGGGAGG - Intergenic
1145935595 17:28712909-28712931 ATGAAGAGGAGGAGAAAGGATGG + Intergenic
1145992826 17:29089497-29089519 AAAAAAAAGCAGAGACAGGAGGG + Intronic
1146597343 17:34181713-34181735 AAGAAGAAGAAGAGAGAGAAAGG + Intergenic
1146776395 17:35621422-35621444 ATGAAAGTGTAGAGATAGGATGG + Intronic
1147212146 17:38877886-38877908 ATGAGGAAGGAGAGAGGGGAGGG + Intronic
1147406339 17:40215082-40215104 ATGAAGAAACAGACACAGCAAGG - Intergenic
1147530215 17:41269257-41269279 ATTAAGAAGCAAAGAAAGGAGGG + Intergenic
1147986031 17:44308422-44308444 CGGGAGAAGCAGAGATTGGAAGG - Intronic
1148575323 17:48706471-48706493 ATGAAGCAACAGAGAGAGGCAGG - Intergenic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1150254632 17:63734344-63734366 ATTAAGAATCAGGGATAGGTTGG + Intronic
1150319444 17:64199888-64199910 ATGCACAAGAAGAGAAAGGAAGG - Intronic
1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG + Intronic
1151126394 17:71849816-71849838 ATGGAGAAACAGACATAGAAAGG + Intergenic
1151366955 17:73623726-73623748 GTGAAGAAGCAGAGAGAGTCGGG - Intronic
1151484511 17:74389934-74389956 AGGAAGAAAGAGAGAAAGGAAGG - Intergenic
1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG + Intronic
1151978240 17:77494327-77494349 ATGAAGGGACAGAGAGAGGAAGG - Intronic
1152258955 17:79256199-79256221 AGGAAGGAGCAGAGCTAAGAGGG - Intronic
1152496907 17:80679813-80679835 AAGAGAAAGCAGAGAAAGGAAGG - Intronic
1152993536 18:384853-384875 ATGGATAAGCACAGATAGGCTGG + Intronic
1153159190 18:2183588-2183610 AAAAAGAAGCAGAGAAAGAAAGG + Intergenic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1153754479 18:8266068-8266090 AAGAGGAAGAAAAGATAGGAAGG - Intronic
1153883494 18:9441070-9441092 TTGAAGAACCAGAGATAGTGTGG - Intergenic
1154515542 18:15161107-15161129 ATGAGGTAGCAGAGAAAGAAAGG + Intergenic
1155041273 18:22067292-22067314 AGGAAGAAGAAGGGAAAGGAAGG + Intergenic
1155116502 18:22773556-22773578 AGGAAGCAGGAGAGAGAGGAGGG - Intergenic
1155354978 18:24943271-24943293 AAGAAAAAGCAGAGAAAGGGAGG + Intergenic
1156036919 18:32774301-32774323 AAAAAGAAGCAGAAAAAGGAAGG + Exonic
1156392698 18:36665744-36665766 GTGAAGAAGCAGAGAGGAGATGG + Intronic
1156406318 18:36786080-36786102 AAGGTGAAGCAGAGACAGGAAGG + Intronic
1157136227 18:45058537-45058559 ATGAAGAAACAGAGATGGAGGGG + Intronic
1157238013 18:45982174-45982196 TTGAAGAAGTAGTGATAGGATGG + Intergenic
1157334135 18:46724974-46724996 AGGAAGAAAGAGAGAGAGGAAGG + Intronic
1157930958 18:51822825-51822847 AAGAAGAGGCAGGGACAGGAAGG - Intergenic
1158293374 18:55967310-55967332 GTGCAGAACAAGAGATAGGATGG - Intergenic
1158355051 18:56608698-56608720 ATGCAGAAGCAGATATGAGAAGG + Intronic
1158434396 18:57425424-57425446 ATGAGGAAGAAGTGATAGGAAGG - Intergenic
1158442133 18:57485690-57485712 ACAAAGAAGCAAAGAGAGGAAGG + Exonic
1158646645 18:59254481-59254503 AAGAAGAAGAAGAGATAGGCTGG - Intergenic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1158991979 18:62878370-62878392 ATGAAGTAGCAGAGAGAGGGAGG - Intronic
1159137757 18:64356998-64357020 ATGAAGTAGCATAGACTGGATGG + Intergenic
1159230616 18:65603905-65603927 AGGTAGAAGCAGTAATAGGAAGG - Intergenic
1159300976 18:66567274-66567296 AGCAAGAAGCAGAGGGAGGAAGG + Intronic
1159600824 18:70427196-70427218 AGGAAGAAGCAGATAAAGGAAGG - Intergenic
1159773199 18:72573408-72573430 ATGAATAAGCAGAGCACGGAAGG - Intronic
1159801388 18:72904523-72904545 AAGATGAGGCAGAGACAGGAGGG + Intergenic
1160047291 18:75398780-75398802 ATGAAGAGAGAGAGAGAGGAAGG - Intergenic
1160098709 18:75900915-75900937 AGGAAGAAGCAGAGAAGGAAGGG + Intergenic
1161417438 19:4155341-4155363 AAGAAGAAAGAGAGAAAGGAAGG - Intronic
1161458131 19:4380172-4380194 AGGAAGAAGCAAGGAAAGGAGGG - Intronic
1162104702 19:8363403-8363425 AGGAAGAAGGAAAGAAAGGAAGG - Intronic
1162680353 19:12335856-12335878 ATGAAGACCCAGAGATACAAAGG - Intergenic
1162880531 19:13655544-13655566 ATGAAGACCCAGAGATACAACGG - Intergenic
1162933474 19:13968766-13968788 TCGCAGAAGCAGAGGTAGGAAGG - Exonic
1163113059 19:15173045-15173067 AAGAAGAAGAAGAGGGAGGAGGG - Intronic
1163149163 19:15401018-15401040 AAGAAGAAGAAGAGAAAGCAGGG - Exonic
1165451185 19:35884335-35884357 ATGAAGATGCAGTAAGAGGATGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166174976 19:41061343-41061365 ATGAAAAAGCTAAGATAGGCCGG - Intergenic
1166301826 19:41915414-41915436 ATGGAGACCCAGAGATGGGAGGG - Intronic
1166651063 19:44575549-44575571 ATTAAGAAGCAGACATAACATGG - Intergenic
1166672688 19:44720855-44720877 TTTAGGAAGCAGAGGTAGGAGGG - Intergenic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167359165 19:49020700-49020722 ATGGAGACTCAAAGATAGGAGGG + Intergenic
1167419797 19:49396077-49396099 ATGATGGAGCAGAGGTAGGCGGG - Intronic
1167806393 19:51789262-51789284 ATCAAAAAGGAGAAATAGGAAGG + Intronic
1167867133 19:52337373-52337395 GAGAGGAAGCAGAGATAGGGAGG + Intronic
1168114849 19:54216604-54216626 ATTAAGAAGCATAAATAGGCCGG - Intronic
1168161525 19:54513313-54513335 TTGAGGGAGCAGAGAGAGGAAGG + Intergenic
925189490 2:1871371-1871393 ACTGAGGAGCAGAGATAGGAGGG - Intronic
925203161 2:1985238-1985260 ATCAAGAAGAGGAGATAGGAGGG + Intronic
925837991 2:7964679-7964701 CTGGAGAAGCAGAGGTAGGGCGG - Intergenic
925842588 2:8006566-8006588 ATGGAGGAGAAGAGAGAGGAGGG - Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
927208838 2:20626531-20626553 ATGAGGAAGGTGATATAGGATGG + Intronic
927360970 2:22232990-22233012 ATGAAAAAGCAGAAACAGAAAGG + Intergenic
927960332 2:27237327-27237349 AGGAAGATTCAGAAATAGGAAGG - Intronic
928063669 2:28141013-28141035 AAGAAAAAGAAGAGATATGAGGG - Intronic
928542484 2:32296103-32296125 ATGAAGAACCAGTGGTAGGTAGG - Intronic
928773384 2:34729484-34729506 ATGTAGAATAATAGATAGGATGG - Intergenic
929627135 2:43420991-43421013 ATCTAGAAGCAGAGATTGGAAGG - Intronic
930037284 2:47094607-47094629 AAGAATAAACGGAGATAGGAGGG + Intronic
930371466 2:50506740-50506762 AGGAAGAAAGAGAGAGAGGAGGG + Intronic
930840812 2:55842819-55842841 ATGAGGAAGAAGAGATAGGGAGG + Intergenic
930919608 2:56736415-56736437 ATGAAGCTGGAGAGAGAGGATGG - Intergenic
931063695 2:58560380-58560402 ATGAAGAAATGGAGAAAGGATGG + Intergenic
931809486 2:65840960-65840982 AAGAAGAAGCAGAGAGTAGAGGG - Intergenic
931844036 2:66184258-66184280 ATGCAGAATCAGAGATAAAAGGG + Intergenic
932056866 2:68454471-68454493 ATGAACTACCAGATATAGGAAGG + Intergenic
932170210 2:69548498-69548520 AGGAAGAAAGAGAGAAAGGAAGG - Intronic
932355419 2:71064549-71064571 ATGAGGAAGGAGAGAGAGGCTGG - Intronic
932556457 2:72829181-72829203 ATGTAGAAGCAGAGATAGAGTGG - Intergenic
932688186 2:73891354-73891376 AAGACGAAGCAGAGTCAGGAAGG + Intergenic
932823654 2:74921701-74921723 GTGAAGAAGTGGAGAAAGGAGGG - Intergenic
932961644 2:76419292-76419314 AGGAAGAAACAGAGGAAGGAAGG - Intergenic
933302766 2:80561213-80561235 ATTAAGTATTAGAGATAGGAAGG + Intronic
933983421 2:87572072-87572094 GTGAAGATGCAGAGACAGGTTGG - Intergenic
935854977 2:107263944-107263966 ATGAGGAAGCAGAGACTGGAGGG - Intergenic
935923067 2:108035829-108035851 ATCAAGAAGTAGTGAGAGGAAGG - Intergenic
936310427 2:111378722-111378744 GTGAAGATGCAGAGACAGGTTGG + Intergenic
936544572 2:113379942-113379964 AGGGAGAAGCACAGATAGAAAGG - Intergenic
936859227 2:116996140-116996162 ATGAAAAGGCATAGATGGGAAGG - Intergenic
936944348 2:117917175-117917197 ATGAGGCAGCAGAAATATGAGGG + Exonic
937920040 2:127122402-127122424 AGGGAGGAGCAGAAATAGGAGGG - Intergenic
938698924 2:133859171-133859193 AAGGAGAAGCTGAGATAGGCAGG - Intergenic
939362846 2:141196058-141196080 ATGAGGTAGCAAAGATAGGCAGG + Intronic
939459159 2:142476769-142476791 ATGAAGAAGCAGATTTAGGCTGG - Intergenic
939701933 2:145402780-145402802 ATGAAGCAGGAGAGATAAGCAGG - Intergenic
940153684 2:150630341-150630363 ATGAAGACACACAGAAAGGAAGG + Intergenic
940480645 2:154226122-154226144 ATGAATGAACAGAGACAGGAGGG + Intronic
941270591 2:163422532-163422554 ATAAAGAAGAAGACATAGGAAGG + Intergenic
941292855 2:163697904-163697926 ATGAAGATAGAGAGATTGGAGGG - Intronic
941451594 2:165666605-165666627 ATGAAGAAAGAGAGAAAGGAAGG + Intronic
941622200 2:167790616-167790638 ATTTTGAAGAAGAGATAGGAGGG - Intergenic
942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG + Intronic
942943272 2:181644946-181644968 ATGAGGATGCAGAGATAGGCAGG + Intronic
942943476 2:181647114-181647136 ATGAAGCTGAAGAGATGGGATGG + Intronic
943438426 2:187896308-187896330 AGGAATAAGCAGAGATAGAGAGG + Intergenic
943788364 2:191903050-191903072 AGAAAGAAGGAAAGATAGGAAGG + Intergenic
944271412 2:197787626-197787648 GTGATGAAGCAGAGATTTGAAGG + Intergenic
944842451 2:203637367-203637389 GTGAGGAAGTAGAGAAAGGAGGG + Intergenic
944868872 2:203889774-203889796 AAGAAGAAGAAGAGCTAGGTAGG + Intergenic
945148951 2:206767765-206767787 TTGAAGAAGGAGAGAAGGGAAGG + Intronic
945644324 2:212470274-212470296 GTGAAGAAGCACAGAGAGGCTGG - Intronic
946383233 2:219363891-219363913 ATAAAGCAGCAGAGAAAGGGTGG + Intergenic
946842726 2:223834647-223834669 CTCAAGAAGCTGAGGTAGGAGGG + Intronic
947005941 2:225511243-225511265 ATGAAGAATATGAGAAAGGATGG - Intronic
947760414 2:232599956-232599978 GTGAAGAAGCAGAGCCCGGAAGG + Intergenic
948068060 2:235096893-235096915 AGGCAGAGGCAGAGATTGGAGGG - Intergenic
948721868 2:239905783-239905805 AAGAAGAAGCGGGGAGAGGAGGG + Intronic
1168993732 20:2116695-2116717 ATGACAAACCAGAGATAGCAGGG - Exonic
1169396429 20:5234862-5234884 AAGAAGAGGCAGTGATAGAAAGG + Intergenic
1169548945 20:6681486-6681508 ATGAATAAGCAAAGAGAGAAAGG - Intergenic
1169555787 20:6748338-6748360 ATGCAGAAGCAGACAAAAGATGG + Intergenic
1169598912 20:7234381-7234403 AGGAAGAAGGAGATGTAGGAAGG - Intergenic
1169813799 20:9635426-9635448 ATGGACAAGTAGAGATTGGATGG - Intronic
1171030076 20:21669185-21669207 CAGGAGAAGCAGAGAAAGGAGGG - Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171444980 20:25196467-25196489 AAGAGGAAGGAGAGATGGGAGGG + Intronic
1171770723 20:29320330-29320352 AGCAAGAAACAGAGAGAGGAAGG + Intergenic
1171813419 20:29763097-29763119 AGCAAGAAACAGAGAGAGGAAGG + Intergenic
1171905034 20:30893612-30893634 AGCAAGAAACAGAGAAAGGAAGG - Intergenic
1171905817 20:30899239-30899261 AGCAAGAAACAGAGAGAGGAAGG - Intergenic
1172034866 20:32003433-32003455 ATGAGGAAGGAGGGATAGGTAGG + Intergenic
1172227040 20:33311966-33311988 ATAAAGGAGCAGAGAGAAGAAGG - Intergenic
1172377534 20:34456955-34456977 ATTAAGTAGCAGAGATGAGATGG - Intronic
1172804686 20:37603430-37603452 AGGAAGAAACAAAGAAAGGAAGG - Intergenic
1172972394 20:38883079-38883101 AGGAAGGAAGAGAGATAGGAGGG + Intronic
1173704041 20:45097082-45097104 ATGAAGAAGCTGAGGTTGAAGGG - Intronic
1173845976 20:46189067-46189089 AGAGAGAAACAGAGATAGGAAGG + Intronic
1174062778 20:47844236-47844258 AGGAAGAAACAAAGAAAGGAAGG + Intergenic
1174464542 20:50707146-50707168 ATGAAGCTGCAGAGATAAGGAGG + Intergenic
1174466371 20:50720742-50720764 ATGAAGAAACTGAGTCAGGAAGG + Intergenic
1175363290 20:58432031-58432053 ATGAAGAAGCTGAGGGATGATGG + Intronic
1175459573 20:59142214-59142236 ATGAAGGAGCAGAGCCATGAAGG + Intergenic
1175604089 20:60298369-60298391 AGGCAGAGGCAGAGATGGGAGGG - Intergenic
1176511308 21:7750661-7750683 AAGAAGAGGCAGTGAGAGGATGG + Intronic
1176668484 21:9709608-9709630 ATCAAGACGCAGAGGAAGGAAGG + Intergenic
1177345519 21:19863536-19863558 ATGAAGAGGCAGAGATTAGAAGG + Intergenic
1177850999 21:26348603-26348625 AAGAAGAAAAAGAGATGGGATGG - Intergenic
1178282365 21:31294398-31294420 GTGGAGAAGCAGAGTTAGAAAGG - Intronic
1178645422 21:34381190-34381212 AAGAAGAGGCAGTGAGAGGATGG + Intronic
1178910509 21:36669648-36669670 ACACAGAGGCAGAGATAGGAGGG - Intergenic
1179128856 21:38616468-38616490 ATGAATAAGAATAGATAAGAGGG + Intronic
1179142877 21:38742160-38742182 AGGAAGAAGTAGAGAAGGGAGGG + Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180234610 21:46450266-46450288 ATTAGGAGGCAGAGAGAGGATGG - Intergenic
1180316104 22:11278148-11278170 AGCAAGAAACAGAGAGAGGAAGG + Intergenic
1180317169 22:11285313-11285335 AGGAAGAAGCAAACAAAGGAAGG - Intergenic
1180338467 22:11599797-11599819 ATCAAGAAACAGAGAAAGGAAGG - Intergenic
1180339233 22:11605340-11605362 AGCAAGAAACAGAGAGAGGAAGG - Intergenic
1180387977 22:12197371-12197393 ATTAAAAAGCAGAGACATGAAGG + Intergenic
1180645769 22:17337610-17337632 GAGAAGAGGCAGAGAAAGGATGG - Intergenic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1181682279 22:24503736-24503758 ATGAAGAGTCAGAGAGAGTATGG - Intronic
1182404667 22:30115797-30115819 ATGAAGAAGGAGGGATTGGATGG + Intronic
1182706370 22:32283120-32283142 ATGCAGAAGGAGCAATAGGAGGG - Intergenic
1182722278 22:32412986-32413008 ATGACGAAACAGAGATAAGAGGG - Intergenic
1182806383 22:33074172-33074194 ATAAAGAAGAAGAGTGAGGAGGG - Intergenic
1182824429 22:33252352-33252374 ATGGAGAAGGAGAGTTAGGCTGG - Intronic
1182845353 22:33426455-33426477 ATTAAGATGCAGAGAAATGAAGG + Intronic
1183669066 22:39261592-39261614 ATGAGGAAACAGAGATATCAAGG + Intergenic
1183730179 22:39614158-39614180 ATGAAGAAACTGAGACAGAAGGG - Intronic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1184103972 22:42356830-42356852 ATGAAGAAACAGAGAGGTGAAGG + Intergenic
1184704784 22:46203382-46203404 AAGAAAAAGCAGAGATAAAATGG - Intronic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
949904668 3:8849035-8849057 GTGCAGAAGCAGAGACAGGGAGG - Intronic
950276648 3:11666942-11666964 ATGAGGAAGCGGAGTCAGGAAGG - Intronic
950670315 3:14521877-14521899 ATGAAGAAGCAGGGAATGGGTGG + Intronic
951072461 3:18347700-18347722 CTTAATAAGTAGAGATAGGATGG - Intronic
951578480 3:24137641-24137663 ATGAGGAAGCAGAGGTAGGCAGG + Intronic
951580100 3:24153610-24153632 CTGAAGGAGCAAAGACAGGAGGG - Intronic
951807532 3:26662919-26662941 ATGAGGAAGGAGGGATATGAGGG + Intronic
951932645 3:27985921-27985943 ATGAAGACACAGAGAGAAGATGG + Intergenic
952516944 3:34114011-34114033 ATGAAGAAGAAGAAAAAGAAAGG - Intergenic
952657010 3:35799045-35799067 TTGAACACACAGAGATAGGATGG + Intergenic
953470905 3:43165196-43165218 ATGAAGAAACAGATTTATGAAGG - Intergenic
953759375 3:45674661-45674683 CTGAAGCTGCAGAGCTAGGAGGG + Intronic
954110778 3:48431612-48431634 ATGGAGAGGCAGTGATAGGGAGG - Intergenic
954299449 3:49691666-49691688 AGGAAGAAGCAGAGTACGGAAGG - Intronic
955621519 3:60869430-60869452 ATTGAGAAGCAGAGATAGAAGGG - Intronic
955871398 3:63442224-63442246 ACAAAGAGACAGAGATAGGAAGG + Intronic
956475595 3:69616936-69616958 ATGAAGAAACTGAGATATTATGG + Intergenic
956639110 3:71397942-71397964 AGGAAGAAGCAGAGAGAGTGGGG + Intronic
957036525 3:75298469-75298491 AGGAAGAAGGAAAGAAAGGAAGG + Intergenic
957117534 3:76045816-76045838 AAGAAGAGGAAGAGAGAGGAAGG - Intronic
957504352 3:81100492-81100514 TTTAAGAAGCAGAGATGAGATGG - Intergenic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
957792777 3:84960566-84960588 AAGAAGCGGCAGAGAGAGGATGG - Intronic
957866490 3:86031086-86031108 ATGAATAAACAGACTTAGGAAGG + Intronic
957953842 3:87158796-87158818 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
959451633 3:106510759-106510781 AGGAAGAAGCAAAGAAAGGAAGG - Intergenic
959481516 3:106878448-106878470 AGGAAGAAGAAGAGGGAGGAAGG - Intergenic
959560708 3:107777330-107777352 GTTGAGAAGCAGAGATAAGAGGG - Intronic
959637669 3:108593307-108593329 ATGAAAAAACTAAGATAGGAAGG + Intronic
959813631 3:110649417-110649439 ATAAACAAGCAGAGATAGAGAGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960128927 3:114032377-114032399 ATGAGGAAGAATAGATAGGTGGG - Intronic
960676652 3:120201814-120201836 ATTAAGAACCAGTGATAGGAAGG + Intronic
960884563 3:122381427-122381449 AAGAAGAGGAAGAGATAGGCTGG + Intronic
961080259 3:124020924-124020946 GTGAAGAAGGAAAGAAAGGAAGG + Intergenic
961547119 3:127642382-127642404 ATGAAGCAGCAGATTTATGAAGG + Intronic
961902395 3:130225657-130225679 ATAAAGAAACAGAGATAAGAAGG + Intergenic
962886639 3:139633774-139633796 ATGAAGCTGCAGAGAGTGGAAGG + Intronic
963728452 3:148947673-148947695 ATGAAGAAACAGAGAAGGAAAGG + Intergenic
963905173 3:150767641-150767663 CTTACGTAGCAGAGATAGGAAGG + Intergenic
964430312 3:156598741-156598763 ATGAAGAAGCAGCGAGAAAATGG + Intergenic
964514009 3:157486611-157486633 ATGAGGAAACAGACATAGAAAGG - Intronic
964620513 3:158716168-158716190 AGGAAGAAGCTGAGTTGGGAGGG + Intronic
965117362 3:164508454-164508476 AGGAAGAAGAAGAGGAAGGAAGG - Intergenic
966231547 3:177657810-177657832 ATGTAGAAGCAGAGTTGTGATGG + Intergenic
966378054 3:179317188-179317210 ATGAAGAAACAGATTTAGGCTGG - Intergenic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
967199632 3:187060546-187060568 ATGAAGACACATAGTTAGGAAGG + Intronic
967372301 3:188760364-188760386 AGGAAGAAGCAAAGATCTGATGG - Intronic
967562829 3:190936714-190936736 AGGGAGAAAGAGAGATAGGAAGG - Intergenic
967693635 3:192506073-192506095 AAGGTGAAGCAGGGATAGGAAGG + Intronic
967949752 3:194831738-194831760 ATGAAACAGGAGACATAGGAGGG + Intergenic
969502644 4:7562632-7562654 ATGAAGGACCACAGATTGGATGG + Intronic
969657308 4:8505654-8505676 ATGAGGAAGCAGAGACAGAGAGG + Intergenic
969997414 4:11326981-11327003 AGCCAGAAGAAGAGATAGGATGG - Intergenic
970071358 4:12163111-12163133 ATGAAGAGGAAGAGATGGGTAGG + Intergenic
970216867 4:13767832-13767854 ATGAAGATGCTGAGAGAGTAAGG - Intergenic
970382668 4:15523729-15523751 AAGAAGAATCAGAGAAAAGAGGG - Intronic
970689328 4:18603888-18603910 GTGAAGAAGAAGAGAAAGCAGGG - Intergenic
970808063 4:20059446-20059468 ATGGGGAAGCAGACATAGAAAGG + Intergenic
970924763 4:21438863-21438885 ATTAAAAAGTAGAGAAAGGACGG + Intronic
971444825 4:26732025-26732047 AAGAAGAAGAAAAAATAGGAAGG - Intronic
971521299 4:27555133-27555155 AAGAAGAAAAAGAGAAAGGAAGG - Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971735660 4:30447116-30447138 GTGAAGAAGCATACACAGGAGGG + Intergenic
972129296 4:35809976-35809998 AGAAAGAAACAGAGAGAGGAGGG - Intergenic
972623163 4:40768911-40768933 GTGAAAAAGTAGAGAAAGGAGGG + Intronic
973730797 4:53820611-53820633 ATGAAGGGGGAGAGAAAGGAGGG - Intronic
973835634 4:54806580-54806602 AGGAAGGAGCAAAGAAAGGAAGG - Intergenic
974389207 4:61243435-61243457 AGGGAGAAGCAGAGATTGGGTGG - Intronic
975357672 4:73426897-73426919 AGGAAGAAAAAGAGATTGGAAGG - Intergenic
975390656 4:73813400-73813422 ATGAGGATGGAGAGACAGGATGG + Intergenic
975612051 4:76213358-76213380 ATGTAGCAGCAGGGATGGGAGGG + Intronic
975891368 4:79032631-79032653 ATGGAGAGGCAGAGGTGGGAGGG + Intergenic
975931905 4:79534667-79534689 ATGCAGAATCAGAGATCTGAGGG + Intergenic
976007387 4:80446110-80446132 ATGAGGAAGAAGAGAGAGGAAGG + Intronic
976314825 4:83648200-83648222 ATTAACAATCAGAGATAGAATGG + Intergenic
976380881 4:84396936-84396958 ATGAAGAAGAAAAAATATGATGG + Intergenic
976441574 4:85081965-85081987 ATGAAGATGTAGAAATAGCAAGG - Intergenic
976621798 4:87135885-87135907 ATGCAGAAGCAGAGATGAGGAGG + Exonic
976671074 4:87654330-87654352 ATGAGGGGCCAGAGATAGGAGGG + Intronic
976747385 4:88417488-88417510 ATGAAGCAGCTGAGAGATGATGG - Exonic
976858079 4:89628474-89628496 ATGAAGAGGGAGAGGTAGGAAGG - Intergenic
977002885 4:91525734-91525756 AAGAAGAAGCATAGGTAAGAGGG - Intronic
977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG + Intergenic
977230532 4:94447265-94447287 AATAAGAAGGATAGATAGGATGG - Intergenic
977790927 4:101102214-101102236 ATGAAGAAGGAAAGAAAGGAGGG + Intronic
977914404 4:102575367-102575389 ATGAACAAGCTAAGGTAGGAAGG - Intronic
978927489 4:114266355-114266377 CTTAGGAAGCTGAGATAGGAGGG - Intergenic
979478911 4:121191165-121191187 ATGAAGAAGCAGAGACTATAAGG + Intronic
979662282 4:123270998-123271020 ATGAAGAAGCAAAGCCATGAAGG + Intronic
979702701 4:123686344-123686366 ATGAAGATGGAGAGGTAGGTAGG + Intergenic
979804894 4:124959351-124959373 ATGAAGAACCACATATATGATGG - Intergenic
979931552 4:126638537-126638559 ATCAGGAAGCAGTGATGGGAAGG + Intergenic
980395671 4:132211733-132211755 ATGAAGTATAAGAAATAGGAAGG + Intergenic
982057081 4:151562273-151562295 ATGAAGAAGGAGGGGTAGGAAGG + Intronic
982097620 4:151937040-151937062 ATGATGAAGCAGAGAGATGCAGG - Intergenic
982240646 4:153296256-153296278 AAGAGGAAGAAGAGAAAGGAGGG - Intronic
982246060 4:153352456-153352478 ATGAAGAAACAGACATAGAGAGG - Intronic
982413247 4:155103347-155103369 ATGTAAAAGCAGGGATTGGAGGG - Intergenic
982554688 4:156843972-156843994 TAGAAGAAGCAGAAATAGCAAGG - Intronic
984005387 4:174299879-174299901 ATGAAGAAACAGAATTATGAAGG - Intronic
984581230 4:181512064-181512086 ATGAAGAAGGCGAGAAAGCAGGG - Intergenic
984617284 4:181913200-181913222 ACGCAGAAGCCGAGACAGGAAGG + Intergenic
984664181 4:182407792-182407814 ATAAAGAAGCAAAGATATTATGG - Intronic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
984781212 4:183527405-183527427 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
985040043 4:185880986-185881008 GTGAAGAAAAAGAGAAAGGAAGG + Intronic
985246718 4:187986457-187986479 AGGAAGACACAGAGACAGGAAGG + Intergenic
985406295 4:189641900-189641922 ATCAAGACGCAGAGGAAGGAAGG - Intergenic
985996623 5:3600575-3600597 CGGAAGAGGCAGAGTTAGGACGG - Intronic
985997758 5:3606265-3606287 ATGAGGAGGCAGAGAAAGGGCGG + Intergenic
986470375 5:8067830-8067852 ATGAAGTAGGAGAGAAAGGAGGG + Intergenic
986990811 5:13550971-13550993 AAGAAGAAGAAGAGATGGGATGG + Intergenic
987074518 5:14368314-14368336 ATGAACAAGCAGAGAAAAGGTGG - Intronic
987112212 5:14698954-14698976 ATGAAGAAACAGATTTAGGGAGG - Exonic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987215708 5:15734611-15734633 AGCAAGAAACAGAGAAAGGAAGG - Intronic
987255160 5:16143119-16143141 ATGAAGGAACAGAGAAAGGAGGG - Intronic
988032502 5:25781848-25781870 ACGAAGAAGGAGAGAAAGGGTGG - Intergenic
988425451 5:31058380-31058402 AAGAAGAAGCAGAGTTATAATGG + Intergenic
988481029 5:31630737-31630759 ATGAAGATCTAGAGATGGGAAGG + Intergenic
989603377 5:43220849-43220871 TTGAAGAAGCCGAGAGAAGAAGG + Intronic
989654444 5:43731112-43731134 AAGAAGAAGAAGAGAGAGGGAGG - Intergenic
989720517 5:44522789-44522811 ATGAAGGAGGAGAGATAACAAGG - Intergenic
990262286 5:54036416-54036438 ATGTAGAAGTAGAAATTGGATGG - Intronic
990821383 5:59844597-59844619 AGGAAGAACCAGATATATGAAGG - Intronic
990895010 5:60689720-60689742 ATGTAGAAGCAGAAATATAACGG + Intronic
991029024 5:62063332-62063354 AGGAAGAAGCAGAGAAAGCTTGG + Intergenic
991368283 5:65891787-65891809 ATAAAGAATCAGGCATAGGAGGG + Intergenic
992250722 5:74873466-74873488 ATGAAGCTGCAGAAATAGGCAGG + Intergenic
992282533 5:75196490-75196512 CAGAAGAAGCAGAGATGGCATGG + Intronic
992560245 5:77944886-77944908 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
993033711 5:82733739-82733761 ATGAAGGATGAGAGACAGGAGGG + Intergenic
993830694 5:92753877-92753899 ATGAAGAAACAGGGAGAAGATGG + Intergenic
993860714 5:93133535-93133557 TTGAAGAACCAGATTTAGGAAGG - Intergenic
994026149 5:95086842-95086864 ATTAATAATCAGATATAGGAAGG - Intronic
994410308 5:99399852-99399874 ATGAAGAAACAGAAATAGCTTGG - Intergenic
994483512 5:100365424-100365446 ATGAAGAAACAGAAATAGCTTGG + Intergenic
994504720 5:100628287-100628309 ATGAAGAAGCACACTTTGGATGG - Intergenic
994582190 5:101658391-101658413 ATGAAAAAGCAGATATAAAAGGG + Intergenic
995910361 5:117179612-117179634 ATGAAGAAGCAGGGGAAGCAGGG + Intergenic
996153224 5:120065285-120065307 ATGAACAAGCTGAGATGGAATGG + Intergenic
996185918 5:120475160-120475182 ATGAAGAAGCACAGACAGAGAGG + Intronic
996553598 5:124755113-124755135 AAGAAGAAGCAGAGAAATGGAGG - Intergenic
997281209 5:132647277-132647299 ATGAAGAAGCAGATTTTGGATGG - Intergenic
997333584 5:133086258-133086280 GGGAAGAAGAAGAGATGGGAAGG - Intronic
997437435 5:133885467-133885489 AAGAGGAGGCAGAGAAAGGAGGG + Intergenic
997606141 5:135176993-135177015 CTGAAGAAGCAGGGAATGGAGGG + Intronic
997787212 5:136724429-136724451 ATGTAGAAACATAGACAGGAAGG - Intergenic
998454248 5:142258691-142258713 AGAAAGAGGCAGAGATTGGAGGG + Intergenic
998953581 5:147415664-147415686 AAGAAGAAGCTAAGAGAGGAGGG + Intronic
999334700 5:150705514-150705536 ATGAAGGGCCAGAGACAGGAAGG + Intergenic
999371334 5:151057018-151057040 ATGAGGAAGCAGAGGGAGAATGG - Intronic
999454143 5:151700879-151700901 AGGCAGAGGCAGAGATAGAAAGG + Intergenic
999809962 5:155118252-155118274 AAGAAAAAGCAGAGGAAGGAGGG + Intergenic
1000293097 5:159889561-159889583 ATGAAGAAGTAGAGACAGAGAGG + Intergenic
1000668941 5:164035756-164035778 AAGAAAGAGCAGAGAAAGGAAGG - Intergenic
1000728788 5:164804760-164804782 AAGAATAAGCAAAGATAGGCCGG - Intergenic
1000810132 5:165851234-165851256 ATGAAGAAGCTAAGGTAGAAAGG + Intergenic
1000910701 5:167018646-167018668 ATGAAGATACAGAGATTAGATGG - Intergenic
1000953998 5:167520753-167520775 ATGAGGAAGCAGGAATAGGGAGG - Intronic
1001142674 5:169158021-169158043 AAGAAGAGGGAGAGAAAGGATGG + Intronic
1001716226 5:173818467-173818489 AGGAAGTAACAGAGATTGGAAGG + Intergenic
1001810092 5:174620976-174620998 ATGAAGAGGCAGAGATAGGAAGG - Intergenic
1001917181 5:175571590-175571612 ATGCAGGAGCAGGGAGAGGAAGG - Intergenic
1001968820 5:175937398-175937420 AGGAGGAGCCAGAGATAGGATGG + Intronic
1002248625 5:177906345-177906367 AGGAGGAGCCAGAGATAGGATGG - Intergenic
1002414131 5:179109955-179109977 AGGGAGAAGCAGGGGTAGGAAGG - Intergenic
1002851748 6:1003099-1003121 AGGAAGAGGCAGAGAGAGAAAGG - Intergenic
1002952475 6:1828340-1828362 CAGAAGAAGCAGAGAGAAGAAGG + Intronic
1002953716 6:1841733-1841755 ATGTAGAGACACAGATAGGAAGG + Intronic
1003014133 6:2454418-2454440 ATGAAGCAGCGGAGACATGAAGG - Intergenic
1003093591 6:3124755-3124777 ATGTAGAACCACGGATAGGAAGG + Intronic
1003265035 6:4558195-4558217 TAGGAGAACCAGAGATAGGATGG + Intergenic
1003384987 6:5659154-5659176 GTGAACAAGCAGAGAAAAGATGG - Intronic
1003631144 6:7788858-7788880 AAAAAAAAACAGAGATAGGATGG - Intronic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1005197876 6:23310181-23310203 AAGAAGCAGAAGATATAGGAGGG + Intergenic
1005283828 6:24303075-24303097 ATGAACAAGCAGAGACAGCCGGG - Intronic
1006252698 6:32802534-32802556 ATGAAGAAGTGGAAATGGGAGGG - Intergenic
1006809753 6:36812244-36812266 ATGAGGAAGCAGAGCTCAGAGGG - Intronic
1007256007 6:40529165-40529187 TGGAAGAAGCAGAGAGAGCAGGG + Intronic
1007615516 6:43177617-43177639 ATTAAGAAGGAGAGAGAGGCCGG + Intronic
1007825581 6:44598301-44598323 CTGAAAAAGCAGAGAAATGAGGG - Intergenic
1007938472 6:45754802-45754824 CTGAGAAAGAAGAGATAGGAAGG - Intergenic
1008300716 6:49835865-49835887 ATTAAAAAGCACATATAGGATGG + Intronic
1009291324 6:61886382-61886404 ATTTAGAAGCAGAGAGAAGAGGG - Intronic
1009349054 6:62651941-62651963 AAGAAAAAGCAGAGAGAAGAGGG - Intergenic
1010485665 6:76410430-76410452 AGGAAGAAGAAGAGGAAGGAAGG - Intergenic
1011388383 6:86822509-86822531 AGGAAGAATCAGAGATCAGATGG - Intergenic
1011412153 6:87076987-87077009 ATGAGGCTGCAGAGATAGGTTGG + Intergenic
1011501904 6:87999858-87999880 ATGAAAAAGCAGCAAGAGGATGG + Intergenic
1011589665 6:88960043-88960065 TTGAGGAAGAAGAGATGGGAAGG - Intronic
1012167653 6:95978462-95978484 ATGACTAAGCAGAGAAGGGAGGG - Intergenic
1012989241 6:105908169-105908191 ATGAGGAAGCAGGAATAGGCGGG - Intergenic
1013289544 6:108708539-108708561 ATGAAGACTCCGTGATAGGAAGG - Intergenic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1013491651 6:110652747-110652769 ATGAAGACACAGAGAGAGAAAGG + Intronic
1013521509 6:110937954-110937976 ATGAACAAGAAGAGACTGGAAGG + Intergenic
1013787302 6:113796137-113796159 ATGAAGATGCAGAGCTTGAAAGG - Intergenic
1013836298 6:114340594-114340616 ATGACCAAACAGAGAGAGGAAGG + Intronic
1013990620 6:116251045-116251067 ATGCAGAAGCTGAGAAATGAGGG + Exonic
1014062069 6:117083064-117083086 AAGAAGAATGAGAGCTAGGAGGG - Intergenic
1015214239 6:130731695-130731717 ATGAAGAGTGAGAGAAAGGAGGG - Intergenic
1016142840 6:140634313-140634335 AGGAAGAAAGAGAGAAAGGAAGG - Intergenic
1016356594 6:143225135-143225157 TTGAACAGGCAGAGACAGGAGGG - Intronic
1016799221 6:148152160-148152182 ATGTAAAAGCAGAGATAAGCAGG + Intergenic
1016850768 6:148616535-148616557 GTGATGAAGCAGAGAGGGGAAGG + Intergenic
1016962433 6:149686864-149686886 GTCAAGAAGCTGAGATATGAGGG - Intronic
1016984846 6:149887378-149887400 GTGAATATGCTGAGATAGGAAGG - Intronic
1017076565 6:150624290-150624312 GACAAGAAGCAGAGATAGGCAGG - Intronic
1017625609 6:156345391-156345413 AAGGAGAGGGAGAGATAGGAAGG - Intergenic
1017650911 6:156581720-156581742 ACGAAGAACAAGAGAAAGGATGG + Intergenic
1018378105 6:163232539-163232561 AATAAGAAGCAGAGATGAGAAGG + Intronic
1018423576 6:163661199-163661221 AAGATGAAGCAGTGATAGCAGGG - Intergenic
1018504206 6:164446172-164446194 ATCAAAAAGCAGAGGGAGGATGG + Intergenic
1019118823 6:169787021-169787043 AGGAAGAAGGAGAGGAAGGAAGG - Intergenic
1019495487 7:1337766-1337788 AGAAAGAAGGAGAGAGAGGAGGG - Intergenic
1019627980 7:2030903-2030925 ATGAGGAAGAACAGAGAGGATGG - Intronic
1019730527 7:2627213-2627235 AGGAAGAAAGGGAGATAGGAGGG + Intergenic
1020648232 7:10842332-10842354 ATGAAGTAGCAGTTGTAGGAAGG + Intergenic
1020903729 7:14038820-14038842 GTGAAGATGCAGAGATACAAAGG + Intergenic
1020914970 7:14181604-14181626 AAGAAGAATCATAGATAGGAAGG + Intronic
1021114521 7:16732504-16732526 ATAAAGAAGGAAAGAAAGGAAGG - Intergenic
1021206432 7:17786697-17786719 ATGAGGAAGCACAGATAGTCTGG + Intergenic
1021267960 7:18548002-18548024 ATGATTAAGCTGAGTTAGGAAGG - Intronic
1021402585 7:20226454-20226476 ATGAGAATGGAGAGATAGGAAGG - Intergenic
1021508250 7:21408615-21408637 ATGAGGAAGTAGAGGTATGAAGG + Intergenic
1021665087 7:22969095-22969117 ATGAAGATGATGAGATGGGAGGG + Intronic
1022131058 7:27405027-27405049 ATGGAGAACCAAAAATAGGAAGG + Intergenic
1022566893 7:31412877-31412899 ATGAAGAAGGAGGGAAAGGAAGG + Intergenic
1023836289 7:44069825-44069847 AGGGAGAAGGAGAGATAGGAGGG + Intergenic
1024250196 7:47500642-47500664 ATGAAGAAGCTGAGTTCAGAGGG + Intronic
1024271764 7:47647787-47647809 GAGAAAAAGCAGAGCTAGGAGGG - Intergenic
1026100424 7:67379538-67379560 ATGGAGCAACAGAGATAGAAGGG + Intergenic
1026104155 7:67407864-67407886 ATGAGGAAGGGGAGACAGGAGGG - Intergenic
1026501754 7:70948643-70948665 ATGGAGCAAGAGAGATAGGAGGG - Intergenic
1026869001 7:73839622-73839644 GTGAGGAAGCAGTGAGAGGAAGG + Intronic
1027386353 7:77662993-77663015 GGGAAGAAGGAGAGAGAGGAAGG + Intergenic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1028167600 7:87556492-87556514 ATGTAGAAGCAGAGAAGGGAAGG + Intronic
1028472463 7:91220089-91220111 ATGAAAATGGAGAGAAAGGAAGG - Intergenic
1028854899 7:95579520-95579542 ATGAAGTGGCAGAGCTGGGATGG + Intergenic
1029385128 7:100238586-100238608 TTCGAGAAGCAAAGATAGGAAGG - Intronic
1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG + Intronic
1029449240 7:100631757-100631779 AGGAGGAAGCAGAGAGAGGAAGG - Intronic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1030016777 7:105230516-105230538 ATGAAGAAAGAAAGACAGGAAGG + Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030230594 7:107204800-107204822 AGGAAGAAGCAGAGATCAGGAGG - Intronic
1030906886 7:115196882-115196904 GTGAAGAAGAAGTGATTGGAAGG - Intergenic
1032860837 7:135877847-135877869 CTGAATAATCAGAGAAAGGAGGG - Intergenic
1032937639 7:136751780-136751802 TTACAGAAGCAGAGATAGAATGG + Intergenic
1032946870 7:136864184-136864206 GAGAAAAAGCAGAGATGGGAGGG - Intergenic
1032952247 7:136928127-136928149 AAAAAGAAGCAGAGGAAGGAGGG + Intronic
1033433232 7:141308094-141308116 ATGAAGAAGCCGGGGAAGGAGGG + Intronic
1033639567 7:143248373-143248395 AGAAAGAAGCACAGATACGAAGG - Intronic
1034114834 7:148575544-148575566 ATGGAGAATTAGGGATAGGAAGG + Intergenic
1034534900 7:151720644-151720666 ATGAAGGAGGAGAGAATGGAGGG + Intronic
1034783623 7:153904911-153904933 ATGAAGACGCAAAGATAGACAGG + Intronic
1035280697 7:157776360-157776382 GTGAGGAAGAAGAGAGAGGAGGG - Intronic
1035915636 8:3618875-3618897 ATGAAGAAGCAGAGAGAAAGTGG + Intronic
1036543934 8:9748103-9748125 ATGAAGCAGCCCAGAAAGGAAGG + Exonic
1036943209 8:13070720-13070742 ATGAGGAAGCAGAGATTGGAAGG - Intergenic
1037816182 8:22113385-22113407 AAGAAGAAGGACAGAGAGGAGGG + Intergenic
1037899879 8:22681717-22681739 ATGAAGTCGGAGAGATAGTATGG - Intergenic
1038138243 8:24814068-24814090 AAGTAGAAGGAGAGACAGGAAGG - Intergenic
1038182800 8:25244687-25244709 ATGAGAAAGAAGAGATGGGAAGG + Intronic
1038259045 8:25977562-25977584 AGGAAGAAGAAGAGAAAGAAAGG + Intronic
1038680157 8:29659367-29659389 ATGTAGAAACAGAGATACAAAGG + Intergenic
1038890343 8:31714072-31714094 ATAAAGAAACAGAGAAAGGCCGG - Intronic
1038927332 8:32154937-32154959 ATGAAGAAACTGAGATCGCAGGG + Intronic
1039174864 8:34792420-34792442 TTGGAGAAGCAGAGATAGCATGG - Intergenic
1039337175 8:36603893-36603915 AAGAAGTAGCAGTGTTAGGAAGG - Intergenic
1039379834 8:37074716-37074738 ATGATTGAGCAGAGAGAGGAAGG - Intergenic
1039824523 8:41161719-41161741 AAGAAGAAGGAAAGAAAGGAAGG - Intergenic
1039963761 8:42269503-42269525 AGGAAGGAGGAGAGATAGGAAGG + Intergenic
1040639182 8:49312407-49312429 AAGAAGAAGTAGAGAGAGAAAGG + Intergenic
1040683873 8:49847053-49847075 TTCAAGAAGCTGAAATAGGAAGG - Intergenic
1041051748 8:53941046-53941068 GTGAGGCAGCAGAGAAAGGAGGG - Intronic
1041347925 8:56920676-56920698 AGGGAGAAGCAGAGAAAGGTGGG + Intergenic
1041600450 8:59711438-59711460 GTGAAGAAGCAGAGAGAAGGTGG + Intergenic
1042552353 8:70005213-70005235 AGGAAGAAAGAGAGAGAGGAAGG + Intergenic
1042593187 8:70418099-70418121 ATTAAGAAGTAGAAATGGGAGGG - Intergenic
1043012145 8:74894221-74894243 GTGAGGAAGCAGAGGTAGGCAGG - Intergenic
1043023763 8:75040863-75040885 AGCAAGAAGCAGAGATAAAATGG - Intergenic
1043283416 8:78498863-78498885 ATCAATAAGCAGTGACAGGAAGG + Intergenic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1044444604 8:92259806-92259828 AAGAAGAACCAGAGAAAGTACGG + Intergenic
1044704670 8:94996847-94996869 ATGAAGACGCAGGGAGAAGATGG + Intronic
1045121182 8:99036975-99036997 ATGAAGAATCTGAGACATGAAGG - Intronic
1045364325 8:101461793-101461815 ATGAAGAAGGAGGGAAACGAGGG - Intergenic
1045853367 8:106731278-106731300 ATGAAGGAATACAGATAGGAAGG - Intronic
1046918919 8:119706859-119706881 AAGAAGAAAGAGAGAGAGGAAGG - Intergenic
1046998219 8:120547793-120547815 ATGAAGAGGCAGAGGCAGAATGG - Intronic
1047004718 8:120608498-120608520 ATGAAGACACAGAGAGAAGACGG + Intronic
1047195184 8:122714557-122714579 AAGTGGAAGCACAGATAGGAAGG + Intergenic
1047651146 8:126923613-126923635 ATGAATAAGCAGTTATAGCAAGG - Intergenic
1047879602 8:129178997-129179019 ATAAAGAAACAAAGATAGGCTGG - Intergenic
1047988916 8:130265272-130265294 ATAAAGAAGCAAAGATTGGCCGG + Intronic
1048219531 8:132528749-132528771 ATGAAGAAGCAGAGCTTCCAAGG + Intergenic
1048557629 8:135496138-135496160 ATGAGAAAGCAGAAGTAGGAAGG + Intronic
1048824977 8:138415550-138415572 AAGTAGCATCAGAGATAGGAGGG + Intronic
1048903238 8:139060531-139060553 CTGTGGAAGCAGAGATTGGAGGG - Intergenic
1049960010 9:729385-729407 CTGAAGAGGCAGTGATGGGAGGG + Intronic
1050512560 9:6411674-6411696 ATGAAAAAGAAGAGAAAGGCCGG - Intergenic
1050836264 9:10083080-10083102 ATAAAGAAGCAGAGAGAAGAAGG - Intronic
1050951762 9:11605358-11605380 AAGCAGAAGCAGAGATAAGATGG - Intergenic
1052236499 9:26217459-26217481 ATGCAGAAGCAGGCACAGGAAGG + Intergenic
1052395691 9:27935267-27935289 AAGAAAGAGCAGAGGTAGGAAGG + Intergenic
1052955442 9:34250201-34250223 TTGGAGAGGCAGAGAAAGGAGGG - Intronic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1054769859 9:69073568-69073590 ATGAAGGGGCAGATAAAGGAAGG + Exonic
1055194145 9:73566338-73566360 ATGGAAAAGAAGAGATAGGAAGG - Intergenic
1055209130 9:73767788-73767810 AAGAAGAAGGAGAGATATCAGGG + Intergenic
1055860968 9:80748497-80748519 ATGACGCTGCAGAGATGGGATGG + Intergenic
1055944645 9:81681947-81681969 AGGAAGAAGCACAGACAGGCCGG + Intronic
1056041870 9:82676598-82676620 ACTCAGAAGCAGAGATGGGAGGG - Intergenic
1056053399 9:82794347-82794369 ATGAAGAAGTGGAGATAGCGGGG - Intergenic
1056371061 9:85954741-85954763 ATGCAAAAGCAATGATAGGAAGG - Intronic
1056704835 9:88943236-88943258 AGGAAGAGGCAGAGAGAGAAAGG - Intergenic
1056800445 9:89687118-89687140 ATGAATATGCAGAGAGAGGCTGG - Intergenic
1056819613 9:89829476-89829498 ATTAAGAAGCAGAGAGAACAGGG + Intergenic
1057337072 9:94164568-94164590 AAAATGAAGCACAGATAGGAAGG + Intergenic
1057474352 9:95385982-95386004 AGAAAGAAGCACAGAAAGGACGG - Intergenic
1057969848 9:99544391-99544413 ATGAACAAACTGAGATAGCATGG - Intergenic
1058136806 9:101316560-101316582 ATGAAGAAACAAAGAAAGTATGG + Intronic
1058532998 9:105925328-105925350 ATGGAGAAGGAGAGAAAGGTGGG + Intergenic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1058846721 9:108967803-108967825 ATGGAGAAGCATAGATGGTAAGG + Intronic
1059351103 9:113665654-113665676 CTGAAGAAAAAGAGAGAGGATGG - Intergenic
1059670440 9:116485908-116485930 AGGAAGAGGCAGGGAGAGGAAGG + Intronic
1059731086 9:117057944-117057966 ATGAAGAAAGAGAGGTGGGAGGG - Intronic
1059808011 9:117825739-117825761 AGAAAGAAGCAGACATAGCAAGG + Intergenic
1060032961 9:120231587-120231609 ATTATGAAGCAGACATTGGAAGG + Intergenic
1060373506 9:123097802-123097824 ATGCAGAAGAAGAGAAAAGACGG + Exonic
1060419928 9:123461125-123461147 ATGAAGAAGGTGAGGAAGGAAGG - Intronic
1060575150 9:124685111-124685133 ATGAAGAAACAGATTTAGAAGGG - Intronic
1060753845 9:126194579-126194601 ATGAAGAAGGAGGGAAGGGAGGG - Intergenic
1061035208 9:128109739-128109761 ATGAAGAAGCAGATTTTGGGAGG - Intergenic
1061195111 9:129103228-129103250 ATGAAGAAGCACACACAGGCTGG - Intronic
1061743961 9:132726294-132726316 AGGAAGAAGAAGAGAAAGGAAGG - Intronic
1061839967 9:133353004-133353026 CACAAGAAGCAGAGATAGAAGGG - Intronic
1062095176 9:134699433-134699455 GGGAGGAAGCAGAGAGAGGAAGG - Intronic
1062228151 9:135465527-135465549 TTGAAGAATCAGCGACAGGACGG + Intergenic
1203365408 Un_KI270442v1:251028-251050 AAGAAGAAGCAAACACAGGAAGG - Intergenic
1203657382 Un_KI270753v1:11337-11359 ATCAAGACGCAGAGGAAGGAAGG - Intergenic
1185449548 X:275191-275213 AGGAAGAAGGAGGGAGAGGATGG + Intergenic
1185593066 X:1291427-1291449 ATGAAGAAAAAGAGGAAGGAAGG - Intronic
1185745912 X:2573304-2573326 ATGAAGAAACAGAGAAAGTAAGG - Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186327867 X:8499118-8499140 ATGAAGAAAGAGAGAAAAGAAGG + Intergenic
1186448718 X:9654416-9654438 AAGAAGAAGAAGAGCTAAGAAGG + Intronic
1186747280 X:12583080-12583102 ATGAAGATTCAGAGAAATGAGGG - Intronic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188039769 X:25358216-25358238 ATGAAGAGGCAGAGTGAGCAAGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188520670 X:31034169-31034191 ATGGAGAAGGGAAGATAGGAGGG - Intergenic
1188614672 X:32142993-32143015 ATGCAAATCCAGAGATAGGATGG - Intronic
1188776413 X:34225444-34225466 ATGAAGAAGCAGGGGTAGATGGG - Intergenic
1188815943 X:34714373-34714395 ATCAATAAGCACAGCTAGGAGGG - Intergenic
1189114715 X:38330721-38330743 ATGATGAAGCAGAGATTGCTAGG - Intronic
1189206391 X:39242911-39242933 ATGAGCAAGCAGAAATTGGAAGG - Intergenic
1189842938 X:45101196-45101218 ATGAAGAAGCTAAGATATGAAGG - Intronic
1190327071 X:49213055-49213077 ATGAACAAGGTGAGATATGATGG + Intronic
1190739468 X:53279881-53279903 AGGAAGATGGAGAGAGAGGAAGG + Intronic
1190846797 X:54200075-54200097 ATGATTAAGCAGAGATCTGAAGG - Intronic
1190902069 X:54685540-54685562 AGGAAGAAGGAAAGAAAGGAAGG - Intergenic
1191012771 X:55777974-55777996 AAGAAGGAGCAGTGATGGGAAGG + Intergenic
1191823504 X:65339117-65339139 ATTAAGAAGCAGGGAAAAGATGG + Intergenic
1192218912 X:69183449-69183471 GTGAAGAAGAAGAGAGAGGCAGG - Intergenic
1192369098 X:70498709-70498731 AGGAAGAAGCATAGAGAAGAAGG - Intronic
1192433369 X:71127309-71127331 ATGAAGAAGCAAGGTTGGGAGGG - Intronic
1194197886 X:90918036-90918058 AAGAAGAAGAAGAGATACCAGGG - Intergenic
1194724848 X:97383720-97383742 ATAAATATGCAGAGATGGGAAGG - Intronic
1194762899 X:97815482-97815504 ATGAAATAGCAGAGAAAGGATGG + Intergenic
1195980229 X:110569459-110569481 AAAATGAAGCAGAGCTAGGAAGG + Intergenic
1196011647 X:110894427-110894449 CTGAAGAAGAAGAAAAAGGAAGG + Intergenic
1196345624 X:114653645-114653667 ATGAACAAGGAGAAACAGGAGGG - Intronic
1197645707 X:129014392-129014414 AAAAAGAAGCAGAAATAGCAGGG + Intergenic
1197897922 X:131336352-131336374 ATGAAGAAGAACAAGTAGGAAGG - Intronic
1198266811 X:135017125-135017147 GTGGGGAAGCAGTGATAGGAAGG + Intergenic
1199170166 X:144726198-144726220 ATGAAGAGGCAAAGTCAGGAGGG - Intergenic
1199316528 X:146385254-146385276 ATGAAGATGGAGAGAGAGGAAGG + Intergenic
1199346810 X:146750231-146750253 ATGAAGAGGAAGAGATAACAAGG - Intergenic
1199665835 X:150095719-150095741 ATGAGGAAACAGAGACAGGGAGG - Intergenic
1200691282 Y:6307670-6307692 ATCAAGAAGAAGAAAGAGGATGG - Intergenic
1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG + Intergenic
1201050975 Y:9934928-9934950 CTGAAGAAACAGAGATGAGAAGG + Intergenic
1201073573 Y:10170770-10170792 AGCAAGAAACAGAGAAAGGAAGG - Intergenic
1201074241 Y:10175163-10175185 AGCAAGAAACAGAGAGAGGAAGG - Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1201493567 Y:14569091-14569113 ACGAAGACGCAAAGATAAGATGG + Intronic
1201697402 Y:16841019-16841041 GTAAAGAAGGAGAGAAAGGAAGG + Intergenic