ID: 1078129866

View in Genome Browser
Species Human (GRCh38)
Location 11:8604625-8604647
Sequence TAGGAAAAGCTCTCTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078129862_1078129866 -4 Left 1078129862 11:8604606-8604628 CCACTTCAGATTGTGTGGTTAGG No data
Right 1078129866 11:8604625-8604647 TAGGAAAAGCTCTCTGAGGAGGG No data
1078129860_1078129866 3 Left 1078129860 11:8604599-8604621 CCTGGGTCCACTTCAGATTGTGT No data
Right 1078129866 11:8604625-8604647 TAGGAAAAGCTCTCTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078129866 Original CRISPR TAGGAAAAGCTCTCTGAGGA GGG Intergenic
No off target data available for this crispr