ID: 1078142006

View in Genome Browser
Species Human (GRCh38)
Location 11:8699681-8699703
Sequence GGGGCACATCAGTGGGCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078141993_1078142006 29 Left 1078141993 11:8699629-8699651 CCGCAGGACAGTCATCTGACAAA 0: 1
1: 0
2: 0
3: 19
4: 195
Right 1078142006 11:8699681-8699703 GGGGCACATCAGTGGGCCCGTGG 0: 1
1: 0
2: 0
3: 11
4: 115
1078141992_1078142006 30 Left 1078141992 11:8699628-8699650 CCCGCAGGACAGTCATCTGACAA 0: 1
1: 0
2: 1
3: 25
4: 133
Right 1078142006 11:8699681-8699703 GGGGCACATCAGTGGGCCCGTGG 0: 1
1: 0
2: 0
3: 11
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078142006 Original CRISPR GGGGCACATCAGTGGGCCCG TGG Intronic
900972735 1:6000478-6000500 GGGGCACTTCAGAGGCTCCGGGG + Intronic
901671359 1:10858072-10858094 GGGCCACAGCAGTGGGACCAGGG + Intergenic
901770680 1:11529004-11529026 CAGACACATCAGTGGGCCAGGGG + Intronic
902078224 1:13803927-13803949 GGGGCTCAGCAGTGGGCCCATGG + Intronic
902361311 1:15943940-15943962 GGGGCAGGTGAGGGGGCCCGGGG - Intronic
904681830 1:32234632-32234654 GGGGCAGAGCAATGGGCACGAGG + Intergenic
905800044 1:40837632-40837654 GGGAACCATCAGAGGGCCCGGGG - Intronic
907386056 1:54125918-54125940 GGGGAACATCAGGTGGCCCTGGG + Intergenic
909188238 1:72517195-72517217 GGGGCACATCAGAGAGGCAGTGG - Intergenic
912430121 1:109624507-109624529 GGGGCACCACAGAGGGCCCTGGG - Intronic
915460259 1:156066199-156066221 GGGGCTCAGCAGTGGGCTCTGGG + Intronic
917731912 1:177882880-177882902 GGGGGAGATCAGAGGGCCCGTGG + Intergenic
923273586 1:232378576-232378598 GGGACACATCAGGGAGCCTGAGG + Intergenic
923705777 1:236343677-236343699 GTGGCAAGTCAGTGGGCCTGAGG + Intergenic
1065742894 10:28813131-28813153 GGGTCACTTCAGTGGGGCAGTGG - Intergenic
1065924100 10:30420501-30420523 TACGCACATCAGTGGGCCCCAGG - Intergenic
1067085764 10:43237400-43237422 GGGGCACAACAGTGGGGTCAGGG - Intronic
1067284112 10:44894971-44894993 TGGGCACAGCGCTGGGCCCGCGG - Intergenic
1067432287 10:46252396-46252418 AAGGCACAACAGTGGGGCCGGGG + Intergenic
1067688269 10:48480967-48480989 AGGGCACCACAGCGGGCCCGTGG + Intronic
1069739279 10:70677263-70677285 GGGGCTGTTCAGTGGGCCTGGGG + Intronic
1070941908 10:80356137-80356159 TGGGCATATCAGTGGGACCCAGG + Intronic
1074421159 10:113309759-113309781 GCGGCAGACCAGTGGGCCCCTGG + Intergenic
1076864591 10:133160576-133160598 GGGGCCCCCCAGTGGGGCCGGGG - Intronic
1078142006 11:8699681-8699703 GGGGCACATCAGTGGGCCCGTGG + Intronic
1079083344 11:17428802-17428824 GGGGCAGACCAGTGGGCATGGGG + Intronic
1079249001 11:18773513-18773535 GGGGCTCTTCAGTGGGGCTGGGG + Intronic
1080303960 11:30816859-30816881 GGGTCCTATCAGTGGGCCCTTGG - Intergenic
1083304123 11:61753932-61753954 GGGGCACAAAAGGGGGCCAGAGG - Intronic
1084516749 11:69641776-69641798 GGGGCACCCCAATGGGCCCGAGG + Intronic
1084519615 11:69655429-69655451 AGGGCTCAACAGTGGGGCCGGGG + Intronic
1089257065 11:117199642-117199664 GGGGCATTTCAATGAGCCCGGGG - Intronic
1089659695 11:119977907-119977929 GGGGCAGATCAGCGGCCCCATGG - Intergenic
1089831851 11:121335902-121335924 GGTGGACATCAGTGGGCTGGTGG - Intergenic
1096113763 12:49043296-49043318 GGGGCACAGCAGAGGGACAGAGG + Intronic
1096214648 12:49792482-49792504 TGGGCACATGAGAGGGTCCGAGG + Exonic
1096385216 12:51190773-51190795 CGGGCACATCAGAGGGTCTGAGG - Intronic
1096792943 12:54056286-54056308 GGGGCACTTCAGTGGAGCTGAGG + Intergenic
1096844804 12:54400594-54400616 GTGGCACATAACTGGGCCCTAGG + Intronic
1102207028 12:111097791-111097813 GGGGCACAGCATTGGGCACCAGG + Intronic
1104823806 12:131694228-131694250 CGGGCAGGTCAGTGGGCCCCTGG - Intergenic
1105967580 13:25398576-25398598 GGGACACAGCAGTGAGCCAGGGG - Intronic
1108497576 13:51040597-51040619 GGGCCACAGCAGGGGGCCAGGGG + Intergenic
1115670809 14:35609788-35609810 GGTGCACACCAGTGGTCCCAGGG + Intronic
1119719217 14:76879928-76879950 TGGGCACACCAGTGGGCAGGAGG - Intergenic
1120580328 14:86240091-86240113 GGGAGATATCAGTGGGACCGAGG - Intergenic
1121690550 14:95875192-95875214 GGGGCACAGCGGTGGGCCCTGGG + Intergenic
1122409307 14:101517903-101517925 GGGACAGATCCCTGGGCCCGTGG - Intergenic
1122574591 14:102733574-102733596 GGGACGCATGACTGGGCCCGGGG - Intergenic
1124121648 15:26893703-26893725 GGGGCACAGGAGTGGGCGAGGGG + Intronic
1127712386 15:61612676-61612698 TGGGCATATTAGTGGGCCCATGG + Intergenic
1129668428 15:77592726-77592748 GGGGCACTTTGGTGGGCCAGAGG + Intergenic
1129896108 15:79107065-79107087 GGGGCACCTAAGTGGGTCAGAGG + Intergenic
1130154594 15:81338683-81338705 TGGACACATCAGTAGCCCCGTGG - Exonic
1130653126 15:85773549-85773571 GCTGCACATCACTGGGCCCTGGG + Intronic
1131514022 15:93065723-93065745 GGGGACCATCAGCGGGACCGTGG + Intronic
1132148520 15:99443191-99443213 GGGGCACAGCAGTGGGTACTGGG + Intergenic
1133747127 16:8695848-8695870 GGGGCAGAGCAGTTGACCCGAGG + Intronic
1135992502 16:27226676-27226698 GGAGCTCATCACTGGGCCCTCGG - Intronic
1136270659 16:29146433-29146455 GGTGCACATCTGTGGGGACGCGG + Intergenic
1138576771 16:57912378-57912400 GGTGCACATCAGCTGGCACGAGG - Intronic
1144403968 17:14934523-14934545 GTGGCACAGCAGTGGGCACATGG - Intergenic
1146308187 17:31746652-31746674 AGGGGACATCACTGGGCCTGTGG + Intergenic
1149491019 17:57085328-57085350 GGGGCACAGCCGGGGGCCGGCGG + Intronic
1149646026 17:58242306-58242328 GGGGCACAGCTGTGGGCTCAGGG + Intronic
1157763936 18:50283650-50283672 TGGGAACATCAGTGGGCCAGTGG - Intronic
1158210564 18:55044832-55044854 GGGGCCTATCAGTGGGGCCGGGG + Intergenic
1161728694 19:5945852-5945874 GGGGCACCACAGTGTTCCCGGGG - Intronic
1165100149 19:33434488-33434510 GGGGCACCTCAGTAGGCCCAGGG + Intronic
1168267807 19:55231857-55231879 GGGGCCCCTCAGTGTGCCCCAGG - Exonic
925217672 2:2111066-2111088 GGGACACAGCAGTGGGCCCTGGG + Intronic
925334099 2:3080442-3080464 GGGGCACTTGAGCGGGCCCATGG - Intergenic
926621354 2:15049463-15049485 GGGCCACATCAGGAGGCCTGGGG - Intergenic
926738951 2:16095192-16095214 GGGACACATCTGAGGGCCCATGG - Intergenic
928393451 2:30926731-30926753 GGGGGACACCAGAGGGGCCGGGG + Intronic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
936348143 2:111690805-111690827 GGGGTAAAGCAGTGGTCCCGGGG + Intergenic
937346890 2:121131761-121131783 AGGGAACATCCGTGGCCCCGTGG + Intergenic
948523750 2:238558102-238558124 GGGGTCCATCAGTAGGCCCTCGG - Intergenic
948920170 2:241062615-241062637 GGGGCAGGGCAGTGGGCCTGGGG - Intronic
1169137792 20:3208237-3208259 GGGGGACATCAGTTACCCCGAGG - Intergenic
1171126427 20:22605914-22605936 GTGGGAAATCAGTGGGCCAGTGG + Intergenic
1171421051 20:25017882-25017904 GGGCCACCTGAGTGGGCCCTAGG - Intronic
1172270118 20:33650290-33650312 GGAGCCCACCAGTGGGCCTGCGG + Intergenic
1172793114 20:37519755-37519777 GGGGCACAGCAGGGAGCCCTTGG - Intronic
1176039096 20:63055061-63055083 GGAGCACACCAGAGGGGCCGGGG + Intergenic
1179158177 21:38869325-38869347 GGGGCCCCTCAGTTGGCCCTGGG + Intergenic
1180181773 21:46121345-46121367 GGGGCAAGGCAGTGGGCCTGAGG + Intronic
1185062184 22:48612783-48612805 GAGACACATCAGCGGGCCCTGGG - Intronic
1185175907 22:49326530-49326552 GTGGCACCGCTGTGGGCCCGAGG + Intergenic
950082040 3:10229565-10229587 GGGTCATATCAATGGGCCCATGG + Intronic
953947854 3:47164327-47164349 GGCCCACATCACTGGGGCCGGGG - Intergenic
955026711 3:55174553-55174575 GGTGCAGATCACTGGGCCCAGGG - Intergenic
963566211 3:146934435-146934457 GGGGCACAACAGTGCTCACGAGG - Intergenic
968446253 4:653820-653842 GGGGCACACCTGTGGGCCTGTGG - Intronic
968726523 4:2250436-2250458 ATGGCACAGCAGTGGGCCTGTGG + Exonic
969054350 4:4392374-4392396 GAGAGACATCAGTGGGCCCCAGG + Intronic
969083836 4:4640791-4640813 GGGGCACAGCAGCGGGGCCTCGG + Intergenic
969119668 4:4898891-4898913 GGGGCACAGGAGAGGGCCCTGGG + Intergenic
973292520 4:48483951-48483973 GGCGCACGTCCGTCGGCCCGTGG + Exonic
989536034 5:42564685-42564707 GGGCCACATCTGTAGGCCCATGG + Intronic
990979903 5:61593012-61593034 GGGGCCCATGAGTGGCCCAGGGG + Intergenic
1001567110 5:172706915-172706937 GGGGCACAGCAGGGGGCGGGAGG + Intergenic
1005589950 6:27312642-27312664 GGCGCAGATCTGTCGGCCCGCGG + Intergenic
1006665196 6:35688592-35688614 GGGGCGCCGCAGTGGGGCCGAGG + Intronic
1007779318 6:44243598-44243620 GGGGAACATCAGTGGTTCCAAGG + Intergenic
1019577828 7:1746047-1746069 GGGGCCCAGCAGCGGGCCCTGGG - Exonic
1025080324 7:55976131-55976153 GGGGAACATGACTGGGCCTGGGG - Intronic
1030532642 7:110729753-110729775 GGGGCCTATCAGTGGTTCCGGGG + Intronic
1031871313 7:127091887-127091909 GGGAGTCATCAGTGGGCCGGCGG - Intronic
1036867496 8:12414349-12414371 GGGGAACAACAGTGGGTCCAGGG - Intergenic
1041732632 8:61077801-61077823 GCTGCCCATGAGTGGGCCCGAGG + Intronic
1044721203 8:95149942-95149964 GGGGCACCTCAGTGTGCTGGAGG + Intronic
1049379148 8:142303383-142303405 GGGGCACCTCGCTGGGCCCTGGG - Intronic
1055361290 9:75493404-75493426 GGGGAACTTCAGTGAGCCTGGGG + Intergenic
1057528725 9:95825341-95825363 CAGGCACATCAGTGTGCTCGGGG + Intergenic
1058871229 9:109203230-109203252 AGGGCACATCAATGGGCCAAGGG + Intronic
1059225487 9:112669153-112669175 GGGGCACATGAGTGGGAAAGTGG + Intronic
1060831119 9:126717411-126717433 GAGAAACAACAGTGGGCCCGGGG - Intergenic
1062312031 9:135943959-135943981 GGGGCCCATCAGGGGGTCTGGGG + Intronic
1190170780 X:48110065-48110087 GGGGCAGAGCAGTGGTCCAGGGG + Intergenic
1190176917 X:48158031-48158053 GGGGCAGAGCAGTGGCCCAGGGG + Intergenic
1190188659 X:48257327-48257349 GGGGCAGAGCAGTGGTCCAGGGG + Intronic
1190657546 X:52625083-52625105 GGGGCAGAGCAGTGGTCCAGGGG + Intergenic
1192234273 X:69285987-69286009 GGGTCACATCCCTGGGCCCGGGG - Intergenic
1194219276 X:91171179-91171201 GGGAAACAACAGTGGGCCCAGGG - Intergenic
1199493984 X:148432749-148432771 GGAGGAAATCAGTGGGCCCTTGG - Intergenic