ID: 1078129122

View in Genome Browser
Species Human (GRCh38)
Location 11:8597593-8597615
Sequence CAATTAGTACAGTTTGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078129121_1078129122 15 Left 1078129121 11:8597555-8597577 CCAGAATTGAAATTTGTCAATAA No data
Right 1078129122 11:8597593-8597615 CAATTAGTACAGTTTGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078129122 Original CRISPR CAATTAGTACAGTTTGTCCC AGG Intergenic
No off target data available for this crispr