ID: 1078141225

View in Genome Browser
Species Human (GRCh38)
Location 11:8694403-8694425
Sequence GGCTGAGCACCCTGCAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 2, 2: 4, 3: 46, 4: 397}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078141225 Original CRISPR GGCTGAGCACCCTGCAGGGA GGG Intronic
900151412 1:1180788-1180810 TGCTCAGCACCCTTCGGGGACGG + Exonic
900383950 1:2400828-2400850 GGCAGAGCAACCATCAGGGAGGG - Intronic
900868928 1:5288134-5288156 GGCTGAGCCTCCAGCATGGATGG - Intergenic
900929100 1:5725155-5725177 GGCTCAGCCCCCGGCAGGCAAGG + Intergenic
901225158 1:7609042-7609064 GGCTGGGCCCCCCGCAGGGGTGG + Intronic
901238201 1:7678769-7678791 GCCTGAGCCCCTTGCAGGGGTGG + Intronic
901290263 1:8118532-8118554 AGGTGAGCACACTGCAGGAAAGG - Intergenic
902288529 1:15422028-15422050 GGCTGAGAACCCTGCTGCAATGG - Intronic
903217690 1:21852296-21852318 GGCTGAGCTAGCTGCAGGGTGGG - Intronic
903446616 1:23426305-23426327 GGCTCAGGAACCTGGAGGGAAGG + Intergenic
903462367 1:23528842-23528864 AGCTGAGCTCCCCCCAGGGAAGG - Intronic
904049593 1:27631290-27631312 AGCTGGTCACCCAGCAGGGAGGG + Intronic
904293193 1:29500822-29500844 GGCAGAGAGGCCTGCAGGGAGGG - Intergenic
904320638 1:29695748-29695770 GGGTGAGCACTCAGCAGAGAGGG + Intergenic
904852085 1:33467018-33467040 GGCTGAGCTGCCTGCCAGGATGG + Intergenic
905028139 1:34865298-34865320 GCCTGAGCTCCTTCCAGGGATGG - Intergenic
905873147 1:41416324-41416346 GGCTGAGGAACCTGCTGGGTGGG + Intergenic
906376176 1:45298712-45298734 GGCTGAGCATAATGCAGGGCTGG - Intronic
907326074 1:53639331-53639353 AGGAGAGCAGCCTGCAGGGAGGG - Intronic
908431261 1:64060739-64060761 GACTCAGCACTCTGCAGAGAAGG + Intronic
910384543 1:86666482-86666504 AGCTCACCACCCTGAAGGGAAGG + Intergenic
910515304 1:88053999-88054021 GGCTCACCACCCTGAAGGGATGG - Intergenic
911745787 1:101440554-101440576 GGTTGTCCTCCCTGCAGGGATGG + Intergenic
912643972 1:111373175-111373197 GGCTCAGCACCTTGAAGGGAAGG + Intergenic
915325002 1:155077280-155077302 GGATGAGGAGCCTGCAGGGAGGG + Intergenic
917299168 1:173555144-173555166 GGCTGTGGAACCTGCAGGGTGGG + Intronic
917682778 1:177384784-177384806 GACTGAGCTCCCTGCAGGAGGGG - Intergenic
918039150 1:180901672-180901694 GGCAGGGCACCCTGAAGGCAGGG + Intergenic
919241844 1:194924724-194924746 GGTTGTGCACTGTGCAGGGAAGG + Intergenic
919802086 1:201360082-201360104 GGGGCAGCACCCTGCAGGGGTGG - Intronic
919805075 1:201376710-201376732 GGCTGAGGACTATTCAGGGAGGG - Intronic
920197505 1:204238889-204238911 GGCTGTGCACTTTGCATGGAAGG + Intronic
920584784 1:207146919-207146941 GGCTGAGCAGGCTCCAAGGATGG + Intergenic
921100618 1:211925362-211925384 TTCTGAGCAGCCAGCAGGGAAGG - Intergenic
922996374 1:229965465-229965487 GCCAGAACACCCTGGAGGGAAGG - Intergenic
923011980 1:230095449-230095471 GGCTGAGGAGCCCGCAGGGGTGG - Intronic
923518821 1:234720523-234720545 AGCTGAGGGCCGTGCAGGGAAGG + Intergenic
924115663 1:240743697-240743719 GACTGAACACCCTGCATGTAAGG - Intergenic
924840706 1:247707313-247707335 GGTTGTGCACCTTGCATGGAAGG - Intergenic
924934462 1:248756355-248756377 TGCAGAGCACACTGCAGGCAGGG - Intergenic
1062760191 10:11841-11863 GGCTGCGCAGCCGCCAGGGAGGG - Intergenic
1062979464 10:1710030-1710052 GACTGAGCACTTTGCAGAGAAGG - Intronic
1063179382 10:3584091-3584113 GGCCAACCACGCTGCAGGGAAGG - Intergenic
1063799717 10:9560641-9560663 GCCTGAGCACCTGGAAGGGATGG + Intergenic
1063981156 10:11452921-11452943 CTCAGAGCAGCCTGCAGGGAAGG + Intergenic
1066166954 10:32798707-32798729 GGTTGTGCACTCTGCATGGAAGG - Intronic
1067144684 10:43686501-43686523 AGCTGAACACCCTGAAGGAAAGG + Intergenic
1067294712 10:44968668-44968690 AGCTGGGCATTCTGCAGGGATGG + Intronic
1067805372 10:49388399-49388421 GGCTGAGCCCTCTGCTGGGCTGG + Intronic
1067806225 10:49395294-49395316 GGCTGCGCCCCCCGCAGGGCGGG + Intronic
1069635466 10:69922330-69922352 GCCTGAGCACCCTGCAGTGATGG + Intronic
1069826266 10:71256949-71256971 GGGTGAGCACAGAGCAGGGAAGG + Intronic
1070373695 10:75809113-75809135 GGCTATGAAGCCTGCAGGGAAGG - Intronic
1070385194 10:75917882-75917904 GGAGCAGCATCCTGCAGGGAAGG + Intronic
1070811790 10:79301776-79301798 GGATGAGCACCCTGGCAGGAAGG + Intronic
1071503878 10:86221649-86221671 GGCCCAGCACCCTCCAGGAATGG + Intronic
1072782675 10:98261122-98261144 GACTGTGCACCCCGCAGGGCCGG - Exonic
1074121355 10:110496508-110496530 GGAAGAGCAGCCTGCAGGGAAGG + Intergenic
1074235681 10:111582267-111582289 GGCAGAGCAGCCTGCATGGTGGG + Intergenic
1075548885 10:123377525-123377547 GGCTCAGCACCATGGAGGGATGG + Intergenic
1076025179 10:127106187-127106209 GGCTGAGCAGCATGCAGGTTAGG - Intronic
1076497342 10:130905617-130905639 GCCTGAGCCCCATCCAGGGAGGG - Intergenic
1076498434 10:130914949-130914971 GGCAAAATACCCTGCAGGGAAGG + Intergenic
1076732788 10:132446781-132446803 GGATGCCCACCCTGCTGGGAAGG + Intronic
1076783540 10:132737604-132737626 GGCTGAGGAGCTGGCAGGGAGGG - Intronic
1077027639 11:448317-448339 GCCTCTGCACCCTGGAGGGACGG + Intronic
1077054565 11:584640-584662 GGCTGAGCGCCCCGAAGGAAGGG + Intronic
1077173857 11:1180071-1180093 GGCAGGGCACCCCGCAGGGCTGG - Intronic
1077551124 11:3200781-3200803 GCCCGGGCCCCCTGCAGGGAAGG + Intergenic
1078141225 11:8694403-8694425 GGCTGAGCACCCTGCAGGGAGGG + Intronic
1078524623 11:12090914-12090936 GGCTGTGGGCCCTGCAGGGGAGG - Intergenic
1079437634 11:20474067-20474089 AGGTCAGTACCCTGCAGGGATGG - Intronic
1080094885 11:28394063-28394085 GGCTGAGCACCTTGTAAGTAGGG + Intergenic
1080839481 11:35970983-35971005 GGCTGAGCACCAGGGAGAGATGG - Intronic
1083170897 11:60923687-60923709 ACCTCAGCACACTGCAGGGAAGG - Intergenic
1083419511 11:62545355-62545377 GGCTGTGCCCCTTGCTGGGAGGG - Intronic
1083681806 11:64354869-64354891 GGCTGAGGCTCATGCAGGGAGGG - Intronic
1083709877 11:64541354-64541376 GGCAGGGCACCCTGCAGAGTAGG - Intergenic
1084400662 11:68941103-68941125 TGCTGAGCACCATGCACAGAAGG + Intergenic
1084686005 11:70695758-70695780 GGCTGTGCTCCATGCAGGGTGGG + Intronic
1085196751 11:74677233-74677255 GGGTGAGCACCCACCAGGGCTGG + Intergenic
1085414556 11:76311493-76311515 GACTGACCAGCTTGCAGGGAGGG + Intergenic
1085486031 11:76863367-76863389 CTCTGAGCAGACTGCAGGGAGGG + Intronic
1088836732 11:113583886-113583908 GGCTGTGCACTTTGCATGGAAGG + Intergenic
1089036151 11:115394662-115394684 GACTGAGCACACTACAGAGATGG + Intronic
1089080866 11:115775302-115775324 CCCTGAGCACCCTGGAAGGAGGG + Intergenic
1089769074 11:120789715-120789737 GCCTGAGCACCTGGCAGGGAAGG - Intronic
1089981935 11:122779798-122779820 GGTGGAGGACCCTGCAGGAATGG + Intronic
1090364419 11:126193574-126193596 GGCAGAGGATCCTGCAGGAATGG + Intergenic
1092194368 12:6540433-6540455 CGCTGAGCTCCCTGCTGCGAGGG + Exonic
1095409839 12:41909524-41909546 GGCTGAGCAGGCTGCAGAGGTGG - Intergenic
1095672634 12:44877571-44877593 GTCTGAGCCCCCTGCAAGGCAGG + Intronic
1096077046 12:48812498-48812520 GGCAGGGCACCCTGCTGAGAGGG - Intergenic
1096457391 12:51798939-51798961 GGCTGTGCACTTTGCATGGAAGG - Intronic
1096606633 12:52771168-52771190 GGCTGAGCAGCGTGGAGAGATGG - Exonic
1097821279 12:64131407-64131429 GGCTGTGCACTTTGCATGGAAGG - Intronic
1098308263 12:69123015-69123037 GGCTGAGCAGCCTGCTGCGCTGG + Intergenic
1099298467 12:80861291-80861313 GGAGCAACACCCTGCAGGGAAGG - Intronic
1099433859 12:82620133-82620155 AGCTCATCACCCTGAAGGGAAGG + Intergenic
1100603365 12:96131245-96131267 AGAAGAGCACCCTGCAGAGAGGG + Intergenic
1100904989 12:99286972-99286994 AGCTCACCACCCTGAAGGGAAGG + Intronic
1101321111 12:103673827-103673849 GGCAGAGCACCCTGGAGGACAGG - Intronic
1101676185 12:106918837-106918859 GGCTGAGGACCCGAAAGGGAAGG - Intergenic
1102505884 12:113384434-113384456 GGCTGAGGAGCCTGCAGGGGAGG - Intronic
1102554915 12:113720568-113720590 GGCTGAGGAGGCTGCAGGGGAGG - Intergenic
1103558465 12:121779741-121779763 CTCTGAGGACTCTGCAGGGATGG + Exonic
1103813410 12:123633871-123633893 CGGTGAGGACCCTGCAGGGCGGG + Exonic
1103869484 12:124081107-124081129 GGCTGAGCAGCCTCCAGAGAAGG + Intronic
1104372925 12:128239098-128239120 GGCTGAGGACTCTGCTGGGCTGG - Intergenic
1104967249 12:132513857-132513879 CGCTGAGCAGCCCCCAGGGAGGG + Intronic
1105303442 13:19154129-19154151 GGCTGAGCTACCTGCAGCCATGG - Intergenic
1105899609 13:24743806-24743828 GGCTGCACAACCTGCAGGCATGG - Intergenic
1107412711 13:40172521-40172543 GGCTGCGCTCCCTACACGGACGG - Intergenic
1107836692 13:44417503-44417525 GGCTGAGAGCCCTGCAGAAATGG - Intergenic
1113047705 13:106173640-106173662 GGCTCAGCAGCCTGCTGGGGTGG - Intergenic
1113905500 13:113817461-113817483 GGATGTGCCCCCTGGAGGGAGGG - Intergenic
1113905521 13:113817509-113817531 GGATGTGCCCCCTGGAGGGAGGG - Intergenic
1120424473 14:84329661-84329683 GGCTGCAGACCCTGCAGTGATGG - Intergenic
1120835585 14:89035955-89035977 TGTTGAGCACCGTGCAGGGTGGG + Intergenic
1120973776 14:90231334-90231356 GGTTGTGCACTCTGCATGGAAGG + Intergenic
1121088507 14:91164914-91164936 AACTCACCACCCTGCAGGGAAGG - Intronic
1121284714 14:92726342-92726364 GGCTGGGCAGACTGCAGTGACGG - Intronic
1121310365 14:92932422-92932444 GGCTCAGGACCCCGAAGGGAAGG + Exonic
1121637857 14:95465942-95465964 GGCTGAGTACGATGCAGTGAAGG - Exonic
1121845846 14:97171398-97171420 GGCTTAGCACGCTCCGGGGATGG - Intergenic
1122106614 14:99462022-99462044 AGATGAACACCCTGCAAGGAGGG + Intronic
1122126962 14:99584410-99584432 GGATAAGCACCCTGCCTGGATGG - Intronic
1122237816 14:100342468-100342490 GTCTGGGCGCCCTGCAGGGCTGG + Exonic
1122392805 14:101401895-101401917 GGATGAGAACCCTGCAGGCCAGG + Intergenic
1122704165 14:103609647-103609669 GGGAGAGCAGTCTGCAGGGAAGG + Intronic
1122704423 14:103611213-103611235 GGGAGAGCAGTCTGCAGGGAAGG + Intronic
1122706461 14:103625069-103625091 GGGTGAGCAGGCTGCGGGGAGGG + Intronic
1122820019 14:104337531-104337553 GTCTGAGCAGCCAGCAGGGCTGG + Intergenic
1122972040 14:105156243-105156265 GGCTAGGGGCCCTGCAGGGAGGG + Intronic
1123110475 14:105864767-105864789 GGCTGAGACCCAGGCAGGGAGGG + Intergenic
1125505980 15:40267853-40267875 GACAGTGCACCCTGCTGGGAAGG + Intronic
1125676692 15:41505857-41505879 AGCGGAACACCCTGAAGGGAAGG - Intronic
1125727824 15:41877057-41877079 GGATGAGCTCCCTCCAGTGATGG + Intronic
1126047954 15:44662014-44662036 GTTTGAGAACCCAGCAGGGAAGG - Intronic
1127287697 15:57545531-57545553 GGCTGGGCCCCCTGCAGGGATGG + Intronic
1127734043 15:61825312-61825334 TGCTGGGCAGCCTGGAGGGAGGG + Intergenic
1127783357 15:62335272-62335294 AGCTCATCACCCTGAAGGGAAGG - Intergenic
1128380063 15:67105904-67105926 GGCTGTGCAGACGGCAGGGAGGG - Intronic
1129251323 15:74310737-74310759 GGCTGAGCAGGCTGTAGAGAAGG + Intronic
1129466751 15:75728377-75728399 AGCTGGGCAGACTGCAGGGAAGG + Intergenic
1129873529 15:78957107-78957129 TGCTGGGCACCCCCCAGGGATGG - Intergenic
1130375201 15:83322831-83322853 GGCTGTCCACCGTGAAGGGAGGG + Intergenic
1130644197 15:85709389-85709411 GCCTGAGCACCTCACAGGGAGGG + Intronic
1131047244 15:89323964-89323986 GTCTGAGTACCATGCAGGGAGGG - Intronic
1131582414 15:93657708-93657730 GGCTGTTTACCCTGCAGGGAAGG + Intergenic
1132199923 15:99944301-99944323 GGCAGACCACCAGGCAGGGATGG + Intergenic
1132314322 15:100879502-100879524 GGCTCAGCTCCCTGCCGGGTCGG + Exonic
1132402842 15:101523947-101523969 GTCTCAGCACCCTGCAGGGCAGG - Intronic
1133064414 16:3195904-3195926 GGCTGCGCACCCAGGTGGGAGGG - Intergenic
1134431883 16:14217140-14217162 ATCTGAGTAGCCTGCAGGGATGG - Exonic
1134704512 16:16293049-16293071 GGCTGCGCCTGCTGCAGGGAAGG + Intronic
1134963030 16:18419065-18419087 GGCTGCGCCTGCTGCAGGGAAGG - Intronic
1134967325 16:18501664-18501686 GGCTGCGCCTGCTGCAGGGAAGG - Intronic
1135125413 16:19805475-19805497 TGCTAGGCAACCTGCAGGGAAGG + Intronic
1136685806 16:31994363-31994385 GGCCGAGGGCCCTGCTGGGAGGG - Intergenic
1136786419 16:32937896-32937918 GGCCGAGGGCCCTGCTGGGAGGG - Intergenic
1136883353 16:33915899-33915921 GGCCGAGGGCCCTGCTGGGAGGG + Intergenic
1137537556 16:49339010-49339032 CGCTGAGAACCCAGCAAGGATGG - Intergenic
1137540743 16:49360046-49360068 GGCGGTGCACACTGCAGGAAGGG - Intergenic
1138452427 16:57101620-57101642 GGCTGACCACACCCCAGGGATGG - Intronic
1139473024 16:67188393-67188415 AGCTGAGGATCCTGGAGGGAAGG + Intronic
1139634729 16:68251274-68251296 GGCTGAGTTCCGTGAAGGGAGGG + Intronic
1139923863 16:70475118-70475140 GGCTGAGGAGCCTGAAGGGAAGG + Intronic
1141721125 16:85755940-85755962 GGCTGAGCCTCCTGCATGGATGG - Intergenic
1141810431 16:86372124-86372146 GACTGAGCACCCTGGAGGCAAGG + Intergenic
1142359556 16:89619733-89619755 GGCACAGCAGGCTGCAGGGAGGG - Intronic
1142366313 16:89651776-89651798 GGCCCAGCACACCGCAGGGAAGG + Intronic
1142381030 16:89732318-89732340 GGCTGGGCTCCCTGCAGTGGAGG + Intronic
1203016131 16_KI270728v1_random:354939-354961 GGCTGGCCACCCTCAAGGGATGG - Intergenic
1203034466 16_KI270728v1_random:628097-628119 GGCTGGCCACCCTCAAGGGATGG - Intergenic
1203088653 16_KI270728v1_random:1199562-1199584 GGCCGAGGGCCCTGCTGGGAGGG - Intergenic
1142967810 17:3592023-3592045 AGCTGGGCTCCCAGCAGGGAGGG + Intronic
1143919214 17:10317598-10317620 CTCAGAGCACCCTGCAAGGAGGG + Intronic
1144330248 17:14216781-14216803 CTCTGAGCACCCTGCTGGAAAGG + Intergenic
1144853813 17:18257483-18257505 GGCTCCCCACCCTGCAGGGCAGG + Intronic
1146183743 17:30712048-30712070 GGCTGTGGAGCCTGCAGGGAGGG + Intergenic
1146544358 17:33725417-33725439 GGCAGGGCAGCCTGCAGTGATGG + Intronic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147324601 17:39664261-39664283 AGCTGAGGACCCTGTGGGGACGG - Exonic
1148143114 17:45342323-45342345 GGCTGAGCAGCTTGCTGAGATGG - Intergenic
1148339134 17:46863037-46863059 GGCTGAGGACCATGGCGGGATGG + Intronic
1148820229 17:50355736-50355758 GGCTGGGGATCCTGCAGGGTGGG - Intronic
1148858732 17:50593131-50593153 GGCTGTGCCTCTTGCAGGGAAGG + Intronic
1149448097 17:56729405-56729427 GGGTGAAGAGCCTGCAGGGAAGG - Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150550445 17:66204678-66204700 AGCTCACCACCCTGAAGGGAGGG + Intergenic
1150980669 17:70138173-70138195 TGCTGAGCACCTAGCAGGGATGG + Intergenic
1151362994 17:73599801-73599823 GGCTGAGCTCCCTGCAAGTGGGG - Intronic
1151491328 17:74433532-74433554 GCCTGAGCGCCCTGCACAGAGGG + Intronic
1151551681 17:74826015-74826037 GGCTGAGCAGCCTGCAGGAAAGG + Intronic
1151699533 17:75735974-75735996 GGCTGCCCACCTGGCAGGGAGGG - Intronic
1152246158 17:79185583-79185605 TCCTGAGCATCCTCCAGGGAAGG - Intronic
1152420095 17:80188050-80188072 AGCTGAGCAGCCGGCAGTGATGG - Intronic
1152953099 18:12195-12217 GGCTGCGCAGCCGCCAGGGAGGG - Intergenic
1153714957 18:7838740-7838762 AGCTCTCCACCCTGCAGGGAAGG - Intronic
1154252604 18:12756780-12756802 GGCTGTGCACGTTGCATGGAAGG - Intergenic
1154412802 18:14150457-14150479 GGCTCAGCACCCTGCAGGGAGGG + Intergenic
1155427740 18:25723968-25723990 AGCAGAGCTCCCTGCAGAGAGGG + Intergenic
1156071226 18:33212555-33212577 GGCAGAGCAAGCTGCAGGGTTGG - Intronic
1156479033 18:37424689-37424711 AGCTGGGGAACCTGCAGGGAAGG - Intronic
1156479581 18:37427555-37427577 GGCTGGGGAGCCTGCAGAGAGGG - Intronic
1157293694 18:46427110-46427132 GTCTCAGCACCCTGCTGAGAAGG - Intronic
1157932786 18:51841703-51841725 AGCTGATCCCCATGCAGGGAAGG + Intergenic
1158292644 18:55958373-55958395 TGCTGAGCACCCTGAAAGCATGG + Intergenic
1158453705 18:57588446-57588468 GGCCCAGCACCCTGGATGGAGGG - Intergenic
1158642821 18:59218278-59218300 GGCTGGGAACCCGGGAGGGATGG + Intergenic
1160500366 18:79398637-79398659 GGCCGCGGGCCCTGCAGGGATGG - Intronic
1160761699 19:788791-788813 GGCGCAGCAGCCTGCAGGGCTGG + Intergenic
1160866117 19:1256868-1256890 TGCTGACCTCCCTCCAGGGAGGG + Intronic
1160992534 19:1865558-1865580 GGGTGAGCAGCCTCCAGGGGTGG + Intergenic
1161495412 19:4583611-4583633 GGCTGGGCACAGCGCAGGGAAGG - Intergenic
1162281648 19:9702782-9702804 GGCTGAGCACCTGGAAGGAACGG + Intergenic
1162554966 19:11381156-11381178 TGCTGAGCAACCTGCGGGGCCGG - Exonic
1162975053 19:14203705-14203727 GGCTGTGGAGCCTGCAGGGAGGG - Intronic
1163520477 19:17788644-17788666 GGTTGAGCGCAGTGCAGGGAGGG - Intergenic
1163585691 19:18162267-18162289 CACTCAGCATCCTGCAGGGAGGG - Exonic
1163633835 19:18429543-18429565 GTCTGTCCACCCCGCAGGGAGGG - Intronic
1163698357 19:18775157-18775179 GGCTGAGTCCCCGGCAGGGGTGG + Intronic
1163722145 19:18903413-18903435 TTCTCACCACCCTGCAGGGAGGG + Exonic
1163817515 19:19475781-19475803 GGATGAGGAGCCTGCAGGAAAGG - Intronic
1164616069 19:29667466-29667488 GGCCCAGGTCCCTGCAGGGAAGG + Intronic
1164643617 19:29843477-29843499 GGCAGAGCCCCGTGCAGGGAAGG - Intergenic
1164777681 19:30865689-30865711 GGCTGAGCATGCTGCGGGAAGGG + Intergenic
1165157579 19:33797338-33797360 GGCCGAGCGCCCTGCAGAGCTGG + Intronic
1166096220 19:40541205-40541227 GACTGAACCCCCTACAGGGAGGG - Intronic
1166412020 19:42561717-42561739 GGATGCGCCCTCTGCAGGGAGGG + Intergenic
1166804511 19:45477325-45477347 GGGTGGGGACCCTGCAGGGTGGG + Intronic
1167247653 19:48383359-48383381 CGCTGGGGCCCCTGCAGGGAGGG + Intronic
1167739925 19:51318412-51318434 GGAAGTGGACCCTGCAGGGAAGG - Intronic
1168224137 19:54982430-54982452 GGCTGAGCTCCCTGCAGCTGAGG - Exonic
1168242025 19:55093185-55093207 GGCAGAGAAGGCTGCAGGGAAGG - Exonic
1168343762 19:55640908-55640930 TGCGGAGCGCCCTGCGGGGAGGG - Intronic
925122734 2:1432072-1432094 GGCTGAGTCGCCTGCAGGGCGGG - Intronic
925142914 2:1562315-1562337 GGCTGGACGCCCTGCAGGGAGGG + Intergenic
925294234 2:2767189-2767211 TTCTGAGCTCCCTGCAGGGAGGG + Intergenic
925551795 2:5084328-5084350 GGGTGAGCACAGTGCAGGAATGG + Intergenic
926120956 2:10240994-10241016 GGCTGAGCTCCCCGCAGGAAGGG - Intergenic
926140646 2:10365858-10365880 GGCTCAGCACCCAGCAGGCGAGG - Intronic
926712122 2:15890126-15890148 GCCTGAGCACCCTGCAGTCAGGG + Intergenic
926753283 2:16216635-16216657 GGCTCACCTCCCTGCCGGGAAGG + Intergenic
928203542 2:29267510-29267532 GTGTAAGCACCCAGCAGGGAGGG + Intronic
929704999 2:44201273-44201295 GCCTGAGCAGCATGCAAGGATGG + Exonic
929978586 2:46657988-46658010 TGCTGAGCACCCTGGAAGGGTGG + Intergenic
932419310 2:71592193-71592215 GGCCGAGCACCCTGCAGAGAGGG + Intronic
932850728 2:75182284-75182306 GCCTGTGCTCCCTGCAAGGAAGG + Intronic
933512331 2:83256767-83256789 GGCAGAGCACCATGCATTGAAGG + Intergenic
934094291 2:88584863-88584885 GGCTGAGCACGGTGGAGGGGAGG + Intronic
936396964 2:112138554-112138576 CGCCCCGCACCCTGCAGGGACGG + Exonic
936514420 2:113172939-113172961 GACTCTGTACCCTGCAGGGAGGG + Intronic
936846423 2:116840505-116840527 GGCTGTCCAACCTGCAGTGAAGG + Intergenic
939045516 2:137245453-137245475 GGCTGAGGACCCGGGAAGGAGGG - Intronic
943111459 2:183611313-183611335 AGCTGATCACCATCCAGGGAAGG + Intergenic
944392177 2:199228934-199228956 GGGGGAGCCCCCTGCAGGCAGGG + Intergenic
945251636 2:207769726-207769748 CGCGGAGCCCCCTGCAGGGGAGG - Intergenic
946143918 2:217714350-217714372 GGCTGACCAGCCTCCAGGCATGG + Intronic
946179892 2:217942841-217942863 GGCTGGGCTCCCTGCAGGGGAGG - Intronic
946199788 2:218064883-218064905 GGCTGGGCTCCCTGCAGGGGAGG - Intronic
947913096 2:233814506-233814528 GCATGAACTCCCTGCAGGGAGGG + Intronic
948019719 2:234720528-234720550 GGCTGAGTTCCCTGCGGGGAAGG - Intergenic
948032341 2:234829061-234829083 GCTTGAGAACCCTGCAGGGTGGG - Intergenic
948046704 2:234951502-234951524 GGCTGAGGACAGTGGAGGGAAGG - Intergenic
948606022 2:239135713-239135735 GGCCGAGCACCCAGCAGGCATGG + Intronic
948912607 2:241011934-241011956 GGCTCAGCCCCCAGCGGGGAGGG + Intronic
1168967197 20:1905893-1905915 GGCTGAGCACACTGCTGGCAAGG - Intronic
1169343687 20:4814170-4814192 GGGAGGCCACCCTGCAGGGAGGG + Intronic
1171225181 20:23436769-23436791 GGCTGAGGAACCTGCAGACAGGG - Intergenic
1172838182 20:37886398-37886420 GGCTGAGGGCACTGCAGGGCAGG - Intergenic
1173163619 20:40670915-40670937 TGGTTATCACCCTGCAGGGATGG - Intergenic
1173273811 20:41560565-41560587 GCCCAAGCACCCTCCAGGGAGGG + Intronic
1174110491 20:48194800-48194822 GTCTGCGCGCCCTGCAGGGCTGG - Intergenic
1174178542 20:48659863-48659885 GCCAGAGCCCCCTGCAGGCATGG - Intronic
1175242725 20:57561658-57561680 GTCCCAGCACCCTGCAGGCAGGG + Intronic
1175918665 20:62439678-62439700 GGCATCCCACCCTGCAGGGAGGG - Intergenic
1176363789 21:6020196-6020218 AGCTCAGCAGCCTCCAGGGAAGG - Intergenic
1176860205 21:14007798-14007820 GGCTCAGCACCCTGCAGGGAGGG - Intergenic
1176891015 21:14319775-14319797 GGCAGAGAGCCATGCAGGGAAGG - Intergenic
1177075268 21:16563954-16563976 GCCTGAGCAGCCTGCAGCGGGGG - Intergenic
1177821217 21:26032878-26032900 GGCTCAGAGCCCTGCAGAGATGG + Intronic
1179491165 21:41742409-41742431 GGCCTAGCAGCCTGCAGAGATGG + Intronic
1179759729 21:43518349-43518371 AGCTCAGCAGCCTCCAGGGAAGG + Intergenic
1179826328 21:43968345-43968367 GGGTGAGCACCTTCCAGGGGAGG + Intronic
1180591076 22:16937872-16937894 GGCTGTGCACTTTGCATGGAAGG - Intergenic
1180783350 22:18534108-18534130 GGTAGGGCTCCCTGCAGGGAGGG - Intergenic
1180911493 22:19454005-19454027 GGCTGAGCATCCTGTAGACATGG - Intronic
1180966015 22:19788322-19788344 GGCTGAGCATCCTGCCTGGTGGG + Exonic
1181111677 22:20606241-20606263 GGCTGAGCTACCTGCAGCCATGG - Intergenic
1181985259 22:26796249-26796271 GGCAGAGGAAGCTGCAGGGAGGG - Intergenic
1182146659 22:28000948-28000970 GGCTGGGCCCCAGGCAGGGAGGG - Intronic
1183299642 22:37052480-37052502 GGCTGAGCGCAGTGCAGGGAAGG - Intronic
1183548327 22:38467314-38467336 GGCTGAGCACCAGGAAGGGTGGG - Intergenic
1183985932 22:41570429-41570451 GCCTGAACACCCTGCATGGCAGG - Intronic
1184352359 22:43952507-43952529 GGCTGAGCGCCCTGAGGTGAGGG - Intronic
1184744203 22:46446576-46446598 TGCTGAGCACCTGGCAGGGAGGG + Intronic
1184839554 22:47044428-47044450 GGCAGAGCACCCAGCAGGTGCGG - Intronic
949679821 3:6500044-6500066 AGATGAGCACAATGCAGGGAAGG - Intergenic
950548516 3:13653075-13653097 TGCTGGGCCCCCTGCAGGGATGG - Intergenic
951122631 3:18946063-18946085 GGCTGTGCACTTTGCATGGAAGG + Intergenic
951742373 3:25938723-25938745 GGCTGAGGGCCCAGCATGGAGGG + Intergenic
951803638 3:26623485-26623507 GGGTGAGCACCGCGCAGGGAAGG - Intronic
951861100 3:27253701-27253723 CTCTGGGGACCCTGCAGGGAAGG + Intronic
953404407 3:42653550-42653572 GGCTGAGCAGGCAGCAGGGTGGG - Intergenic
953492612 3:43363985-43364007 GTCTGAGCAACTTGCAGGGGCGG + Intronic
953851636 3:46469585-46469607 TGCTGATCACCCTGAAGAGAGGG + Intronic
954415050 3:50389178-50389200 GGCCGAGCACCCTGCAGCTTGGG - Intronic
954419134 3:50409343-50409365 AGCAGAGCAAGCTGCAGGGAAGG + Intronic
954897039 3:53984485-53984507 GGCTCTGCACTCTGCAGGGCTGG - Intergenic
955463254 3:59208756-59208778 GCCTGATCACCCAGCAAGGAGGG - Intergenic
955807766 3:62755189-62755211 GCAGGAGAACCCTGCAGGGAAGG - Intronic
960466614 3:118003617-118003639 GCCTGAGCACCCTGCACTGCAGG + Intergenic
960923055 3:122767862-122767884 GGGTGAACAGCCTGCAGGGATGG + Intronic
961053503 3:123767206-123767228 GGTTGAGAAGCCTGCAGGTAGGG + Intronic
961723227 3:128909530-128909552 TGTTGATCACCCTGGAGGGATGG + Intronic
962422153 3:135238325-135238347 GGCTCAGCCACCTGCTGGGATGG + Intronic
962755943 3:138465462-138465484 AGCCCAGCACCCCGCAGGGAGGG - Intronic
967964607 3:194951196-194951218 GGCTGAGCACCTGGGTGGGACGG - Intergenic
968235522 3:197028493-197028515 GGCTGAGGACCCATCAGGGTAGG + Intronic
968506789 4:974453-974475 GGCTGTGGACTCTGGAGGGAAGG + Intronic
968661643 4:1801139-1801161 GGCAGAGCACCCTGGAGGGGAGG + Intronic
968912371 4:3482862-3482884 GGCTGAGCACCTTGCCGGCAGGG - Intronic
968944567 4:3656827-3656849 GGCAGGACACCCTGCAGGGAGGG + Intergenic
969138812 4:5051709-5051731 GGCCGAGCACCGTGCAGGGGCGG - Exonic
969421828 4:7102035-7102057 AGATGAGCTCCCTGCAAGGAGGG - Intergenic
969722511 4:8900354-8900376 GGCTGGGCTCACTGCAGTGAAGG - Intergenic
969985152 4:11201301-11201323 GTCTGTGCACCCTTAAGGGAAGG - Intergenic
972902671 4:43703700-43703722 AGCTCACCACCCTGAAGGGAAGG - Intergenic
975297572 4:72751581-72751603 GGCTGAACCTCCAGCAGGGAGGG - Intergenic
976220525 4:82753527-82753549 GGCTGAGTCACCTGCGGGGAAGG + Intronic
977996163 4:103499287-103499309 TGCTAAGCACTCTGCAGTGAAGG - Intergenic
978341514 4:107725054-107725076 GGCTGTGCACTTTGCATGGAAGG - Intergenic
978366685 4:107990073-107990095 GCGTGGGCACGCTGCAGGGAGGG - Intronic
980385716 4:132086538-132086560 GGCTGTGCACTTTGCATGGAAGG - Intergenic
980815962 4:137946707-137946729 GTCTTAGCAACCTGCATGGAGGG + Intergenic
984819751 4:183871140-183871162 GACTGTGCTCCCTGCAAGGATGG - Intronic
986175480 5:5348478-5348500 GCCTGGGCTCCCTGCAGTGATGG + Intergenic
988440421 5:31227010-31227032 AGCTGAGCAGCTTCCAGGGATGG - Intronic
991013729 5:61910393-61910415 GGCTGTGCACTTTGCAAGGAAGG - Intergenic
991033619 5:62106418-62106440 GGCTGTGCACTTTGCAAGGAAGG + Intergenic
992291458 5:75283828-75283850 TGCTCACCACCCTGAAGGGAAGG + Intergenic
992665659 5:79006436-79006458 GAGTGAGCGCCCTGGAGGGAGGG + Intronic
992771847 5:80055881-80055903 GGCTGAGCAATTTGCAGCGAGGG + Exonic
995675427 5:114657787-114657809 GCCTGAGCCCCCTGAAGGAAGGG - Intergenic
997821598 5:137070844-137070866 GACTGAGCTGCCTGCAGAGATGG - Intronic
997890270 5:137670253-137670275 GGCTGTGGACCCTGTAGGGCAGG - Intronic
1001630019 5:173168122-173168144 GGCTGAGCATCCTGTAGATATGG - Intergenic
1003837181 6:10084458-10084480 GGCTGAGCACTCAACAGGGAGGG + Intronic
1006641565 6:35492121-35492143 GGCTGGGGTCCCTGCAGGGGTGG - Intronic
1006984863 6:38169523-38169545 GGCTGAGCAGCCTTCAGGGCAGG - Exonic
1007284107 6:40735528-40735550 GGCTGAGCACCATGCAGTCGTGG - Intergenic
1008070869 6:47097587-47097609 AGCTGTTCACCCTGCAGGGAGGG + Intergenic
1008244293 6:49150983-49151005 TGCTGAGCTCCCAGAAGGGAGGG - Intergenic
1012383452 6:98648661-98648683 TGCTGAGCTCCCTGGAGGCATGG + Intergenic
1013406739 6:109850299-109850321 GGCTGTGCACTTTGCATGGAAGG + Intergenic
1018185730 6:161264289-161264311 GGCTGAGCATCCTGCAGCTCTGG - Intronic
1018847208 6:167563892-167563914 GGCCTGGCACCCGGCAGGGATGG - Intergenic
1019541969 7:1555648-1555670 GGCTGAGCTCGGAGCAGGGAGGG - Intronic
1019577011 7:1742448-1742470 GTCTGGGCACGGTGCAGGGATGG + Intronic
1023877331 7:44294127-44294149 GGCTGACCCCCCTCCAAGGAAGG + Intronic
1023998869 7:45178073-45178095 GGTGGAGCACCCTCCAGGCAAGG - Intronic
1025908464 7:65808450-65808472 TGCTGAGCACCGTGCAGGGCAGG - Intergenic
1028972680 7:96876028-96876050 GGCTTGCCACCCTGAAGGGAAGG + Intergenic
1030677999 7:112404983-112405005 GCCTGAGCTCCCTGCTGGGCTGG - Intergenic
1032867376 7:135939796-135939818 GGCTGAGCTCCATGAAGGAAGGG + Intronic
1032991104 7:137395791-137395813 GTCTCAGCAGCCTACAGGGAAGG - Intronic
1033076324 7:138253541-138253563 GGTTGTGCACACTGCATGGAAGG + Intergenic
1033346218 7:140527271-140527293 TTCTCCGCACCCTGCAGGGAGGG + Intronic
1033603370 7:142906800-142906822 GGCTGAGTGCCCAGCAGTGAGGG - Intergenic
1034282454 7:149863702-149863724 GGCTGAGAGCCCTGCCTGGAAGG - Intronic
1034522821 7:151633052-151633074 GCCCGTGCACTCTGCAGGGATGG - Intronic
1035015557 7:155762767-155762789 AGCTAAGCACCCTGTGGGGAGGG + Intronic
1035026930 7:155832275-155832297 AGCTGAGCACCCTGAATGGTCGG - Intergenic
1035075593 7:156175310-156175332 GGCTGAGAACCACGCAGGAAGGG - Intergenic
1035268772 7:157707468-157707490 CGCTAAGTACCCTTCAGGGATGG + Intronic
1035374672 7:158400022-158400044 GCCTGAGTACCCTGCAGGTGTGG - Intronic
1037001907 8:13729831-13729853 GGCTCGTCACCCTTCAGGGAAGG - Intergenic
1037591147 8:20313167-20313189 GGCTGAGCCCAGTGCTGGGAGGG + Intergenic
1037951429 8:23020820-23020842 GGCTGAGCGTCCTGCACAGAAGG + Exonic
1039280521 8:35979210-35979232 GGCTGAGGACAATGCTGGGAAGG + Intergenic
1039426484 8:37490679-37490701 GGCTGAACACCAGCCAGGGATGG - Intergenic
1039426761 8:37492847-37492869 GGCTGAACACCAGCCAGGGATGG - Intergenic
1040351784 8:46576281-46576303 GACAGAGCACACAGCAGGGATGG + Intergenic
1041415092 8:57599119-57599141 GGATAAGCTCCCTGCAGGGCTGG - Intergenic
1043340201 8:79229171-79229193 AGCTCACCACCCTGAAGGGAAGG - Intergenic
1044469643 8:92551379-92551401 GCCTGAGCTCAGTGCAGGGAAGG - Intergenic
1044591237 8:93916599-93916621 GGCTGAGCAGGCTGCGGGGTCGG - Intronic
1046128604 8:109941107-109941129 GGCTGTGCACTTTGCATGGAAGG - Intergenic
1046631535 8:116626918-116626940 TGCTGAAAAGCCTGCAGGGATGG - Intergenic
1047487783 8:125348102-125348124 GACTGAGCTCCCTGAAGGCAAGG + Intronic
1047773955 8:128053809-128053831 GGCTGAGCAACCAGAAGGGTTGG + Intergenic
1048992138 8:139766666-139766688 TGTTGAGCACCTTGCATGGAAGG - Intronic
1049367748 8:142248897-142248919 GGCTGGGTACTCAGCAGGGAGGG + Intronic
1049570218 8:143366668-143366690 GAAACAGCACCCTGCAGGGAGGG + Intergenic
1049597379 8:143491081-143491103 GCCTGGGCTCCCTGGAGGGAGGG - Intronic
1049745780 8:144262748-144262770 GGCAGTGCACCCTGCAGGTGAGG - Intronic
1049745810 8:144262818-144262840 GGCGGTGCACCCTGCAGGTGAGG - Intronic
1049745821 8:144262847-144262869 GGCGGTGCACCCTGCAGGTGAGG - Exonic
1050260369 9:3835252-3835274 GTCTGAGCCTACTGCAGGGAAGG - Intronic
1052337780 9:27337459-27337481 AGCTGAGGACCCTGTTGGGAGGG - Intronic
1056261411 9:84852380-84852402 GTCGAAGCTCCCTGCAGGGAAGG - Intronic
1056764569 9:89436827-89436849 GCCTGAGGACCCTGCAGGCCTGG + Intronic
1057415967 9:94862557-94862579 GGCTGAGCATCCTCAAGGGTGGG - Intronic
1057915990 9:99055537-99055559 GGCTGAGGTCCCTGGAGAGAAGG + Intronic
1057992316 9:99783182-99783204 GACTGAGCTCCCAGCAGGGCAGG - Intergenic
1058019968 9:100076575-100076597 GGCTGTGCACTTTGCATGGAAGG + Intronic
1058538973 9:105992423-105992445 GGCAGAGCACTCTTCAGAGAGGG + Intergenic
1059405947 9:114098471-114098493 GGCGGGGCACCCTGGAGGGGCGG + Intronic
1060156576 9:121324546-121324568 GACTGGGCACCCTGCCTGGAAGG - Exonic
1060630329 9:125152055-125152077 GGCTGAGCACCCTGTAAGGCAGG + Intronic
1060663261 9:125416614-125416636 GGCTGTGCACCCTGGAGCTAGGG - Intergenic
1060829371 9:126704152-126704174 AGCTGACCACCCTGCAGGCCAGG - Intergenic
1061133803 9:128722224-128722246 GGCGGAGCACCCTGGACTGAGGG + Intronic
1061370499 9:130194951-130194973 GGCTCAGCACCCTGCACACAGGG - Intronic
1061558959 9:131390351-131390373 GGCTAAGCACTTTGCAGGGATGG + Intergenic
1061804087 9:133128502-133128524 GGCTGACCACCCTCCAGGAGGGG - Intronic
1062008032 9:134251376-134251398 GACCGAGCACCCTGCCAGGACGG - Intergenic
1062030601 9:134360242-134360264 GGCAGTGCAGCCTCCAGGGAAGG - Intronic
1062043498 9:134414867-134414889 GGCTCAGGACCCTGTATGGAGGG + Intronic
1062086904 9:134653747-134653769 GGCTGGGGACTCTGCAGGGCTGG + Intronic
1062290474 9:135792163-135792185 GCCTGAGCTCCGTGCAGGGCTGG - Exonic
1062475197 9:136723238-136723260 TGGAGAGCACCCTGCAGGGCAGG - Exonic
1062690074 9:137837108-137837130 GGCTGCTCCCCCTGCAGGGCTGG - Intronic
1185623137 X:1465526-1465548 CGGTGCGCACCCTGAAGGGATGG - Exonic
1186416046 X:9383858-9383880 GGCTACCCACCCTGCAAGGAAGG + Intergenic
1186751442 X:12625627-12625649 GGCTGAGAAGGGTGCAGGGAAGG + Intronic
1187479199 X:19639573-19639595 GGCTGGGCACCCTCCTGGGAAGG + Intronic
1187767162 X:22655075-22655097 GGCTGAGAAACATTCAGGGAAGG - Intergenic
1189316633 X:40061597-40061619 GGCTGAGGGCTCTGGAGGGAGGG - Intronic
1190382865 X:49856285-49856307 GGCTCATCAACCTGAAGGGAAGG + Intergenic
1195169341 X:102250653-102250675 GGCTGATTACCCTACAGGGAGGG - Intergenic
1195189516 X:102436435-102436457 GGCTGATTACCCTACAGGGAGGG + Intronic
1195693684 X:107650495-107650517 AGCTGAGCACCCTGTAAGGCAGG + Exonic
1196191847 X:112803004-112803026 GGCTGAGCACCCTTCCTGGAGGG + Intronic
1197028262 X:121782180-121782202 GCCTCACCACCCTGAAGGGAAGG - Intergenic
1197770615 X:130086900-130086922 GGCTGGGGACCTGGCAGGGAGGG + Intronic
1200111753 X:153744151-153744173 GGCTGACCACCCTCAGGGGATGG - Exonic