ID: 1078143436

View in Genome Browser
Species Human (GRCh38)
Location 11:8707669-8707691
Sequence CACCTGTGACTGTGAGCGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 130}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078143436_1078143440 15 Left 1078143436 11:8707669-8707691 CCGCTCGCTCACAGTCACAGGTG 0: 1
1: 0
2: 0
3: 13
4: 130
Right 1078143440 11:8707707-8707729 CTGGCTGCAGATACTCCTGTGGG 0: 1
1: 0
2: 2
3: 12
4: 180
1078143436_1078143438 -4 Left 1078143436 11:8707669-8707691 CCGCTCGCTCACAGTCACAGGTG 0: 1
1: 0
2: 0
3: 13
4: 130
Right 1078143438 11:8707688-8707710 GGTGGTTTTCTCATCTAAGCTGG 0: 1
1: 0
2: 0
3: 5
4: 100
1078143436_1078143442 29 Left 1078143436 11:8707669-8707691 CCGCTCGCTCACAGTCACAGGTG 0: 1
1: 0
2: 0
3: 13
4: 130
Right 1078143442 11:8707721-8707743 TCCTGTGGGAGCTGTCAGCTGGG 0: 1
1: 0
2: 2
3: 38
4: 219
1078143436_1078143444 30 Left 1078143436 11:8707669-8707691 CCGCTCGCTCACAGTCACAGGTG 0: 1
1: 0
2: 0
3: 13
4: 130
Right 1078143444 11:8707722-8707744 CCTGTGGGAGCTGTCAGCTGGGG 0: 1
1: 0
2: 9
3: 49
4: 348
1078143436_1078143441 28 Left 1078143436 11:8707669-8707691 CCGCTCGCTCACAGTCACAGGTG 0: 1
1: 0
2: 0
3: 13
4: 130
Right 1078143441 11:8707720-8707742 CTCCTGTGGGAGCTGTCAGCTGG 0: 1
1: 0
2: 1
3: 22
4: 282
1078143436_1078143439 14 Left 1078143436 11:8707669-8707691 CCGCTCGCTCACAGTCACAGGTG 0: 1
1: 0
2: 0
3: 13
4: 130
Right 1078143439 11:8707706-8707728 GCTGGCTGCAGATACTCCTGTGG 0: 1
1: 0
2: 3
3: 25
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078143436 Original CRISPR CACCTGTGACTGTGAGCGAG CGG (reversed) Intronic
900478321 1:2886633-2886655 CTGCTGTGTCTGTGAGCCAGGGG + Intergenic
901143893 1:7052610-7052632 CACCTGGTCATGTGAGCGAGGGG - Intronic
904032664 1:27542970-27542992 TGCCTGTGACTCTGAGCAAGAGG - Intronic
905287168 1:36889116-36889138 GACCTGTGTGTGTGAGAGAGAGG - Intronic
908396357 1:63728905-63728927 CACCTGTGACAGTCAGCCTGAGG - Intergenic
912982112 1:114384340-114384362 CACCTGAGCCTGTGAGTTAGAGG - Intergenic
915678817 1:157559377-157559399 CACCTGTGAGTGAGAGCATGTGG + Intergenic
920747680 1:208644286-208644308 CATCTGTGACTCGGAGAGAGTGG - Intergenic
923248387 1:232156333-232156355 CACCTGTGAGTGAGAGCATGTGG - Intergenic
1063211756 10:3887175-3887197 CGCCTGTGAGTGTGTGCAAGGGG + Intergenic
1066101633 10:32122978-32123000 CAGCTGTGCCTGGGAGCGTGGGG + Intergenic
1068101656 10:52561751-52561773 CACCTGAGAGAGTGAGTGAGTGG - Intergenic
1068705736 10:60073390-60073412 CCCCTGTAACTCTGAGCTAGGGG + Exonic
1069428938 10:68315711-68315733 CACCTCTGACTGAGACCTAGGGG + Intronic
1074218917 10:111416872-111416894 CACCTGTAACTCTGCGCAAGAGG - Intergenic
1075010268 10:118862591-118862613 CACCTATGAGTGAGAGCGTGCGG + Intergenic
1078143436 11:8707669-8707691 CACCTGTGACTGTGAGCGAGCGG - Intronic
1078682060 11:13486448-13486470 CAAATGGGACTGTGAGCCAGGGG - Intergenic
1078932068 11:15920500-15920522 CACCTCTGTCTGTGAGCTATAGG - Intergenic
1079086422 11:17448737-17448759 CACCTGTTACAGTGTGCCAGGGG + Intronic
1082067623 11:47913759-47913781 CACCTGAGCCTGTGAGGCAGAGG + Intergenic
1090809149 11:130221580-130221602 ACCCTGTGGCTGTGAGCTAGAGG - Intergenic
1092277028 12:7069288-7069310 CACCAGTCACTGGGAGTGAGAGG + Intronic
1094392475 12:29966634-29966656 CACCTCTGAATGGCAGCGAGAGG - Intergenic
1100001293 12:89839088-89839110 CAGCTGTGACTGTGAGGAAGAGG + Intergenic
1104979613 12:132567982-132568004 AACCTGTGGCTGTGAGCTATGGG + Intronic
1107325269 13:39235256-39235278 CACCTGTGCTTGTGACCGACTGG + Intergenic
1108710051 13:53024478-53024500 CACCTCTAACTGTGAGAAAGAGG - Intergenic
1110396216 13:75032507-75032529 CACCTGTGAGTGAGAACAAGCGG + Intergenic
1111347195 13:86974471-86974493 CAGCTGTGACTGGGAGTGCGGGG - Intergenic
1111647591 13:91049966-91049988 CACCTATGAGTGAGAGCAAGCGG + Intergenic
1117446566 14:55808776-55808798 CACCTGTGACTGAGAACATGTGG + Intergenic
1118960607 14:70526862-70526884 AGGCTGTGACTGTGAGTGAGGGG - Intronic
1126413545 15:48395799-48395821 CACCTGTGACTGGGAGGCAGCGG + Intergenic
1127485981 15:59417997-59418019 CACCTGTGAGTGAGAACAAGTGG + Intronic
1127527610 15:59809253-59809275 CACCTATGAGTGAGAACGAGCGG - Intergenic
1128228437 15:66018622-66018644 CATGTGTGAGTGTGTGCGAGCGG + Intronic
1129882720 15:79017736-79017758 CACCTGTTCCTGAAAGCGAGTGG - Intronic
1130091442 15:80824417-80824439 CAGCTGAGACTGTGACAGAGGGG - Intronic
1131062750 15:89414114-89414136 CACATGTCAGTGTGAGCCAGAGG - Intergenic
1132038934 15:98508361-98508383 CACCTGTGAGTGAGAACGTGCGG + Intronic
1138714079 16:59001713-59001735 CACCTGTGGGTGAGAGCGTGTGG + Intergenic
1139607766 16:68032198-68032220 CACCTCTGACTGAGTGCCAGAGG + Intronic
1142547915 17:718261-718283 CACCTGTTCCTGTTAGCGACAGG + Intronic
1144852191 17:18249406-18249428 CACCTGTGTGTGTGAGGGTGTGG + Exonic
1146112507 17:30102913-30102935 CACCTGAGCCTGAGAGGGAGAGG - Intronic
1146208558 17:30924287-30924309 CACCTGAGCCTGTGAGAGTGTGG + Intronic
1146296487 17:31654385-31654407 CACTGCTGAGTGTGAGCGAGTGG - Intergenic
1147158571 17:38558122-38558144 CACCTGTGACTCAGAGGGAAGGG + Intronic
1147252556 17:39161852-39161874 CACCTCTGACTGTGTGGCAGAGG + Intronic
1154999067 18:21669122-21669144 CACCTGAGACTGGGAGGTAGAGG + Intronic
1157753105 18:50195273-50195295 CACCTGTGCCTGCGCGCGCGCGG - Intergenic
1157780767 18:50437095-50437117 CACCAGGGCCTGTGAGGGAGTGG + Intergenic
1162332351 19:10038070-10038092 CACCTGTGACGGTGGGTGACAGG + Intergenic
1163578297 19:18123355-18123377 CACCTGAGACTGCGAGAGCGGGG - Exonic
1167741071 19:51325373-51325395 CGCCTGTGACGGTGAATGAGGGG + Exonic
926143757 2:10384431-10384453 CAGTAGTGAGTGTGAGCGAGGGG - Intronic
934616237 2:95772966-95772988 CACCTTTGGCTTTGAGGGAGAGG - Intergenic
934644658 2:96051594-96051616 CACCTTTGGCTTTGAGGGAGAGG + Intergenic
934838073 2:97607684-97607706 CACCTTTGGCTTTGAGGGAGAGG + Intergenic
936997123 2:118427085-118427107 CATCTGTGACTGTGAGAAATGGG + Intergenic
937862088 2:126719197-126719219 AACCTGTGACTCTGAGAGTGAGG + Intergenic
938742999 2:134250526-134250548 CACCTGTTACTGTGAGAGATAGG + Intronic
946781785 2:223198911-223198933 CACCTGGGCCTGTCAGGGAGTGG + Intergenic
1169769462 20:9185383-9185405 CACGTGTGAGTGTGAGAGAGAGG - Intronic
1173315923 20:41942979-41943001 CAGCTGTGACTCTGAGCCAGGGG - Intergenic
1173877118 20:46380348-46380370 CACCTGTGACTACTATCGAGAGG + Intronic
1175713877 20:61242571-61242593 CAGCTTTGACTGTGAGCTTGGGG - Intergenic
1175768849 20:61610228-61610250 CACCTGGGACTGAGAACGTGTGG + Intronic
1175799731 20:61794543-61794565 CACCTGTGACTCTTTGCCAGTGG - Intronic
1183908273 22:41059455-41059477 TACCTGGGACTGTGAGGTAGGGG - Intergenic
1184462847 22:44649073-44649095 CAACTGGGCGTGTGAGCGAGCGG + Intergenic
949097290 3:100578-100600 CACCTGTCAGTGTGAGGGTGAGG - Intergenic
949579359 3:5371703-5371725 CACCTGTGAGTGGGAACGTGCGG + Intergenic
949714032 3:6907280-6907302 CACCTGTGAAGGTGAGAGACAGG - Intronic
950896119 3:16452666-16452688 CAACTGTGACAGTGAAGGAGTGG + Intronic
952946400 3:38480565-38480587 GTTCTGTGACTGTGAGGGAGGGG + Intronic
954868665 3:53750589-53750611 CACCAGTGATTGTCAGGGAGAGG + Intronic
956545543 3:70397386-70397408 CACCTGGGCCTGGGAGCCAGAGG - Intergenic
957156382 3:76550573-76550595 CAGCTGTGCCTGGGAGTGAGGGG - Intronic
957787852 3:84905016-84905038 CAGCTGTGCCTGTGAGGGCGGGG - Intergenic
958881607 3:99678118-99678140 CACTTGTGGCTGTGAGTGGGTGG + Intronic
958916364 3:100054806-100054828 CACCAGTGATGGTGAGAGAGAGG - Intronic
961385621 3:126521760-126521782 CACCTGCCAGTGTGAGCCAGTGG + Intergenic
963355214 3:144202700-144202722 CACCTGTGAGTGAGAACGTGCGG + Intergenic
969037558 4:4267008-4267030 GGCCTGTGACTGGAAGCGAGAGG - Intergenic
969129980 4:4983995-4984017 CACATGTGAATGTGGGTGAGGGG - Intergenic
972112230 4:35578502-35578524 CACCTGTGAGTGTGAACATGCGG - Intergenic
977900316 4:102415038-102415060 CACCTGTGAGTGAGAACGTGCGG - Intronic
979071433 4:116212830-116212852 CACCAGTGACTGTTAGCCGGTGG - Intergenic
982545059 4:156724044-156724066 CAGCTGTGCCTGGGAGAGAGGGG - Intergenic
982752931 4:159183967-159183989 CACCTGTGAGTGAGAACGTGTGG + Intronic
984195953 4:176658481-176658503 GACCTGTGAATGTAAGAGAGAGG + Intergenic
984587744 4:181582231-181582253 CAGCTGTGAATGTGAGAGACAGG - Intergenic
987792492 5:22586253-22586275 CACCTGTGAGTGAGAGCATGCGG - Intronic
988576825 5:32433983-32434005 CACCTGTGCCTGGGAGGCAGAGG + Intronic
989402916 5:41027953-41027975 CACCTGTGAGTGAGAACAAGCGG - Intronic
989452645 5:41604954-41604976 CACCTGTGAGTGAGAACAAGTGG + Intergenic
993299192 5:86185196-86185218 CACCTGTGTCTGGGAGGCAGAGG + Intergenic
996595294 5:125194703-125194725 CACCTGAGAGTGTGAGGGATTGG - Intergenic
998152283 5:139764401-139764423 CCCCTGGGAGTGTGAGTGAGGGG + Intergenic
998185253 5:139974408-139974430 CACCAGTCACTTTGAGCCAGGGG + Intronic
1001649899 5:173308825-173308847 CACCTGTGAATGTGGGCAGGAGG + Intergenic
1001774015 5:174315316-174315338 CACCTGTGGCTGTGTGGGAAGGG + Intergenic
1002082499 5:176745839-176745861 CACCTGTGGGTGTGAGCGTGGGG + Intergenic
1003427863 6:6009185-6009207 CCCCTGTAACTCTGAGCGTGGGG + Intergenic
1006641799 6:35493099-35493121 CAACTGTGTATGCGAGCGAGAGG - Intronic
1019739627 7:2666165-2666187 CACCTGTGTATGTGGGCGGGGGG + Intergenic
1020416655 7:7953634-7953656 CACCTGAGCCTGAGAGAGAGAGG + Intronic
1028089845 7:86685452-86685474 CACCTGTGTGTGTGAGCAAGTGG + Intronic
1030386643 7:108874929-108874951 CACCTGTGGCTGTCAGGGTGGGG - Intergenic
1030819406 7:114077397-114077419 CACCTCTCACTGTGTGGGAGAGG + Intergenic
1032255673 7:130295309-130295331 CTCCTGTGAGGGTGAGGGAGTGG + Intronic
1032493550 7:132343559-132343581 CACTTGTGACTTTAAGCCAGGGG - Intronic
1036385305 8:8274223-8274245 CACCTCTTTCTGTGAGGGAGGGG - Intergenic
1036769879 8:11571652-11571674 CATCTGTGTCTGTGAGCGTGGGG - Intergenic
1037410782 8:18593889-18593911 CACCTATGACTGAGAGCATGCGG - Intronic
1037484325 8:19333182-19333204 CACCTGATACTGTGAGCAAGAGG - Intronic
1039604374 8:38868471-38868493 CACCTGTGATGGTGAGAGACAGG - Intergenic
1040084665 8:43326896-43326918 CACCTGTGAGTGAGAACGTGCGG + Intergenic
1041788132 8:61658702-61658724 TACCTGTGACTGGCAGGGAGGGG - Intronic
1047646744 8:126877960-126877982 CTCCTGTGGCTGGGAGTGAGTGG + Intergenic
1052900162 9:33786765-33786787 CAACTCTGACTGTGAGCAACAGG + Intronic
1052999653 9:34570955-34570977 CACCTGTGGCTGTGACAGGGAGG - Intronic
1055506065 9:76950716-76950738 CACCTGTGACTGTTAGTGTTGGG - Intergenic
1057962687 9:99471594-99471616 CACCTGGGACAGTGAGGGAGTGG - Intergenic
1058306904 9:103454832-103454854 CACCTGTGACTGAGAACATGCGG - Intergenic
1059159385 9:112019610-112019632 CACCTGGGACTGTGAGGCAGTGG + Intergenic
1059239690 9:112793458-112793480 CTGCTGTGACTGTGACCAAGGGG - Intronic
1060528127 9:124331998-124332020 GACCTGTGACTGCCACCGAGGGG - Intronic
1060836015 9:126755660-126755682 CAGGGGTGCCTGTGAGCGAGTGG - Intergenic
1186223808 X:7376191-7376213 CATCTGTGCCTGTGAGGGTGGGG + Intergenic
1187555385 X:20345962-20345984 CACCTGTGACTGTCTGCCTGGGG - Intergenic
1189220467 X:39367589-39367611 CACCTGTGAAAGGGAGGGAGAGG + Intergenic
1189646938 X:43143274-43143296 CACATGTGACCGTGAGGGAGCGG - Intergenic
1196564934 X:117193869-117193891 CACCTGTGCCTGTGAGGGCGAGG + Intergenic
1196606410 X:117662484-117662506 CACCTATGACTGAGAGCATGGGG - Intergenic
1197765783 X:130058709-130058731 CACCAGTGACTGAGAGGAAGAGG + Intergenic
1198142560 X:133819219-133819241 CACCTGTGAGTGAGAACAAGCGG + Intronic
1198971482 X:142285793-142285815 CACCTATGACTGAGAACGTGCGG + Intergenic
1199990823 X:152987063-152987085 CAGGTGTGAGTGTGAGTGAGCGG - Intergenic
1200033912 X:153316537-153316559 CAGGTGTGAGTGTGAGTGAGCGG - Intergenic
1202339139 Y:23842269-23842291 TACCTGTCACTGTGATCTAGAGG + Intergenic
1202531627 Y:25827803-25827825 TACCTGTCACTGTGATCTAGAGG - Intergenic