ID: 1078131830

View in Genome Browser
Species Human (GRCh38)
Location 11:8619872-8619894
Sequence CACGCTCCTGCCCCATGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 303}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078131824_1078131830 -6 Left 1078131824 11:8619855-8619877 CCCAACCTGGGAACCACCACGCT 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1078131830 11:8619872-8619894 CACGCTCCTGCCCCATGGCCTGG 0: 1
1: 0
2: 2
3: 29
4: 303
1078131819_1078131830 14 Left 1078131819 11:8619835-8619857 CCCAGTGGCCATGCTCTGAGCCC 0: 1
1: 0
2: 0
3: 29
4: 247
Right 1078131830 11:8619872-8619894 CACGCTCCTGCCCCATGGCCTGG 0: 1
1: 0
2: 2
3: 29
4: 303
1078131820_1078131830 13 Left 1078131820 11:8619836-8619858 CCAGTGGCCATGCTCTGAGCCCA 0: 1
1: 0
2: 1
3: 28
4: 282
Right 1078131830 11:8619872-8619894 CACGCTCCTGCCCCATGGCCTGG 0: 1
1: 0
2: 2
3: 29
4: 303
1078131822_1078131830 6 Left 1078131822 11:8619843-8619865 CCATGCTCTGAGCCCAACCTGGG 0: 1
1: 0
2: 0
3: 36
4: 315
Right 1078131830 11:8619872-8619894 CACGCTCCTGCCCCATGGCCTGG 0: 1
1: 0
2: 2
3: 29
4: 303
1078131825_1078131830 -7 Left 1078131825 11:8619856-8619878 CCAACCTGGGAACCACCACGCTC 0: 1
1: 0
2: 2
3: 7
4: 127
Right 1078131830 11:8619872-8619894 CACGCTCCTGCCCCATGGCCTGG 0: 1
1: 0
2: 2
3: 29
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078131830 Original CRISPR CACGCTCCTGCCCCATGGCC TGG Intronic
900310871 1:2032585-2032607 CAGGCTCCTGCCCCAAGGGCGGG + Intergenic
900485465 1:2920657-2920679 CAGGCTCCTGCCTCAGAGCCTGG + Intergenic
901890353 1:12258298-12258320 CTTCCTCCTACCCCATGGCCCGG - Intronic
902302124 1:15509490-15509512 CAGGCGCCTGCCCCCTCGCCTGG - Intronic
902341732 1:15787792-15787814 CAGGCGCCTGCCACATCGCCTGG - Intergenic
902374567 1:16024217-16024239 CCCACTCCTGCCCCAAGGCACGG - Intronic
902605282 1:17565693-17565715 CACCCTCCTGCCCTGTGTCCCGG - Intronic
903389507 1:22953978-22954000 CTCGCTCCTGGCCCACGTCCTGG - Exonic
904027172 1:27511642-27511664 CACGCCACTGCACCCTGGCCTGG + Intergenic
904523322 1:31113037-31113059 CACGCTACTGCGCTCTGGCCTGG - Intergenic
904747435 1:32719874-32719896 GACCCCCCTGACCCATGGCCAGG + Intergenic
904749360 1:32731592-32731614 CAGGCTCCTGCCACAATGCCTGG + Intergenic
905015884 1:34778136-34778158 CACGTTCCTGCCACATTACCAGG - Intronic
905294561 1:36946152-36946174 CGCTCTCCTGTCCCCTGGCCTGG - Intronic
905823307 1:41011009-41011031 ACCGCTCCTGCCCTAAGGCCTGG + Intronic
905865168 1:41372503-41372525 CACTCCCCTGCCCCAGGCCCTGG - Intronic
906325247 1:44841735-44841757 GACCCTCCAGCCCCAGGGCCAGG + Intronic
907921514 1:58918569-58918591 CAGGCTCCTGCCACCTTGCCTGG - Intergenic
908274263 1:62453491-62453513 CAGGCTCCTGCCCCCTCGCCTGG + Intergenic
911173579 1:94796096-94796118 CACTCTCCAGCCCCCTTGCCGGG + Intergenic
912044533 1:105437611-105437633 CAAGCTCTTGTCCCATGTCCAGG - Intergenic
912649656 1:111426558-111426580 CTCGATCTTGCCCCATGACCTGG - Exonic
915111464 1:153566745-153566767 CACCCTCCTCCCCCAGGGCCAGG + Intronic
915429213 1:155852697-155852719 CACGCCACTGCACCCTGGCCTGG + Intronic
915447159 1:155980254-155980276 CACCCTCCTGCCCCAGGCCTGGG - Intronic
915899488 1:159836040-159836062 CACGCTCCAGCACAGTGGCCAGG + Exonic
916556459 1:165898062-165898084 CATGCTTCTGCCCCAGGGCCTGG + Intronic
917109087 1:171526949-171526971 CAGGCTCCTGCCCCCATGCCTGG + Intronic
921607364 1:217171527-217171549 CACGCTCCTGCCACCGTGCCTGG + Intergenic
922798176 1:228351737-228351759 CACACCACTGCCCCATGCCCTGG + Intronic
922931707 1:229395185-229395207 CAGGCTCCTGCCACCAGGCCTGG - Intergenic
923409400 1:233692023-233692045 CAGGCTCCTGCCCCCACGCCTGG + Intergenic
924188185 1:241519156-241519178 CACCGTCCTGCCCCATAGCTGGG - Intronic
924323350 1:242870962-242870984 CACTAAGCTGCCCCATGGCCAGG - Intergenic
924455093 1:244212929-244212951 CATGCTTCTGCACCCTGGCCAGG + Intergenic
924532644 1:244906331-244906353 CAGGCTCCTGCCACCAGGCCTGG + Intergenic
1063391881 10:5655056-5655078 CACGCCACTGCACCATAGCCTGG + Intronic
1064961508 10:20970270-20970292 CAACATCCTGCCCCATGGCCAGG + Intronic
1065525254 10:26613737-26613759 CAGGCGCCTGCCACAAGGCCTGG - Intergenic
1065843627 10:29726701-29726723 CACGCTGCTGCACTCTGGCCTGG + Intronic
1067432172 10:46251905-46251927 CAGGCTTCAGCCCCATGTCCAGG + Intergenic
1067477096 10:46574343-46574365 CTCGCTCCTGCCCCTGGGCGTGG - Intergenic
1068116776 10:52744690-52744712 CACACTCCTGCCCCAGGGTGAGG - Intergenic
1069708455 10:70474076-70474098 CACGCTCCTGCCACATGTCCTGG + Intergenic
1070688539 10:78507895-78507917 CAGGGTCCTGCCCCAGGGCTAGG - Intergenic
1070731762 10:78833683-78833705 CTCCCTCCTGCCCCTTGACCCGG + Intergenic
1071481094 10:86065512-86065534 CACTCCCCTGCCCTGTGGCCAGG + Intronic
1071855886 10:89623886-89623908 CACTCACCTGCACCACGGCCAGG + Intronic
1071973996 10:90936907-90936929 CAAGTACCTGCCTCATGGCCAGG + Intergenic
1073062707 10:100741977-100741999 CGCGCCCCTCCCCCGTGGCCGGG - Intronic
1073122388 10:101130754-101130776 CACCGTCCTGCCTCAGGGCCTGG + Exonic
1073221505 10:101878212-101878234 CACGCCACTGCCCTCTGGCCTGG + Intronic
1073291404 10:102414980-102415002 TACCCACCTGCCCCACGGCCCGG - Exonic
1075087166 10:119421476-119421498 CAGGCTCCTGGCTCTTGGCCTGG + Intronic
1075189466 10:120293378-120293400 CACGTACCTGCCCCAGGACCTGG - Intergenic
1075686666 10:124369171-124369193 CAGGCTCCTGCCCAGTGACCAGG - Intergenic
1076588878 10:131569985-131570007 AATGCACCTGCTCCATGGCCAGG - Intergenic
1076684261 10:132189996-132190018 CCCTTTCCTGCCCCAAGGCCAGG + Intronic
1076717019 10:132371304-132371326 CAAGCTCCTGGCTCATGGGCTGG - Intronic
1077017560 11:403638-403660 TACGCTCCTGCTCCAGGGCCAGG - Exonic
1077019291 11:410416-410438 CACACCCCTGCCCCAAGGCCAGG - Intronic
1077046928 11:550893-550915 CACTCTCCAGACCCAAGGCCGGG - Intronic
1077220065 11:1411831-1411853 GAGGCTCCTGCCCACTGGCCCGG + Intronic
1077497993 11:2896003-2896025 CAGGCACCTGCCCGAGGGCCTGG - Intronic
1077532376 11:3103319-3103341 CGTTCTCCTGCCCCATGGCAGGG - Exonic
1077826943 11:5820830-5820852 CAAGCGCCTGCCCTATTGCCGGG + Exonic
1078131830 11:8619872-8619894 CACGCTCCTGCCCCATGGCCTGG + Intronic
1081851841 11:46279343-46279365 CCGGCTCCTGTCCCTTGGCCTGG - Intronic
1081993142 11:47348162-47348184 ACGGCTCCTGGCCCATGGCCTGG - Intronic
1083137157 11:60690321-60690343 TACGTTCCTACCACATGGCCTGG - Intergenic
1083355688 11:62064408-62064430 CAAGATCCTGCCCCATACCCTGG - Intergenic
1083607737 11:63988785-63988807 CACCCTCCTGCCCCACCCCCAGG - Intronic
1083922565 11:65788419-65788441 CACGCCCCGCCCCCAAGGCCTGG - Intronic
1084376749 11:68783143-68783165 CCCGCTCCTGCTCCCAGGCCTGG + Intronic
1084712397 11:70852096-70852118 CACGCTCCTCCCCGGCGGCCAGG - Intronic
1084857372 11:71997762-71997784 CAGGCTCCTGTCCTGTGGCCTGG + Intergenic
1084880614 11:72169005-72169027 CACGCTACTGTCCTCTGGCCTGG - Intergenic
1085346090 11:75768923-75768945 CGCGCCCCTGGCCCATGCCCCGG - Exonic
1085524562 11:77156808-77156830 CCCGCTCCCGCCCCACTGCCTGG - Intronic
1088236152 11:107725668-107725690 CAGGCACCTGCCCCAACGCCCGG + Intergenic
1089232006 11:116986229-116986251 CACTCTGCTGCCCCAAGCCCAGG - Intronic
1089453765 11:118613881-118613903 CACTCACCTGCACCATGGTCTGG - Exonic
1089462899 11:118663083-118663105 GCAGCTCCTGCCCCTTGGCCTGG + Exonic
1089535546 11:119158740-119158762 CACACCCTTGCCCCATGCCCAGG - Intronic
1089556559 11:119318529-119318551 CAGGCTCCAGGCCCCTGGCCCGG - Intronic
1089689859 11:120180583-120180605 CAGGCTCCTGCCCCAAGCTCTGG - Intronic
1091569608 12:1673133-1673155 CAGGCGCCTGCCCCAACGCCTGG + Intergenic
1092259025 12:6942537-6942559 CCCCCTCCTGCCCCAAGGCTGGG + Intergenic
1096228368 12:49883491-49883513 CAAGCTCCTGCCCCTTCCCCTGG - Intronic
1096503039 12:52076923-52076945 GCCGCTCCTGCTCCGTGGCCAGG - Exonic
1096584478 12:52610920-52610942 CTCTGTCCTGCCCCATGTCCTGG + Intronic
1097244387 12:57599088-57599110 CACGCTTCTGCCCCAGTTCCTGG + Exonic
1098884732 12:75949240-75949262 CAGGCACCTGCCCCCAGGCCCGG + Intergenic
1103039040 12:117679543-117679565 CAGACTCCTGCCTCATGGCCAGG - Intronic
1103719407 12:122965443-122965465 CCCGCTCCTGCCCCAGAGCCAGG - Intronic
1104798124 12:131533836-131533858 CACCCTCGTGCCCGAAGGCCAGG - Intergenic
1104815879 12:131645101-131645123 CAGGCCCCTGCCCCAGGCCCAGG - Intergenic
1104921278 12:132291994-132292016 CACGCTCCTGCTTCCTGCCCCGG + Intronic
1105892048 13:24688978-24689000 CCTGCTCCTGTCCCATGCCCTGG - Intronic
1106199369 13:27523688-27523710 CACGCTCCAGCCTCATGGGAAGG - Intergenic
1108272124 13:48771670-48771692 CTCGCTCATGCACCAAGGCCCGG - Intergenic
1114283998 14:21222749-21222771 CAGGCGCCTGCCACAAGGCCCGG - Intronic
1114628299 14:24143641-24143663 CTCGCTCATGCACCAAGGCCCGG + Exonic
1121782714 14:96632122-96632144 CCCGCCCCTGCCCCAGTGCCTGG - Intergenic
1122079139 14:99254697-99254719 CAGGCTTCTGCCTCCTGGCCGGG - Intronic
1122079152 14:99254729-99254751 CACGCTCCTGGCCCCCGGGCCGG - Intronic
1122780109 14:104139885-104139907 CAGGCTCCAGCCCCAGGGGCAGG + Intronic
1122847836 14:104510420-104510442 TCCCCTCCTGCCCCAGGGCCAGG + Intronic
1122876177 14:104666389-104666411 CTCCCTCCTCCCCCAGGGCCGGG + Intergenic
1123017913 14:105384350-105384372 CAGGCTCCCACCCCGTGGCCAGG + Exonic
1125546726 15:40511674-40511696 GACGCTCCCTCCCCAGGGCCCGG + Intergenic
1127488159 15:59438130-59438152 CGCGCGCCTGCCGCCTGGCCCGG - Intronic
1127493099 15:59483875-59483897 CAGTCTCCTGCCCCATGGAGGGG + Intronic
1128232873 15:66047844-66047866 CACGCTTCTGCCCCACGGGAGGG - Intronic
1128358640 15:66945378-66945400 CTCGGCCCTGCCCCATGTCCGGG - Intergenic
1129784372 15:78299416-78299438 CACCCTCAGGCCCCAGGGCCTGG + Intronic
1129953215 15:79610180-79610202 CACGCTCTTGACCCAGGGCTTGG - Intergenic
1132048441 15:98586136-98586158 CACTCTTCAGCCTCATGGCCTGG + Intergenic
1132826365 16:1907554-1907576 GACCCTCCAGCCCCATGCCCCGG + Intergenic
1132889363 16:2196417-2196439 CCTGCTCCTTCCCCATGGCGCGG + Exonic
1133102144 16:3486064-3486086 CAAGCTGCTGCTCCAAGGCCTGG + Exonic
1133440937 16:5820423-5820445 CACGGTCCAGCCACGTGGCCGGG - Intergenic
1135383246 16:22010875-22010897 CACGCTACTGCACTCTGGCCTGG + Intronic
1135746612 16:25022351-25022373 CCAGCTCCTGCCCTCTGGCCAGG - Intergenic
1136778727 16:32884744-32884766 CCCGCTCCTCCCCTCTGGCCCGG - Intergenic
1136891891 16:33976770-33976792 CCCGCTCCTCCCCTCTGGCCCGG + Intergenic
1137237017 16:46624999-46625021 CCTGCTCTTGCCCTATGGCCAGG + Intergenic
1137650387 16:50114843-50114865 CACACTCCTGCCCCTTAGGCAGG + Intergenic
1138017265 16:53440595-53440617 CACGCCCCTGCACCCTGGCCTGG - Intronic
1139436267 16:66938270-66938292 CCCACCCCTGCCCCAGGGCCTGG - Intronic
1139576845 16:67847242-67847264 CACCGGCCTGCGCCATGGCCAGG + Intronic
1203081144 16_KI270728v1_random:1146838-1146860 CCCGCTCCTCCCCTCTGGCCCGG - Intergenic
1142766210 17:2065638-2065660 CTGTCTCCTGCCCCTTGGCCAGG + Exonic
1143709976 17:8727400-8727422 CAGTCTCCTGCCCCTGGGCCAGG + Intergenic
1143863671 17:9908872-9908894 GACCCTCCTGCCCTCTGGCCTGG + Intergenic
1144143760 17:12377076-12377098 CAGGCTCTTGTCACATGGCCAGG + Intergenic
1144948134 17:18980264-18980286 CTTTCTCCTTCCCCATGGCCAGG + Intronic
1146004967 17:29155353-29155375 CCCTCTTCTGCCCCAGGGCCGGG + Intronic
1146955066 17:36932664-36932686 CACGCCCCTGCCCCATGCCCAGG + Intergenic
1147236457 17:39061270-39061292 CACGCTACTGCCCTCTAGCCTGG - Intergenic
1147689707 17:42307742-42307764 CACACTCCAGCCCCAAGGCCCGG + Intronic
1147715686 17:42506522-42506544 CATGCTGCTGCCCGAAGGCCAGG + Intronic
1147771161 17:42868460-42868482 CACGCCCCTGACCCATGGGGTGG + Intergenic
1148456266 17:47813157-47813179 CACGCTCCTCTCCCAGGCCCTGG + Intronic
1148878585 17:50707743-50707765 CGCGCTCCCTCCCCATGGCCGGG - Exonic
1151210510 17:72540628-72540650 CAGGCTCCTGCCTCAGGCCCTGG - Intergenic
1152408107 17:80108774-80108796 GCAGCTCCTGCACCATGGCCGGG - Intergenic
1152781988 17:82230752-82230774 CCCGCCCCTGCCCCAGGGCCCGG - Intronic
1153603567 18:6807886-6807908 CCTGCTTCTGCCCCATGGCCTGG + Intronic
1157083251 18:44551477-44551499 CATGCTACTGCACTATGGCCTGG - Intergenic
1157451541 18:47793023-47793045 GATGTTCCTGCCCCATGACCTGG - Intergenic
1160807461 19:998699-998721 CCCCCTCCAGCCCCCTGGCCAGG - Intergenic
1161068947 19:2251022-2251044 CCCGCTCCTGCCCCGTGTCCCGG - Intronic
1161247923 19:3264758-3264780 CACGCTACTGCACTCTGGCCTGG - Intronic
1161989350 19:7675707-7675729 CACGCTGCTGCACCCCGGCCTGG + Intergenic
1162018950 19:7860066-7860088 CACCCTCTTGCTCCATGCCCTGG - Intronic
1162601499 19:11673670-11673692 CCCCCTCCTGCTCCAAGGCCAGG + Intergenic
1163218440 19:15897506-15897528 CTGGCTCCTGGCCCATGTCCTGG - Exonic
1163239135 19:16048591-16048613 CACGCTACTGCACTCTGGCCTGG + Intergenic
1163810629 19:19429323-19429345 CACGCACCGTTCCCATGGCCAGG - Intronic
1164593504 19:29519151-29519173 CAAGATCCTGCCTCACGGCCTGG - Intergenic
1164683515 19:30151565-30151587 CACGCTACTGCACCCTAGCCTGG - Intergenic
1165158584 19:33802880-33802902 CACCCGCCTCCCCCAGGGCCTGG - Intronic
1165435773 19:35793953-35793975 CTCACTCCTGCCCCAAGCCCTGG + Intergenic
1165956281 19:39503805-39503827 CAGACTCCAGCCCGATGGCCTGG + Intronic
1166185641 19:41137164-41137186 CCAGCTCCTGCCCCTTGGCTGGG - Intergenic
925056394 2:860634-860656 CGTGCTCCTGCCCCAGAGCCGGG - Intergenic
925157797 2:1660718-1660740 CACTCTCCTGATGCATGGCCGGG - Intronic
926197504 2:10772729-10772751 CCCTCTCCTGTCCCTTGGCCTGG + Intronic
926245203 2:11118068-11118090 CACGCCACTGCCCTGTGGCCTGG - Intergenic
926251198 2:11156432-11156454 CTCGCCCCTTCCCCCTGGCCAGG + Intronic
926425462 2:12735344-12735366 CAGGCTCCTGCCCCAAGGATTGG + Intronic
928055673 2:28051789-28051811 CAGGCTCCTGCCACCAGGCCTGG + Intronic
928364299 2:30689731-30689753 GACCCTCCTGCCTCATCGCCAGG + Intergenic
928392668 2:30921276-30921298 CACACTCCTGCCCCAGGGAAAGG + Intronic
929431652 2:41892705-41892727 CTCTCTCCTGGCCCAGGGCCAGG - Intergenic
929580698 2:43080158-43080180 CAGGCTCCTGCCACCAGGCCCGG - Intergenic
929920924 2:46171092-46171114 CAGGCTCCTGCTGCATCGCCAGG + Intronic
931981681 2:67699902-67699924 CTCGCTCCTGGCCCATGAACTGG + Intergenic
933310286 2:80652207-80652229 CACGCTCCTCCCCCATGCAAAGG + Intergenic
933575210 2:84059374-84059396 CAGCATCCTGCCACATGGCCTGG + Intergenic
936972163 2:118186322-118186344 CACGATCCCGCCCCCTGGCATGG + Intergenic
937994069 2:127679881-127679903 CTAGCTCCTGCCCCAGGACCTGG - Intronic
938983839 2:136553722-136553744 CACCCTCCAGCCCCAAGGCATGG - Intergenic
942452150 2:176115025-176115047 CCCGCTGCTGCCCCGAGGCCCGG + Intronic
943188101 2:184639857-184639879 CAGGCACCTGCCCCCTCGCCTGG - Intronic
944116353 2:196191305-196191327 TACACTCCAGCCTCATGGCCTGG - Intergenic
944454147 2:199876144-199876166 CATGCTCCTGCACCCTTGCCTGG + Intergenic
946170537 2:217892782-217892804 CAGGCTCCTGCCTCAGAGCCAGG + Intronic
948148215 2:235724315-235724337 GACCCTCCAGCCCCATGTCCAGG + Intronic
948334875 2:237200121-237200143 CAAGTTCTTGCCCCATGTCCAGG + Intergenic
948357169 2:237387868-237387890 CACGCGGCTGCCCCCTGCCCGGG + Exonic
948791433 2:240379422-240379444 CACGCTCCAGGCACATGGCCTGG + Intergenic
949064823 2:241983704-241983726 GCGGCTCCTGCCCCCTGGCCAGG + Intergenic
1168883603 20:1226738-1226760 CACCCTCCCGCCCCACGTCCCGG - Intronic
1169141328 20:3228863-3228885 CACGCTCCTCCACTAAGGCCAGG + Exonic
1169253982 20:4083329-4083351 CAATCTCCTTCCCCCTGGCCAGG - Intergenic
1169883194 20:10369488-10369510 CAGGGTCTTGCCCCATTGCCCGG - Intergenic
1172227802 20:33316900-33316922 GACGCTGCTGCCCCAGGCCCAGG + Intergenic
1173867566 20:46322390-46322412 CACTCACCTGCCCCCTGGCCGGG + Intergenic
1174831442 20:53816562-53816584 CAGGCTCCTGCCACAACGCCCGG + Intergenic
1175097496 20:56553032-56553054 CACGCCACTGCCCTCTGGCCTGG + Intergenic
1175185561 20:57177810-57177832 AGCGCTCCTGCCCCAAAGCCTGG - Intronic
1175986348 20:62765865-62765887 CAAGCTGCTGCCCCAGGGACTGG + Intergenic
1176840179 21:13834720-13834742 CACTCTACTGCACCATAGCCTGG - Intergenic
1178516550 21:33252802-33252824 CACCCTCCTTCCACCTGGCCAGG + Exonic
1178662628 21:34520357-34520379 CATGCTCATGCCCCCGGGCCAGG + Intronic
1178680874 21:34670720-34670742 CGTGCTCCTGCCCCAGGGCCCGG - Exonic
1179149177 21:38795694-38795716 CACGCCTCTTCCCCATGGTCTGG + Intergenic
1180093086 21:45542530-45542552 GACGCTCCTGCCGCAGCGCCCGG - Intronic
1180105777 21:45617220-45617242 CCCGCTGCAGCCCCAGGGCCAGG + Intergenic
1180244626 21:46538921-46538943 CACCCTCCTGCCCTTTGTCCTGG + Intronic
1180786536 22:18550778-18550800 CCAGCTGCTGCCCCCTGGCCTGG - Intergenic
1180920745 22:19520264-19520286 AGAGCTCCTGCCCCCTGGCCCGG - Intronic
1181243456 22:21490331-21490353 CCAGCTGCTGCCCCCTGGCCTGG - Intergenic
1182447369 22:30397491-30397513 CCTGCCCCTGCCCCAGGGCCCGG - Intronic
1183158575 22:36094791-36094813 CAGGCTCCTGCCACCAGGCCTGG + Intergenic
1183368024 22:37417473-37417495 CCAGCTCCTGCCCCATCACCCGG - Intronic
1183588878 22:38768636-38768658 CACGCCACTGCACCCTGGCCTGG + Intronic
1183727640 22:39598334-39598356 CACACCCCCGCCCCATGTCCTGG + Intronic
1183750261 22:39716068-39716090 CATGCTCCCGACCCATGTCCTGG + Intergenic
1184376906 22:44119342-44119364 CCTGCTGCTGCCCCATGGCTGGG - Intronic
1184667520 22:45996691-45996713 CGCCCTCCTGCTCCACGGCCTGG + Intergenic
1185049901 22:48548555-48548577 CACTCCCCTGCCCCAGAGCCTGG - Intronic
1185172948 22:49304164-49304186 CACCCTCCTGTGGCATGGCCAGG - Intergenic
1185287917 22:50010750-50010772 CCCGCCCCTGCCCCACGGCACGG + Intronic
1185417452 22:50718042-50718064 CAGGCCCCTGCCCCATGCCCTGG + Intergenic
949918277 3:8981831-8981853 CTCTCTCCTGACCCCTGGCCTGG + Exonic
953044186 3:39280789-39280811 CATGCTTCTGCTCCCTGGCCTGG + Intronic
953787709 3:45923149-45923171 GTCGCTCCCGCCACATGGCCAGG + Intronic
953890884 3:46750797-46750819 GACCCTCCAGCCTCATGGCCGGG - Intronic
953993839 3:47504418-47504440 CACGCTCCCGCGCCATGGTCAGG + Exonic
954326820 3:49868521-49868543 TACTCTCCAGCCCCATGCCCTGG - Intronic
954382829 3:50228637-50228659 AACTTTCTTGCCCCATGGCCGGG + Intronic
956353976 3:68370143-68370165 CAGGCGCCTGCCACATTGCCAGG - Intronic
956759902 3:72431821-72431843 CATGCTCCTGCCCTCTAGCCTGG + Intronic
957093851 3:75759317-75759339 CACGCCACTGCACTATGGCCTGG - Intronic
960867672 3:122218389-122218411 CAGGCTCCTGCCACACCGCCTGG - Intronic
961514009 3:127421684-127421706 CCTGCTCCTGCCCCCTGCCCTGG - Intergenic
961647135 3:128398605-128398627 CAGGTCCCTGCCCCAGGGCCCGG - Intronic
961750135 3:129089696-129089718 CCTGCTCTTGCCCTATGGCCAGG + Exonic
962960072 3:140302921-140302943 CACAGTCCTGCCCCATCTCCGGG - Intronic
965277709 3:166707343-166707365 CATGCCACTGCACCATGGCCTGG + Intergenic
967861021 3:194151720-194151742 CAGGCTCCTGCCACAACGCCTGG - Intergenic
968034545 3:195535279-195535301 CAGGCACCTGCCACGTGGCCTGG + Intronic
968085092 3:195870607-195870629 CACCCTTCTGCCACATGGCCAGG + Intronic
968092806 3:195909090-195909112 CGCGCTCCTGCACCCCGGCCCGG + Intronic
969464728 4:7349497-7349519 CAGCCCCCTGCCCCATGACCCGG - Intronic
969931233 4:10632979-10633001 CACGCCCCTGCACTCTGGCCTGG - Intronic
970604597 4:17667322-17667344 CACCCTCCAGCCACATGCCCAGG - Intronic
970633583 4:17981697-17981719 CACGCTCCTGCACTCTAGCCTGG + Intronic
972524501 4:39895082-39895104 CAGGCTCCTGCCACCTCGCCCGG - Intronic
972633770 4:40864494-40864516 AATTCTCCTGCCCAATGGCCTGG + Intronic
975041023 4:69744152-69744174 CACGCTGCTCCCCCATTGGCGGG + Intronic
981715843 4:147751405-147751427 CACGCCACTGCACCCTGGCCTGG - Intronic
982590822 4:157307486-157307508 CAGGCTGTTGCCACATGGCCTGG - Intronic
983561583 4:169107014-169107036 CAGGCTCCTGCCCTGTGGACGGG - Exonic
985489540 5:171333-171355 CCAGCTCCTGCCCCTGGGCCAGG - Exonic
985705610 5:1399923-1399945 CTTGCTCCTGCCCCATGTGCAGG + Intronic
985791022 5:1926804-1926826 TTCCCTCCTCCCCCATGGCCAGG + Intergenic
986286995 5:6366493-6366515 ACCTCTCCTGCCCCATGGCCTGG + Intergenic
986735127 5:10662691-10662713 CCAGCCCCTGTCCCATGGCCTGG + Intergenic
987075756 5:14380361-14380383 CTCGCTCCTGCACCAGGTCCAGG + Intronic
987882518 5:23767278-23767300 CACGCCACTGCCCTCTGGCCTGG + Intergenic
992080344 5:73230583-73230605 CGCGCTCCAGCCCCGCGGCCCGG - Intergenic
993166300 5:84358750-84358772 CAGGCGCCTGCCACAAGGCCCGG + Intronic
995091586 5:108184447-108184469 CAGGCACCTGCCACAAGGCCTGG + Intronic
997365201 5:133321194-133321216 CATGCTCCTGCCCAGGGGCCTGG + Intronic
997499111 5:134357486-134357508 CAGGCTCCTGCCACCAGGCCCGG - Intronic
998579770 5:143359872-143359894 CACCCTCCTGCACCATAGCCTGG + Intronic
998885108 5:146685965-146685987 AACATTCCTGCCCCATGGTCAGG + Intronic
1000260636 5:159585200-159585222 CATGCCCCTTCCCCTTGGCCAGG + Intergenic
1000336602 5:160245985-160246007 CACACTCCTGATTCATGGCCGGG - Intergenic
1001328552 5:170746361-170746383 CTTCCTCCTGCCCCATGGCCTGG - Intergenic
1001522220 5:172402961-172402983 CACGGTTCTGCCCCACAGCCAGG - Intronic
1004346225 6:14851751-14851773 CAGGCTCCTGCCACCTCGCCCGG - Intergenic
1006137073 6:31901823-31901845 CACGCTCCTCTCACCTGGCCCGG + Exonic
1006904432 6:37523483-37523505 CACGCCACTGCCCCCTAGCCTGG + Intergenic
1007776795 6:44228500-44228522 CAGGCTCCTGCACTCTGGCCAGG + Intronic
1007778641 6:44238174-44238196 CACGCCACTGCCCCGTGTCCGGG + Intergenic
1008598474 6:53065797-53065819 CACCCTCGAGCCCCCTGGCCAGG - Intronic
1017175739 6:151503131-151503153 CACGCCGCTGCCCTCTGGCCTGG + Intronic
1018427894 6:163699900-163699922 CACTCTCCTCTCCCCTGGCCAGG - Intergenic
1019190939 6:170250259-170250281 CACCCTCCTGCCTCTGGGCCTGG + Intergenic
1019197271 6:170290014-170290036 CGCGCTCCTGCCCCGCGCCCCGG + Intronic
1019360638 7:602590-602612 CACCCTCCTGCCCCAGCGCCAGG - Intronic
1019930613 7:4220597-4220619 CATGCTTCTTCCCCATGACCTGG - Intronic
1022819980 7:33950212-33950234 CACCCTCCTCCACCATGGCCAGG - Intronic
1022820188 7:33951824-33951846 CACCCTCCTCCACCATGGCCAGG - Intronic
1023834221 7:44059002-44059024 CCTGCTGCTGCCTCATGGCCAGG - Intronic
1026712275 7:72752586-72752608 CACGCTCCTGCCACCATGCCCGG - Intronic
1029351465 7:100015853-100015875 CATGCCCCTGCCTCCTGGCCGGG + Intronic
1029428119 7:100510109-100510131 CACTCTACTGCCCTCTGGCCTGG + Intergenic
1029592289 7:101515074-101515096 AAAGCTCCTGCCCCGTGGGCAGG - Intronic
1030271899 7:107677628-107677650 CAGGGTCTTGCCCCATTGCCTGG + Intronic
1032333737 7:131005018-131005040 CACTCCCCTGCACTATGGCCTGG - Intergenic
1032379271 7:131459217-131459239 CAGGGTCCTGCCCCATTCCCAGG - Intronic
1034075241 7:148225265-148225287 CCCTCTCCTTCCCCTTGGCCAGG - Intronic
1034147932 7:148888674-148888696 CACGCTTCTGCCTCAGGCCCAGG - Intergenic
1036796414 8:11759406-11759428 GACACTCCTGCCCCCTGACCAGG - Exonic
1037742171 8:21616574-21616596 CCCGCTCCAGCCCCATAGCCAGG + Intergenic
1037805197 8:22054975-22054997 TGCGCTCCTGCCCCACGCCCTGG + Intronic
1037969346 8:23160989-23161011 GAAGCTTCTGCCCCAAGGCCAGG + Intronic
1038364309 8:26915604-26915626 GAGGCTCCCGCTCCATGGCCTGG + Intergenic
1038958073 8:32488839-32488861 CAGGCACCTGGCCCATGGCTGGG + Intronic
1039546392 8:38414098-38414120 CCCACTCTTGCCCCAAGGCCTGG + Intronic
1039851879 8:41375110-41375132 CATTCTCCTGCCTCATGCCCAGG - Intergenic
1042563764 8:70092979-70093001 CGTGCTCCTACCACATGGCCTGG + Intergenic
1046163062 8:110392398-110392420 CAGGCTCCCGCCACAAGGCCCGG + Intergenic
1048263932 8:132968776-132968798 CAGGTTCGTGCCCCAAGGCCAGG - Intronic
1048450739 8:134531388-134531410 CACGCCAATGCCCCATGTCCAGG - Intronic
1049074132 8:140380510-140380532 CAGGCACCTGCCACAAGGCCTGG - Intronic
1049217666 8:141415447-141415469 GACCCTCCTGCCCTCTGGCCGGG + Intronic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1049538059 8:143191706-143191728 CAAGCTGCTGCCCCGTGCCCAGG - Intergenic
1053283396 9:36835866-36835888 CCAACTCCTGCCCCACGGCCAGG - Exonic
1055781815 9:79828909-79828931 CACGCTCCCGCCCCAGCGTCTGG - Intergenic
1057141232 9:92727864-92727886 CATGCCCCTGCCCCAGGGACAGG + Intronic
1057283415 9:93728523-93728545 CAGGCTCCTGCCCCATGACTGGG + Intergenic
1057481356 9:95447616-95447638 CACGCTCCTCCGCCAGGTCCTGG - Intronic
1057586864 9:96336261-96336283 CAGGCTCCTGCCTCCAGGCCTGG - Intronic
1060515637 9:124264039-124264061 CTCACTTCTGCCCCACGGCCAGG - Intronic
1060912411 9:127361660-127361682 CAGGCTTCAGCCCCAGGGCCAGG - Intronic
1060934928 9:127509219-127509241 CAGGCGCCAGCCCCAGGGCCTGG - Intronic
1185835647 X:3344766-3344788 CACGCGCCTGCCCATTCGCCCGG + Intronic
1189324913 X:40106216-40106238 GACTCTCCTGGCCCAGGGCCCGG + Intronic
1190178827 X:48174267-48174289 CACGCCCCTGCACTCTGGCCTGG - Intergenic
1195065490 X:101235013-101235035 CCTGCTCCTGCCCCCTGGCTGGG + Intronic
1195394985 X:104400719-104400741 TACCCTCCTGCCCCATTGCTAGG + Intergenic
1196892039 X:120300528-120300550 CAGGCTCATGCCACAGGGCCAGG + Intronic
1197659601 X:129155917-129155939 CAGGCTCCTGCCACAATGCCTGG + Intergenic
1200083016 X:153588750-153588772 CAGGCTCCTGCCTCCTGCCCGGG + Intronic
1200237097 X:154472922-154472944 CACCCTCCTGCCCTGTGCCCAGG + Exonic
1201794521 Y:17880664-17880686 CAGGCACCTGCCACCTGGCCCGG + Intergenic
1201807034 Y:18025321-18025343 CAGGCACCTGCCACCTGGCCCGG - Intergenic