ID: 1078131179

View in Genome Browser
Species Human (GRCh38)
Location 11:8615399-8615421
Sequence ATGATGTTGTCAAGGACAAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078131175_1078131179 12 Left 1078131175 11:8615364-8615386 CCATAAGAATCTAGAACTCACCG 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1078131179 11:8615399-8615421 ATGATGTTGTCAAGGACAAAAGG 0: 1
1: 0
2: 1
3: 11
4: 226
1078131176_1078131179 -8 Left 1078131176 11:8615384-8615406 CCGTATTTCCACTGCATGATGTT 0: 1
1: 0
2: 1
3: 23
4: 189
Right 1078131179 11:8615399-8615421 ATGATGTTGTCAAGGACAAAAGG 0: 1
1: 0
2: 1
3: 11
4: 226
1078131174_1078131179 13 Left 1078131174 11:8615363-8615385 CCCATAAGAATCTAGAACTCACC 0: 1
1: 0
2: 1
3: 4
4: 104
Right 1078131179 11:8615399-8615421 ATGATGTTGTCAAGGACAAAAGG 0: 1
1: 0
2: 1
3: 11
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078131179 Original CRISPR ATGATGTTGTCAAGGACAAA AGG Exonic
903401173 1:23050754-23050776 ATGAGGTTGTGAAGTATAAAAGG - Intronic
904293871 1:29505322-29505344 AGGTTGTTGTCAAGATCAAATGG + Intergenic
905394656 1:37659380-37659402 ATGAAGTTTTTAAGGGCAAATGG - Intergenic
905432456 1:37934496-37934518 ATAATGTTGTACAGCACAAAAGG - Intronic
908031045 1:60000159-60000181 ATGATTTTCTCAGGGACAATAGG + Intronic
908412225 1:63878317-63878339 ATGGTGTTGTCAAAGCAAAATGG - Intronic
908666725 1:66500517-66500539 AGGATGTGGGCAAGGAGAAAAGG + Intergenic
908888291 1:68815106-68815128 TTGATGTTGTACAGCACAAAGGG + Intergenic
908965329 1:69754915-69754937 ATGATATTGTAAAGAAAAAAAGG + Intronic
909789041 1:79650263-79650285 ATGATATTGTCAATAACACATGG + Intergenic
918211915 1:182358678-182358700 GTGATGGAGTCAAGGAAAAAAGG + Intergenic
918693856 1:187517543-187517565 ATGAGGTTGTGAAGGGAAAATGG - Intergenic
918782802 1:188724231-188724253 AATATGTTGTGAAAGACAAAGGG - Intergenic
919679078 1:200416530-200416552 ATGTTGTAGTGAAGAACAAATGG - Intergenic
920330052 1:205200616-205200638 TTGATGTTATGAAGGAAAAAAGG - Intronic
921539873 1:216399853-216399875 ATGATGTTGGCAGTGACAACGGG + Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921826256 1:219675122-219675144 CTGATATTGACAAGAACAAATGG - Intergenic
922532410 1:226354526-226354548 AGGATGTCAGCAAGGACAAAGGG - Intergenic
1062865637 10:850665-850687 ATATTCTTCTCAAGGACAAATGG + Intronic
1063905685 10:10777944-10777966 CTGAAGTTGTCAAGTAGAAAAGG - Intergenic
1064142441 10:12801990-12802012 GTGATTTTTTCAAGGAAAAAGGG - Intronic
1064287038 10:14000686-14000708 ATCGTGTTCTCAAGGAGAAAGGG - Intronic
1064710009 10:18113331-18113353 ATGATGTAGTCTAGTAGAAAAGG + Intergenic
1066015965 10:31243865-31243887 ATGATGCTCTCAATGAAAAATGG - Intergenic
1070048656 10:72865036-72865058 ATTATGTTGTCAAAAACTAAAGG + Intronic
1070367936 10:75754022-75754044 AGGATGTCATCAAGGGCAAAAGG - Intronic
1070766901 10:79061967-79061989 GTGCTGTTTTCAAGGACACACGG - Intergenic
1073104378 10:101023838-101023860 ATGCTGCTGTCAGGGACAGACGG - Intronic
1073930572 10:108569637-108569659 ATAACGTTGTCATTGACAAAAGG + Intergenic
1074129849 10:110564359-110564381 ATGATGTTACCAAGCAAAAAGGG + Intergenic
1077863223 11:6201033-6201055 ATGATGTTGGCCAAGACAAATGG - Intergenic
1078131179 11:8615399-8615421 ATGATGTTGTCAAGGACAAAAGG + Exonic
1078778106 11:14412026-14412048 ATGATGTGGTCAGGGCCTAAGGG - Intergenic
1078987446 11:16609551-16609573 ATGAAGTGATCAAAGACAAAGGG + Intronic
1079813128 11:25021269-25021291 ATGGTGTTTTCAAGGATAATTGG + Intronic
1079989135 11:27228906-27228928 ATGATAATATCTAGGACAAAAGG + Intergenic
1081331815 11:41810759-41810781 ATTATCTTGTCAAGTACAAAAGG + Intergenic
1082884635 11:58069225-58069247 ATGAAGCTGGCAAGGACAATAGG - Intronic
1083010318 11:59391073-59391095 ATTATGTTTTTGAGGACAAACGG - Intergenic
1084178289 11:67434600-67434622 TTGATGCTGTCCAGGACAGACGG - Exonic
1086011802 11:82113533-82113555 ATGGTCTTGTCAAGGAAAGATGG + Intergenic
1089534346 11:119151344-119151366 ATGAGGCTGGCAAGGTCAAAAGG - Intronic
1089614255 11:119686377-119686399 ATGATGTTGGCCTGGACAAGGGG - Intronic
1089692220 11:120193862-120193884 AAGAAGTTGTCAAGACCAAATGG - Intergenic
1090176871 11:124657738-124657760 ATTATGTTGTCAGGTACAGAAGG - Intronic
1090500347 11:127254907-127254929 ATGATGTGATCAATGTCAAAAGG + Intergenic
1094090844 12:26647408-26647430 ATGCTGTTGTAAAAGAAAAAAGG + Intronic
1097703793 12:62846991-62847013 AAGATGATGTCTAGGAGAAAGGG - Intronic
1100067118 12:90662624-90662646 CTAATGCTTTCAAGGACAAAAGG - Intergenic
1100258068 12:92904285-92904307 ATCTTTTTGTCAAGGCCAAATGG - Intronic
1102397163 12:112596339-112596361 ATGATGTTGCCTAGGTCATATGG + Intronic
1102658045 12:114500278-114500300 ATGATGTGTTCAAGGGCACATGG + Intergenic
1105043584 12:132982804-132982826 ATGATGTTAGCATGGTCAAAGGG - Intergenic
1106779014 13:33037803-33037825 ATGGTGTTGGCTGGGACAAATGG - Intronic
1107204521 13:37766755-37766777 ATGATGTGGTCAAGGCCATGTGG - Intronic
1108774146 13:53743578-53743600 GTGATGATGTCTTGGACAAAGGG + Intergenic
1109077872 13:57861209-57861231 AGGATGTTCCCAAGGATAAAGGG - Intergenic
1109217873 13:59610597-59610619 AGGAAGTTGTTAAGGAGAAATGG - Intergenic
1109460863 13:62656116-62656138 ATTGTGTTTTCAAGAACAAAAGG + Intergenic
1110099717 13:71582813-71582835 AGGAGGTTTTCAAGGTCAAAAGG + Intronic
1111199932 13:84922022-84922044 ATGATGATGATAAGGACACATGG - Intergenic
1111422527 13:88033132-88033154 GTGATGAGGGCAAGGACAAATGG - Intergenic
1112759066 13:102672620-102672642 CTGATTTTGTGAAGGAGAAAGGG - Intronic
1113079422 13:106502322-106502344 AAGATGTTATCAAGTACAAATGG + Intronic
1113139882 13:107135442-107135464 GTGATGTTATTAAGGACAGAAGG - Intergenic
1113290559 13:108901117-108901139 AAGATGTTATCAATGACAATGGG + Intronic
1113616193 13:111682297-111682319 AAGATGTTCTAAAGGAAAAATGG + Intergenic
1113621661 13:111767190-111767212 AAGATGTTCTAAAGGAAAAATGG + Intergenic
1114720011 14:24871540-24871562 ATGATGCTGTCAGGGGCCAAAGG + Intronic
1115092884 14:29599696-29599718 ATGATCTTGTCAAGTGAAAAGGG - Exonic
1115948210 14:38688853-38688875 AACATTTTGTCAAGTACAAACGG + Intergenic
1116038197 14:39654873-39654895 ATGACGTTGTCAGAGAGAAATGG + Intergenic
1117259645 14:54018401-54018423 TTGATTTTGTCAAGGTCAGATGG - Intergenic
1117843757 14:59889061-59889083 ACGATCTAGGCAAGGACAAAGGG - Intergenic
1119366515 14:74096664-74096686 ATGATTCTGTCATGCACAAAAGG - Intronic
1119465482 14:74854784-74854806 ATGAGGTTGTTAAGGATTAAAGG - Exonic
1122137439 14:99642867-99642889 AGGACATTGGCAAGGACAAATGG - Intergenic
1122833537 14:104418329-104418351 ATGAAATTGTTAAGAACAAATGG + Intergenic
1126276581 15:46890630-46890652 AAGATGATGTCCTGGACAAAAGG - Intergenic
1126685886 15:51248474-51248496 AGGATGTTGTCAAAGACAATAGG + Intronic
1127699109 15:61479838-61479860 ATCATGATGTCAAGGAAAAAGGG + Intergenic
1127930026 15:63589169-63589191 ATGATGTTGTGAAGGCTTAAGGG + Intronic
1128307622 15:66610363-66610385 ATGATCTTGCCAACGAAAAAGGG + Intronic
1128887974 15:71305711-71305733 CTGATGCTGTCCAGGAGAAATGG + Intronic
1129007302 15:72384633-72384655 ATGATATAGTCAAGGGAAAATGG + Intergenic
1130701848 15:86191566-86191588 ATGCTGTTATCAAGAACAACTGG + Intronic
1133069694 16:3236987-3237009 ATGAGATTGTGAAGGTCAAAGGG - Intergenic
1137807154 16:51318468-51318490 ATGAAGTTGACAAGGATAACAGG + Intergenic
1140251301 16:73296745-73296767 ATGATATTGACAATGACAATGGG + Intergenic
1141913596 16:87077508-87077530 ATGTTTAGGTCAAGGACAAATGG - Intergenic
1143933756 17:10460381-10460403 ATGATGATGACAAAGAAAAAAGG + Intronic
1143941017 17:10541494-10541516 AAGATGTTATCAATGACAATGGG + Intronic
1146099971 17:29972020-29972042 ATGACGTTTTCAAAGACTAAAGG - Intronic
1148272579 17:46274835-46274857 ATTATCTTGTCAAGATCAAATGG - Intronic
1148530389 17:48384717-48384739 ATTCTGTTGTCAAGGAAGAAGGG + Intronic
1149406488 17:56357096-56357118 ACAAAGTTGTAAAGGACAAATGG + Intronic
1150106291 17:62464837-62464859 AGGCTGTTATCAAGGATAAATGG + Intronic
1152766410 17:82142633-82142655 ATGATGGTGAGAAGGAGAAATGG + Intronic
1153969806 18:10215886-10215908 ATAAGGTCTTCAAGGACAAAGGG + Intergenic
1154148740 18:11888617-11888639 ATGAAGTTTCCAAGGACTAAAGG + Intronic
1156307072 18:35887365-35887387 ATGATCTTGGAAAGGTCAAAAGG - Intergenic
1157214821 18:45774068-45774090 ATTATCTTTTCAAGGAGAAAAGG + Intergenic
1159185116 18:64960874-64960896 CTGATGTTTGCAAGGGCAAATGG + Intergenic
1159471610 18:68864679-68864701 ATGATCTTTTTAAGGACAGAAGG - Intronic
1161220245 19:3115044-3115066 ATGATGTTCTCCAGGTCGAAAGG - Exonic
1161552638 19:4922816-4922838 ATGATGTAGACAGGGGCAAATGG - Intronic
1167798926 19:51727783-51727805 TTGATGCTGTGAAGCACAAAGGG + Intergenic
929882294 2:45847603-45847625 ATGATGTGCTCCAGGCCAAAAGG + Intronic
930780996 2:55224739-55224761 CTGATGTTCTCATGGACACAAGG - Intronic
932941967 2:76177486-76177508 AAGATGTTATCAATGACAATGGG - Intergenic
937904612 2:127046805-127046827 ATGAGGCTGTCAAGGAGGAAGGG + Intergenic
937925596 2:127165316-127165338 ATAATGGTTTCAAGGAGAAATGG - Intergenic
944174640 2:196816371-196816393 ATGCTGCTGAAAAGGACAAATGG - Intergenic
944646260 2:201783619-201783641 ATGAGGTTGGAAAGGAAAAAAGG - Intergenic
944855853 2:203765808-203765830 ATAATGTTCTCAAGGACAAAAGG + Intergenic
945469049 2:210205959-210205981 ATGATGTTATCAAGGATCAGGGG + Intronic
1170181646 20:13537632-13537654 ATGTTTTAGTCAAGGACAATAGG - Intronic
1172563503 20:35910119-35910141 ATGATGTTTTCAAGGATATCAGG - Intronic
1173202483 20:40964284-40964306 ATGATGTTGACAAGTATTAAAGG - Intergenic
1173639256 20:44588247-44588269 ATGAAGTTTACAAGCACAAATGG + Intronic
1177417579 21:20814405-20814427 ATGATGTTGTGAAACAAAAAGGG - Intergenic
1178829284 21:36041631-36041653 TTGATGTTGTGGAGGACAAAAGG - Intronic
1179599678 21:42468382-42468404 CTGAAGTTTTCAAGGACCAATGG + Intergenic
1179640994 21:42747182-42747204 CTGCTGTTGACAAAGACAAAAGG - Intronic
1182182072 22:28360142-28360164 ATGATGATGATAAAGACAAAAGG - Intronic
950085414 3:10254157-10254179 CTGTTGTTGCCAAGGACAATCGG + Intronic
952291138 3:32016971-32016993 ATGATATTTTCAAGGAAATAAGG - Intronic
952648725 3:35696029-35696051 ATGATATTGTCAATGACAGTAGG + Intronic
953135110 3:40175477-40175499 AGGATGTAGACAAGGACAAAAGG - Intronic
953300393 3:41768702-41768724 ATGATTTAGACAAGGACAATAGG - Intronic
953439017 3:42902184-42902206 TTGATGTTGCCTAGGAGAAATGG + Intronic
954921687 3:54196543-54196565 ATTATCTTGTCACTGACAAACGG + Intronic
955046590 3:55366834-55366856 CTGATGTTCTCAAGGACACTGGG + Intergenic
956258018 3:67305045-67305067 ATGTTGTTAGTAAGGACAAAGGG - Intergenic
957469321 3:80638247-80638269 AATATGTCGTCAAGAACAAATGG + Intergenic
957567275 3:81900664-81900686 GTGATCTTGACAAGGACAAGGGG + Intergenic
958593314 3:96189045-96189067 ATGATGTTTTCAATGGGAAAAGG + Intergenic
959568179 3:107853909-107853931 ATGAGGTTGTCATGGAGAAGAGG + Intergenic
959630076 3:108497882-108497904 ATGATCCTCTCAAGGACCAAAGG + Intronic
959945670 3:112123247-112123269 ATGGTGTTGTTCAGGATAAATGG + Exonic
960658668 3:120034187-120034209 ATGGTGTTTTGAAGCACAAATGG + Intronic
962964864 3:140344283-140344305 ATGATGCTGTCATGGCAAAATGG + Intronic
966024750 3:175263063-175263085 ACCATGTTGTCCATGACAAATGG - Intronic
966693507 3:182765028-182765050 TTGATTTTGTCTTGGACAAAAGG - Intergenic
967816886 3:193806962-193806984 ATGATGTTACAAAGGCCAAAGGG + Intergenic
967904247 3:194487281-194487303 ATGATGTTGTCATAGCCCAAAGG - Intronic
968528732 4:1078671-1078693 CTGTTGGTGTCAAGGAGAAAGGG - Intronic
968658965 4:1791197-1791219 ATCAGGCTTTCAAGGACAAATGG + Intergenic
969163520 4:5282712-5282734 ATGATGATGTCAATGACCAGTGG + Intronic
969687541 4:8684093-8684115 ATGATGTTCTCATTGACAGAAGG + Intergenic
970464169 4:16306455-16306477 ATGATGTTGACATTGACAGAGGG - Intergenic
970689712 4:18608643-18608665 AAGATGTTCTCAATGGCAAAGGG - Intergenic
971159791 4:24121916-24121938 ATGAGGTTCTCAGGAACAAAGGG - Intergenic
972128924 4:35805264-35805286 ATGATGGTAACAAGGAGAAAAGG + Intergenic
977111104 4:92956162-92956184 AAGATGTTGTTAATGACAGATGG - Intronic
978014579 4:103726813-103726835 ATGATAATGTGAAGGACATAGGG - Intergenic
980106973 4:128597259-128597281 ATGAAGGAGCCAAGGACAAAGGG + Intergenic
981926816 4:150149329-150149351 ATAATGTTGTCAGGCACAACTGG + Intronic
984006528 4:174316989-174317011 ATGTTTTTGTCTAGTACAAATGG + Intronic
984077004 4:175195744-175195766 ATGATGTTGTCCTAAACAAATGG + Intergenic
984094656 4:175419476-175419498 TTGGAATTGTCAAGGACAAAAGG - Intergenic
985973253 5:3393690-3393712 ATGATGCTGAGAAGGATAAAAGG - Intergenic
987235915 5:15941489-15941511 ATGATGCTCTCAAAGAAAAAAGG - Intergenic
987431036 5:17833318-17833340 ATGATGTATACAAGGATAAAGGG - Intergenic
989830771 5:45915549-45915571 ATGATCTGGGCAAGGTCAAAAGG + Intergenic
990205203 5:53421426-53421448 ATGTTGTTGTTAAAGACAACAGG - Intergenic
992955193 5:81901235-81901257 AAGATGTTATCAATGACAATGGG + Intergenic
993808795 5:92447667-92447689 ATGATGTTTTCTAGGAAATAGGG + Intergenic
995820677 5:116227410-116227432 AAGATCTTGTGAAAGACAAAAGG - Intronic
995844373 5:116478124-116478146 ATGATGGAGTCGAAGACAAAAGG - Exonic
996977008 5:129447150-129447172 AACATGTTCTCAAGGAGAAACGG - Intergenic
997425499 5:133800039-133800061 ATGCAGTTGTCATGGACAACAGG + Intergenic
998049208 5:139017315-139017337 AGGATGATGCCAAGGATAAAGGG + Intronic
999342382 5:150783292-150783314 CTGAGGTTGTCAAGGAAGAATGG - Intronic
999865499 5:155696210-155696232 ATGATGTTGTTATGGAGAAGAGG + Intergenic
1000595058 5:163205944-163205966 GTGGTGTTGTAAAGGACAAGTGG + Intergenic
1004049071 6:12056317-12056339 ATGATGTTCTTAAGGAAAAGTGG + Intronic
1004456952 6:15800135-15800157 CTTATGTTGACAAGGACAAGAGG - Intergenic
1008169495 6:48185235-48185257 ATCATTCTGGCAAGGACAAAAGG - Intergenic
1010184776 6:73130989-73131011 ATGTAGTTGAGAAGGACAAAAGG + Intronic
1011356284 6:86475869-86475891 GGGATGTTGTCAAGGAGACATGG - Intergenic
1014119886 6:117712590-117712612 AAGATGTTATCAATGACAATGGG - Intergenic
1014551683 6:122796173-122796195 ATGAAATTATCAAAGACAAAAGG + Intronic
1015862645 6:137696923-137696945 GTGATGTTGTCAAGGGCCCAGGG + Intergenic
1017844759 6:158247544-158247566 AGTTTCTTGTCAAGGACAAAAGG + Intronic
1018274934 6:162120371-162120393 ATGATGATGACAAGGACTATGGG - Intronic
1020733644 7:11917523-11917545 ATATTGTTGTAAAGGACAAAGGG - Intergenic
1021120757 7:16792942-16792964 TTCATGTTGTCAAGCACTAATGG + Exonic
1021632654 7:22662103-22662125 AAGTTGTTGTGAAAGACAAAGGG - Intergenic
1023551147 7:41371031-41371053 ATGTTGTTGGAAAGGAAAAAAGG + Intergenic
1024664161 7:51529160-51529182 ATGGGGTTGTGAAGGATAAAGGG - Intergenic
1030724316 7:112907535-112907557 AAGATATAGTCAAAGACAAAGGG + Intronic
1032035356 7:128517425-128517447 AGGCTGTTATCAAGGATAAATGG + Intergenic
1032342175 7:131084527-131084549 ATGATGCTGTCATGGGAAAAAGG + Intergenic
1038861287 8:31391671-31391693 CTGCTGGTGTCAAGGACAACAGG + Intergenic
1038871424 8:31498623-31498645 ATAATGTTGTCAATGAAAAGTGG - Intergenic
1039018294 8:33177470-33177492 ATGAAGATGTAAAGGAGAAAGGG + Intergenic
1039173322 8:34774137-34774159 GTGATGTTGACAAGGACATGGGG - Intergenic
1039459373 8:37730654-37730676 ATGATGTTTTTAAGCAGAAAAGG + Intergenic
1040334720 8:46410211-46410233 AGGATGTTGTGACAGACAAAAGG + Intergenic
1041147554 8:54893508-54893530 ATGATGTACTCAAGGCCAACTGG - Intergenic
1041389631 8:57337165-57337187 ATGAGGTTGTCAACTCCAAAAGG + Intergenic
1042649542 8:71024278-71024300 AGGCTGCTGCCAAGGACAAAAGG - Intergenic
1043064314 8:75547601-75547623 GTGTTGTTGACAAGGACAAAAGG + Exonic
1043157693 8:76805333-76805355 AGGTTGTTGTAAAGGATAAAGGG + Intronic
1043990642 8:86749844-86749866 ATGATCATGTCATGAACAAAAGG - Intergenic
1044130656 8:88520119-88520141 TTAATATTGTCAAGTACAAACGG - Intergenic
1045205570 8:100036281-100036303 ATGGTGTTGGCAAGGAGAAAGGG - Intronic
1046527375 8:115397875-115397897 ATGAAGCTGTCAAGGTCAACGGG + Intergenic
1047577773 8:126176946-126176968 TTAATGTTGTCAAAGATAAAGGG + Intergenic
1050416928 9:5428026-5428048 AGGATGTTATCAATGACAATGGG + Intronic
1051575389 9:18609531-18609553 ATGCTGTTGTCAAATCCAAAGGG + Intronic
1051838754 9:21370761-21370783 AACATGTTGGCATGGACAAATGG - Intergenic
1052535402 9:29739794-29739816 ATGAGGTTTTCTAGGATAAAAGG + Intergenic
1055514238 9:77020459-77020481 ATAATGTTCTCAATGGCAAAGGG - Exonic
1055550879 9:77431327-77431349 ATGATGTTTTCCAAGTCAAATGG + Exonic
1057114127 9:92504429-92504451 ATCATGTGGTCTAGGAGAAACGG + Intronic
1059537774 9:115098854-115098876 TGGATGTTGGGAAGGACAAAGGG - Intronic
1059877837 9:118655886-118655908 ATGATGTGGACAAGAACAGATGG - Intergenic
1062663835 9:137655839-137655861 ACGATGTTTCCATGGACAAAAGG - Intronic
1203561098 Un_KI270744v1:59492-59514 ATGAAGTTTTTAAGGACAGAAGG + Intergenic
1186297625 X:8167768-8167790 ATGATGGTGTTCAGGACATAGGG + Intergenic
1186308963 X:8296699-8296721 GTGATATTGTCAAGGAAAAGTGG - Intergenic
1186824587 X:13326857-13326879 AAGATATTTTCAAGGACACATGG - Intergenic
1187196573 X:17091438-17091460 ATGACCTTGCCAAGGACACAAGG - Intronic
1188348313 X:29095671-29095693 ATGATTTTCTCAAGGAATAATGG + Intronic
1189330753 X:40143569-40143591 AAGATGGTATCAAGGCCAAAGGG + Intronic
1190179304 X:48177850-48177872 ATCATGTGGTCAAGGACACTGGG + Intergenic
1190757959 X:53417205-53417227 GGGATGTTCTCAAAGACAAATGG + Intronic
1193625280 X:83812796-83812818 GGGATGTTGTCAAGGGCAATGGG + Intergenic
1193913691 X:87339115-87339137 ATGATATTGAGAAAGACAAAAGG - Intergenic
1194051108 X:89070268-89070290 ATCAAGTTTTCAAGGACAAAAGG - Intergenic
1195066828 X:101244910-101244932 AAGAGGTTGTCAAGCCCAAAAGG - Intronic
1196331358 X:114473044-114473066 ATAATGGTGATAAGGACAAATGG + Intergenic
1196798857 X:119524212-119524234 ATGCTGTCTCCAAGGACAAATGG - Intergenic
1197419072 X:126215418-126215440 ATGGTGTTATCAAGGGCAAGAGG + Intergenic
1198270835 X:135054747-135054769 AAGTTGTTGTCAAGAAGAAATGG - Intergenic
1200287859 X:154840903-154840925 ATGAGGTTTTCAAGGAAAGAGGG + Intronic