ID: 1078144308

View in Genome Browser
Species Human (GRCh38)
Location 11:8712640-8712662
Sequence GCTGCTGGAGTGGCAGGAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1112
Summary {0: 1, 1: 1, 2: 14, 3: 121, 4: 975}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078144308_1078144319 25 Left 1078144308 11:8712640-8712662 CCCGCTCCTGCCACTCCAGCAGC 0: 1
1: 1
2: 14
3: 121
4: 975
Right 1078144319 11:8712688-8712710 GGGCGCGCTTCAGCATCGACTGG 0: 1
1: 0
2: 1
3: 0
4: 16
1078144308_1078144314 2 Left 1078144308 11:8712640-8712662 CCCGCTCCTGCCACTCCAGCAGC 0: 1
1: 1
2: 14
3: 121
4: 975
Right 1078144314 11:8712665-8712687 CAGCTCCAGCGTGCGATAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 52
1078144308_1078144316 4 Left 1078144308 11:8712640-8712662 CCCGCTCCTGCCACTCCAGCAGC 0: 1
1: 1
2: 14
3: 121
4: 975
Right 1078144316 11:8712667-8712689 GCTCCAGCGTGCGATAGCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 52
1078144308_1078144317 5 Left 1078144308 11:8712640-8712662 CCCGCTCCTGCCACTCCAGCAGC 0: 1
1: 1
2: 14
3: 121
4: 975
Right 1078144317 11:8712668-8712690 CTCCAGCGTGCGATAGCTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 58
1078144308_1078144315 3 Left 1078144308 11:8712640-8712662 CCCGCTCCTGCCACTCCAGCAGC 0: 1
1: 1
2: 14
3: 121
4: 975
Right 1078144315 11:8712666-8712688 AGCTCCAGCGTGCGATAGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078144308 Original CRISPR GCTGCTGGAGTGGCAGGAGC GGG (reversed) Exonic
900227976 1:1541478-1541500 GCAGCAGTTGTGGCAGGAGCAGG + Intergenic
900298799 1:1966275-1966297 GCAGCTGGTGTGGCCGGGGCAGG + Intronic
900807425 1:4776627-4776649 GCTGCTGGAAGGGGAGGACCAGG - Intronic
901042290 1:6372114-6372136 GCTGCTGGAGAAGCTGCAGCAGG - Intronic
901059788 1:6466684-6466706 GCTACTAGAGTGGCTGGGGCAGG + Exonic
901231591 1:7644608-7644630 GCAGTTGCAATGGCAGGAGCTGG - Intronic
901475602 1:9487172-9487194 GATGCTGGAGTGACCGGAGGAGG - Intergenic
901516814 1:9753235-9753257 GCTGCTGATGTGACAGGAGGTGG + Intronic
901646006 1:10717068-10717090 GCTGCTGGAGGGACAGGAGCAGG + Intronic
901827204 1:11869955-11869977 CCTGCTGGAGGGGCCGGAGTGGG + Intergenic
901987766 1:13089755-13089777 GCTTCTGGAGTGACCAGAGCAGG - Intergenic
901994046 1:13137012-13137034 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
902108849 1:14060971-14060993 GCTGCTGGTGTGGGAGGAGAAGG - Intergenic
902202171 1:14841870-14841892 GATGCTGGAGTGGCTAGAACAGG - Intronic
902732483 1:18378332-18378354 CCTGATGGAGTGGCCGGGGCGGG - Exonic
902800433 1:18826257-18826279 GGAGCTGGAATGGCAGGAGATGG + Intergenic
902814279 1:18907386-18907408 GCTGCTGGCAGTGCAGGAGCTGG - Exonic
902921086 1:19666239-19666261 GCTGCTGGGCTGGCACGAGCTGG + Exonic
903029124 1:20450263-20450285 GGTGCAGGAGGGGCAGGAGGGGG + Intergenic
903232599 1:21931185-21931207 GCTGCTGGGGTGGCCGGGTCGGG - Intronic
903328869 1:22586726-22586748 TCTGCTGGTGGGGCAGGGGCGGG + Intronic
903743859 1:25573800-25573822 GCTCAGGGAGAGGCAGGAGCAGG - Intergenic
903786520 1:25864737-25864759 GCTACTGGAGAGGCTGGGGCAGG + Intronic
903878314 1:26491395-26491417 GCTACTGGAGAGGCTGAAGCAGG - Intergenic
904093983 1:27963521-27963543 GCTGCTGGTGTGGCAGCAGGAGG + Exonic
904215381 1:28914725-28914747 GCTGCAGCAGTGGCGGGCGCAGG + Intronic
904281925 1:29426722-29426744 GGTGCTGGACTGTGAGGAGCTGG + Intergenic
904335028 1:29791415-29791437 GGTGCTGGAATGGCAGGTGTGGG + Intergenic
904832551 1:33314427-33314449 GCAGCAGGAGAGGCAGGGGCAGG - Intronic
904966914 1:34381297-34381319 GGTGCTGGAGGGGAAGGAGGAGG - Intergenic
905158498 1:36010048-36010070 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
905268699 1:36772471-36772493 GCAGCTGGGATGGCAGGCGCCGG - Intergenic
905332636 1:37217197-37217219 ACTGCAGGAGTGGCAGTAGCTGG + Intergenic
905346869 1:37317395-37317417 GTTGCTACAGTGGCAGGAGCAGG + Intergenic
905804968 1:40869615-40869637 GCTGCTGGAGAGGCTGGGGCAGG + Intergenic
905960699 1:42040258-42040280 GCTGCTGGAGTGCCAGGAGGAGG + Intergenic
906001998 1:42434577-42434599 GCTGCTGAACTGACAGGAGGTGG - Intronic
906008341 1:42499585-42499607 GCTACTTGAGAGGCTGGAGCAGG - Intronic
906274006 1:44502875-44502897 GCTACTGGAGAGGCTGAAGCAGG - Intronic
906598710 1:47104889-47104911 GCTACTGGAGAGGGAGGGGCTGG + Intronic
906775583 1:48526512-48526534 GCAGCTGCAGCGGCAGGAGGAGG + Intergenic
906810455 1:48821594-48821616 GCTGCGAGAGTGGGAGGAGGGGG + Intronic
907276484 1:53319665-53319687 GCAGCCGGAGTGGCAGGGGAGGG - Intronic
907501335 1:54883752-54883774 GGTGCGGGAATGGAAGGAGCAGG - Exonic
907675271 1:56512092-56512114 ACTGCAGGAGGGGCCGGAGCAGG + Exonic
908210857 1:61898350-61898372 GCTACTGGGGAGGCTGGAGCAGG - Intronic
908361990 1:63377843-63377865 GCTACTGGGGAGGCTGGAGCAGG - Intronic
908574948 1:65449575-65449597 GCTGCTGCAGCTGAAGGAGCTGG + Intronic
908871073 1:68613184-68613206 CCTGTTGGAGTGGCTGAAGCTGG + Intergenic
909984213 1:82140697-82140719 GCTGCTAAGGTGGAAGGAGCAGG + Intergenic
912477372 1:109947803-109947825 GCTGCAGGAGTGGCAGGCCTTGG - Intergenic
914463940 1:147909500-147909522 GCTGCTGGGGTTGGAGGAGCGGG - Intergenic
914747554 1:150511143-150511165 GCTGCGGCAGTGGCAGCAGCGGG - Exonic
914950749 1:152111299-152111321 GCTGCTGAAGAGCGAGGAGCAGG - Exonic
915224994 1:154405547-154405569 GCGGCAGGGGTGGCAGGGGCGGG - Exonic
915269861 1:154746344-154746366 GCGGGTGGAGTGGCAGGCTCAGG + Intronic
915677414 1:157544497-157544519 GCTGATGGGCTGGAAGGAGCTGG + Exonic
915936740 1:160094067-160094089 GGTGCATGAGGGGCAGGAGCTGG - Exonic
916882081 1:169028737-169028759 GCTGCTTGGGAGGCAGAAGCAGG + Intergenic
917414397 1:174793805-174793827 GCTACTGGAGAGGCTGAAGCAGG - Intronic
917440759 1:175066985-175067007 GCTGCTGGAGGGAAAGGAGAAGG - Intergenic
917937245 1:179880999-179881021 GCTGCTGGGGAGGCTGAAGCAGG + Intergenic
918288288 1:183080425-183080447 GCTTCTGAAGTGGCAGGATGGGG + Intronic
918838205 1:189497891-189497913 GCTACTCGAGAGGCAGCAGCAGG + Intergenic
918851631 1:189697368-189697390 GCTACTGGAGCGGCTGGGGCGGG + Intergenic
919674844 1:200371057-200371079 GCTACTTGAGAGGCTGGAGCAGG + Intergenic
919758236 1:201079364-201079386 GCTGCTGGGAGGTCAGGAGCAGG - Intronic
919773408 1:201177407-201177429 GATGCTGGAATGGCAGCAGATGG + Intergenic
919875652 1:201865318-201865340 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
919896505 1:202012688-202012710 GCTGCCGGGGTGGTAGGGGCTGG - Exonic
919903647 1:202062228-202062250 GCTACTGGAGAGGCTGAAGCAGG + Intergenic
920022671 1:202967321-202967343 GCGGCTGGGGGGGCAGGAGGCGG + Intergenic
920225150 1:204433241-204433263 CCTGCCGGATTGGCAGGAGGAGG - Intronic
920227130 1:204447060-204447082 GCTGTTGGTGTGGAAGGGGCAGG + Intronic
920291029 1:204923329-204923351 CATGCTGGAGTGGGAGGAGGAGG - Intronic
920361449 1:205419574-205419596 GCTGCTGGAGGGGCTGAGGCCGG - Intronic
921348828 1:214214661-214214683 GCTGCTGGTGAAGCAGGAGGAGG - Intergenic
921891318 1:220356802-220356824 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
922313023 1:224414215-224414237 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
922314883 1:224434158-224434180 GCGGCGGGAGGGGCAGCAGCCGG + Exonic
922414002 1:225403821-225403843 GCTGGTGGAGGTGGAGGAGCTGG - Intronic
922729412 1:227942074-227942096 GCTGCTGGGGTGGCCCGGGCTGG - Intronic
922808113 1:228401092-228401114 GCTGCTGCAGAGGCTGGAGGAGG - Exonic
922900594 1:229133554-229133576 GCCGCTGGAATGAGAGGAGCAGG - Intergenic
923108488 1:230872193-230872215 GCTACTGGAGAGGCTGAAGCAGG - Intergenic
923549293 1:234949564-234949586 GCTGCTTGAGAGGCTGAAGCGGG + Intergenic
923637156 1:235710364-235710386 GCTTCAGGAGCGGCAGCAGCAGG + Intronic
923662414 1:235969642-235969664 GCTGCTGGAGAGGCTGAGGCAGG + Intergenic
923854139 1:237827823-237827845 GCTGCTGGGGAGGCTGAAGCAGG + Intronic
924052520 1:240092754-240092776 GCTGCTGCTGTTGCTGGAGCTGG - Exonic
924166554 1:241289196-241289218 CATGATGGAGAGGCAGGAGCTGG - Intronic
924482110 1:244445141-244445163 GCTGCTGAAATTCCAGGAGCAGG + Intronic
924723342 1:246644275-246644297 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1062849116 10:729363-729385 GCAGCGTGAGTGGCAGGACCAGG + Intergenic
1062886376 10:1019636-1019658 GCTGCTGGAGAGGGAGGCGAGGG - Exonic
1063178905 10:3578366-3578388 GCTTCTTGAGTGGCGGGGGCAGG + Intergenic
1063694960 10:8326076-8326098 GCTCCTAGAGTAGGAGGAGCAGG + Intergenic
1063983216 10:11473276-11473298 GGTGCTGGTGAGGCAGGAGCCGG + Intronic
1064028405 10:11867649-11867671 ACTGCTGACGTGGCAGGAGGTGG + Intronic
1064500946 10:15972793-15972815 GCTGCTTGAGAGGCTGAAGCAGG - Intergenic
1064540004 10:16395813-16395835 GCTACTGGAGAGGCTGGGGCAGG - Intergenic
1064568712 10:16670874-16670896 GCTACTGGGGAGGCTGGAGCAGG - Intronic
1064797515 10:19029907-19029929 GCTACTGGAGAGGCTGAAGCAGG - Intergenic
1065177616 10:23095207-23095229 GGAGCAGGAGTGGGAGGAGCTGG + Intergenic
1065186620 10:23174934-23174956 ACCGCGCGAGTGGCAGGAGCAGG - Intergenic
1065214446 10:23437307-23437329 GCGGCTGGAGTGACCTGAGCTGG + Intergenic
1065917336 10:30364835-30364857 ACTGCTGGAGCTGCAGGAGCTGG - Intronic
1066397539 10:35040890-35040912 GCTGCTGATGTGACAGGAGGCGG + Intronic
1067004964 10:42651904-42651926 GCTTCTGGTGTGGTCGGAGCAGG - Intergenic
1067110461 10:43396719-43396741 GCTGCTGGAGTGCCGTGAGCAGG - Exonic
1067111461 10:43404126-43404148 GATGGTGGAGTGGCAGGGGGTGG - Intronic
1069778338 10:70939624-70939646 GCTGCTGGAGGCACAGGGGCAGG + Intergenic
1069891145 10:71653150-71653172 TCTGCTGATGTGGCAGGAGAGGG - Intronic
1069906005 10:71732518-71732540 GCTGCTTGAGAGGCTGGGGCAGG + Intronic
1069914904 10:71781467-71781489 CCTGGTGGAGAGGCAGGTGCTGG + Intronic
1069920613 10:71813320-71813342 GATGGAGGAGTGGCAGGAGGAGG - Exonic
1070352953 10:75611051-75611073 GCTGCTGCAGAGGCTGGAGCTGG + Intronic
1070552669 10:77503003-77503025 GCTGCTTGAGAGGCTGAAGCTGG + Intronic
1070748097 10:78947301-78947323 GCTGCTGGGCTGGCAGGGGAGGG - Intergenic
1071052830 10:81472901-81472923 GCTGCAGGGGAGGCAGGACCCGG + Intergenic
1071420512 10:85492653-85492675 GCTGCTGGAAGGGAAGGAGACGG + Intergenic
1071807966 10:89145102-89145124 GCGGCTGCAGTGGCAGGAAAAGG - Intergenic
1071970473 10:90901084-90901106 GCTGCTTGAGAGGCTGAAGCGGG - Intronic
1072409270 10:95184872-95184894 GCAGCTGGAGTTGGAGGAGAAGG - Intergenic
1072806102 10:98424860-98424882 GCTGCAGGATTGGCTGGAGGAGG - Intronic
1072812964 10:98477842-98477864 GCTGCTGGTCTGACAGGAGGTGG - Intronic
1073326293 10:102645543-102645565 GCAGCTGGAGAGGCAGGACCGGG - Intronic
1073504980 10:103977501-103977523 GCTGCTGGAGAGGCTGAAGTGGG + Intronic
1073809344 10:107135555-107135577 CCTTCTGGATTGGCAGGTGCTGG - Intronic
1075182250 10:120222142-120222164 GCTGTGGGCATGGCAGGAGCTGG - Intergenic
1075326188 10:121533962-121533984 GCTGTTGGACTTGCAGGAGAGGG - Intronic
1075585890 10:123657935-123657957 GCTACTGGAGAGGCTGAAGCAGG - Intergenic
1076057341 10:127386467-127386489 GCTGCTGATCTGGCAGGAGGTGG - Intronic
1076110465 10:127855760-127855782 GCTCCTGCAGGGGCTGGAGCTGG + Intergenic
1076353809 10:129838162-129838184 GCTGCAGGAGGGGCAGGACTGGG - Intronic
1076391792 10:130109046-130109068 ACTGATGGAGTGGCAGTGGCAGG - Intergenic
1076451440 10:130559741-130559763 TGTCCTGGAGGGGCAGGAGCAGG + Intergenic
1077094381 11:793123-793145 GCTGCTGCAGTGGCGGAGGCTGG - Intronic
1077219223 11:1408043-1408065 GATTCTGGAGTGGAAGGACCTGG - Intronic
1077225290 11:1436827-1436849 GCTGCGGGTGGGGCAGGACCCGG + Intronic
1077258008 11:1597810-1597832 GCAGCTGGACTGGCAGCAGCAGG + Exonic
1077259381 11:1607702-1607724 GCAGCTGGACTGGGAGGAGCAGG + Exonic
1077259414 11:1607906-1607928 GCAGCTGGACTGGGAGCAGCTGG + Exonic
1077261110 11:1621527-1621549 GCAGCTGGACTGGCAGCAGTAGG + Exonic
1077262551 11:1630412-1630434 GCAGCTGGACTGGCAGCAGTAGG - Exonic
1077262562 11:1630499-1630521 GCAGCTGGACTGGCAGCAGCAGG - Exonic
1077837576 11:5938001-5938023 GCTGCTGGGATGGCGGGAACTGG - Intronic
1078050301 11:7960099-7960121 GCTGCTGGAGGTAAAGGAGCAGG - Exonic
1078059102 11:8032005-8032027 GGGGCTGGAGGGGCAGCAGCTGG + Intronic
1078136861 11:8658850-8658872 TCAGGTGAAGTGGCAGGAGCAGG - Intronic
1078144308 11:8712640-8712662 GCTGCTGGAGTGGCAGGAGCGGG - Exonic
1078532744 11:12149569-12149591 GCTGCTGAAGAGGCAGGACTTGG + Intronic
1078547488 11:12256646-12256668 TTTGCTGCAGTGGCAGTAGCAGG + Intronic
1078685026 11:13521483-13521505 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
1078997124 11:16713786-16713808 TCTGCAGGAGTGGAAGGAGCTGG - Intronic
1079965712 11:26977448-26977470 GCTACTGGAGAGGCTGAAGCAGG - Intergenic
1079972979 11:27059156-27059178 GAGGCTGGAGTGGGAGCAGCTGG - Intronic
1080746032 11:35109477-35109499 ACTGCTGGAGTCGAAGCAGCTGG - Intergenic
1081077058 11:38690459-38690481 GTGGCTAGAGTGGCAGAAGCAGG + Intergenic
1081584809 11:44376943-44376965 CCTGATGGCCTGGCAGGAGCTGG - Intergenic
1081767017 11:45618452-45618474 GTTGCTGGAGTTGCTAGAGCAGG + Intergenic
1082195810 11:49303839-49303861 GTTTCTGGAGTGTTAGGAGCCGG + Intergenic
1083083777 11:60121434-60121456 GCTGCTGATCTGGCAGGAGGTGG - Intergenic
1083314377 11:61805224-61805246 GCAGGTGAAGGGGCAGGAGCAGG + Intronic
1083636873 11:64125555-64125577 GCTGCTGGCGGGGCAGGAGCAGG - Intronic
1083721612 11:64606450-64606472 GCTGCTGGAGGAGCAGGGGTGGG - Exonic
1083860546 11:65417918-65417940 GCTGGTGAAGAGGCAGGAGGAGG + Intergenic
1083911595 11:65713126-65713148 GCTCCTGGATGGGCAGGAGGCGG + Intronic
1084156265 11:67314461-67314483 GCTGCAGGAGGGGCAGGGCCTGG - Intergenic
1084175284 11:67419585-67419607 GCTGCTGGAGAAGCTGGAGGAGG + Exonic
1084457475 11:69276644-69276666 GCTACTTGAGAGGCAGAAGCTGG - Intergenic
1084492983 11:69488447-69488469 GCAGCTGGGGTGGCGGGAGGGGG - Intergenic
1084563240 11:69915695-69915717 ACTGCTGAAGCGGCAGGGGCTGG - Intergenic
1084597594 11:70126240-70126262 GCAGCTGGGATGGCAGGAGAGGG - Intronic
1084607618 11:70181522-70181544 TGTGCTGGAGTGGGTGGAGCTGG + Intronic
1084791214 11:71476312-71476334 GCAGCTGGCTTTGCAGGAGCAGG + Intronic
1084798831 11:71527656-71527678 GCAGCTGGACTGGCAGCAGCAGG - Exonic
1084803979 11:71566081-71566103 GCAGCTGGACTGGCAGCAGCAGG - Exonic
1084803987 11:71566141-71566163 GCAGCTGGACTGACAGCAGCAGG - Exonic
1084804384 11:71568849-71568871 GCAGCTGGACTGGGAGCAGCAGG - Intronic
1084806064 11:71579747-71579769 GCAGCTGGACTGGGAGCAGCAGG + Intronic
1084806431 11:71582400-71582422 GCAGCTGGACTGGCAGCAGCAGG + Exonic
1084806434 11:71582430-71582452 GCAGCTAGACTGGCAGCAGCTGG + Exonic
1084806436 11:71582445-71582467 GCAGCTGGATTGGCAGCAGCAGG + Exonic
1084806440 11:71582475-71582497 GCAGCTGGACTGGCAGCAGCTGG + Exonic
1084806442 11:71582490-71582512 GCAGCTGGATTGGCAGCAGCAGG + Exonic
1084889294 11:72228810-72228832 GCTGTGGGAGTCTCAGGAGCTGG - Exonic
1085118599 11:73952016-73952038 CCTGCTGCAGTGGTAGCAGCTGG + Intronic
1085300046 11:75452637-75452659 GCTGCTGGAGGGACAGAGGCTGG + Intronic
1085433244 11:76474873-76474895 GCTACTGGGGTGGCTGGGGCAGG - Intronic
1086101996 11:83110514-83110536 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
1086549770 11:88042359-88042381 GAAGCTGGAGTGGGAGGAGCTGG + Intergenic
1088493383 11:110408110-110408132 GCTACTCGAGTGGCTGAAGCAGG - Intergenic
1088769236 11:113016435-113016457 GCTGCTTGGGTGGAAGGAGGTGG - Intronic
1088822641 11:113469726-113469748 GCTGCTCGGGTGGCTGAAGCAGG + Intronic
1089181150 11:116583643-116583665 GATGCAGGAGTGGGAGGACCTGG + Intergenic
1089324691 11:117649187-117649209 GCTGCTGGGGTGGCTGAGGCAGG - Intronic
1089335201 11:117718185-117718207 GCTTCTAGAGAGGCTGGAGCCGG - Intronic
1089343979 11:117778343-117778365 GGTGGTGGAGTGGAAAGAGCGGG + Intronic
1089610206 11:119664657-119664679 GCTCCTGGAGTGGGAGGTGGGGG + Exonic
1089653905 11:119933273-119933295 GCAGCGGCAGTGGCAGAAGCTGG - Intergenic
1089945061 11:122462028-122462050 GCAGCTGGAGAGGTAGGGGCTGG - Intergenic
1090037607 11:123262361-123262383 GCTGCTGGAGAGGCTGAGGCAGG + Intergenic
1090102535 11:123815299-123815321 GCTGCTGGGCTGGCAGGAGATGG - Intergenic
1090329745 11:125921775-125921797 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1090651731 11:128812764-128812786 TTTGCTGGAGTGGCAGAAGGTGG - Exonic
1090869918 11:130735141-130735163 GTGGCTGGAGTGGCAGGAACTGG + Intergenic
1091290669 11:134437799-134437821 GCCTCTGGAGTGGGAGGTGCAGG - Intergenic
1091353166 11:134913836-134913858 GCTGGTGCAGTGGCAGCAGAGGG + Intergenic
1091375469 12:22256-22278 GCTGCTGGGGAGGAAGAAGCAGG + Intergenic
1091390193 12:121563-121585 GCTGCTCCAGTGGCTGGAACGGG + Intronic
1091643769 12:2257537-2257559 GCTGCTGATCTGACAGGAGCTGG + Intronic
1092241588 12:6839320-6839342 GCTGCAGGAGTCACAGGAGGAGG + Exonic
1092392736 12:8095624-8095646 GCTGGTGTCGTGACAGGAGCAGG - Exonic
1093715197 12:22374090-22374112 GCTGATGGAGAGGGAGGAGAGGG - Intronic
1094494562 12:30981257-30981279 GCTGCTGGAGGGCCGGGTGCTGG - Intronic
1095254563 12:40019443-40019465 GAAGCTGGAGTGGTAGCAGCTGG + Intronic
1095347402 12:41167916-41167938 GCTGCTGGGGAGGCAGGCCCGGG - Intergenic
1096148611 12:49295307-49295329 GCTGCTGGAGAAGCGGGAGCTGG - Exonic
1096195839 12:49648315-49648337 GCTGCTGGACGTGAAGGAGCTGG - Exonic
1096314974 12:50556652-50556674 GCTGCTGGAGAGGCTGAGGCAGG - Intronic
1096495561 12:52037451-52037473 GCTGCCGGGGTGGCGGGAGGTGG + Intronic
1096524495 12:52202517-52202539 GAGGCTGGAGTTGGAGGAGCGGG - Intergenic
1096623606 12:52879631-52879653 CCTGCTGGAAAGGCCGGAGCCGG + Intergenic
1096991799 12:55810562-55810584 GCTACTGGAGAGGCTGAAGCAGG - Intronic
1097090212 12:56498822-56498844 ACTGCTGGGGTGGCAGGTACTGG + Intergenic
1097430974 12:59506580-59506602 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
1097467608 12:59947380-59947402 GCTACTGAAGTGGCTGAAGCAGG + Intergenic
1098355637 12:69610334-69610356 GCTCCTGGAGGCGCCGGAGCTGG + Exonic
1099154438 12:79157119-79157141 GGTGCAGAGGTGGCAGGAGCAGG - Intronic
1099391336 12:82083199-82083221 GCTGCCGGGGTGGTAGGAGTGGG - Intergenic
1100507756 12:95236680-95236702 GCTACTGGAGAGGCTGAAGCAGG - Intronic
1101487678 12:105182135-105182157 GCTACTGGAGAGGCTGGAGCAGG - Intronic
1103725336 12:122994928-122994950 GCTGCTGGAATGGCGTGAGCAGG + Exonic
1104299367 12:127550381-127550403 TCTGGTGGATTGTCAGGAGCAGG - Intergenic
1104538491 12:129640833-129640855 GCTGCTGAGCTGACAGGAGCTGG - Intronic
1104598221 12:130134265-130134287 GGTGCTGGGGAGGGAGGAGCTGG - Intergenic
1104624055 12:130338311-130338333 GGTGCGGGAGATGCAGGAGCCGG + Intronic
1104624097 12:130338437-130338459 GGTGCGGGAGATGCAGGAGCCGG + Intronic
1104676206 12:130714180-130714202 GCGGGAGGAGAGGCAGGAGCTGG - Intronic
1104678686 12:130733360-130733382 GCTACTGGAGGGGCTGGGGCAGG + Intergenic
1104681397 12:130754393-130754415 GGGGCAGCAGTGGCAGGAGCAGG + Intergenic
1104700844 12:130903126-130903148 GCTACTTGAGTGGCTGGGGCAGG - Intergenic
1104728344 12:131091725-131091747 GGTGAGGCAGTGGCAGGAGCTGG + Intronic
1104864020 12:131942098-131942120 GCTGCTGCAGGAGCAGGGGCAGG + Intronic
1104969693 12:132525630-132525652 GGTGCTGGGGTGCCGGGAGCAGG + Intronic
1104989567 12:132618322-132618344 GCTGCGGCGGAGGCAGGAGCTGG + Intergenic
1105274154 13:18905082-18905104 TCGGCTGGAGTGGTAGGAGGGGG - Intergenic
1105459421 13:20569459-20569481 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1105701310 13:22937583-22937605 GCTGCTGGAGGAGGGGGAGCTGG - Intergenic
1105806506 13:23954602-23954624 GTGGCTGGAGTGGTAGGAGCAGG + Intergenic
1105854151 13:24360645-24360667 GCTGTTGGAGTAGGGGGAGCTGG - Intergenic
1105866846 13:24468514-24468536 GCTACTGGAGAGGCTGCAGCAGG - Intronic
1105934947 13:25090039-25090061 GGTGCGAGAGTGGGAGGAGCAGG - Intergenic
1106027465 13:25968602-25968624 GCTGGAGGAGGTGCAGGAGCTGG + Exonic
1106268502 13:28131781-28131803 GCTACTGGAGAGGCTGAAGCAGG - Intergenic
1107013966 13:35694526-35694548 GCTTTTGGAGTGGGAGGGGCTGG - Intergenic
1107104893 13:36632492-36632514 GCTGCTGGGATGGAAGGAGATGG + Intergenic
1107290919 13:38852122-38852144 GGTGGGGGAGTGGCAGGAGGTGG - Intronic
1107834774 13:44404543-44404565 GCTGCTGGGCTGGCAGGCTCTGG - Intergenic
1107910489 13:45101017-45101039 GCTGCTGGCATGCGAGGAGCTGG + Intergenic
1108023552 13:46154605-46154627 ACTGGTGGAGTGGTAGCAGCTGG - Intronic
1108313443 13:49217471-49217493 GCTCCTGGGGTGTCAGGGGCTGG - Intergenic
1108321730 13:49296827-49296849 GCTGCTAGAGAGGCTGAAGCGGG + Intergenic
1109856219 13:68131382-68131404 GCATCTTAAGTGGCAGGAGCAGG + Intergenic
1111163130 13:84421256-84421278 GGAGCTGGAGTGGCAGCAACTGG - Intergenic
1111751704 13:92340468-92340490 GCTACTTGAGAGGCTGGAGCTGG - Intronic
1112049805 13:95634094-95634116 GTGGCTGGAGTGGCAGGGGCAGG - Intronic
1113146058 13:107208884-107208906 TCTGCTGGAGGGGGAGGAGGGGG - Intronic
1113482356 13:110630687-110630709 GATGCTGGTGTGGTAGGAGGAGG + Intronic
1113484901 13:110646505-110646527 CCTGCTGAAGTGGCAGGGGTGGG + Intronic
1113661370 13:112108285-112108307 GCAGGTGGGGTGGCAGGAGCTGG - Intergenic
1113674124 13:112196373-112196395 GGTGCTGAGGAGGCAGGAGCAGG - Intergenic
1113973876 13:114211735-114211757 GGTGCTGGAGTGGGAGCTGCTGG - Intergenic
1114501728 14:23174700-23174722 GCTGCAGGAGTGGGAGCAGCTGG - Intronic
1114668599 14:24397101-24397123 CCTCCAGGAGAGGCAGGAGCTGG + Intergenic
1115091160 14:29577549-29577571 GCTGTTAGAGTGGAAGGAGAAGG - Intronic
1115398858 14:32937335-32937357 GCCGCGGGAGTGACAGGAGTGGG + Intronic
1115804940 14:37040086-37040108 GCTACTCGGGAGGCAGGAGCAGG + Intronic
1116608610 14:47036156-47036178 GCTGCTGGGGTGGCTGAGGCAGG + Intronic
1116866930 14:50038832-50038854 GATGCTGGAGTTGCATGAGCTGG + Intergenic
1117366951 14:55038541-55038563 GCTGCTGGAGTTCTGGGAGCTGG + Intronic
1117437627 14:55732116-55732138 ACTGCTGGAGTGGCAGAATTGGG + Intergenic
1118441952 14:65820620-65820642 GATGCTGGAGTCGGAGGAGGTGG + Intergenic
1118773387 14:68957365-68957387 ACTGCTAGAGTGGCAGGAGAGGG + Intronic
1118830833 14:69430740-69430762 GCTGCTGGAGAGGCTGAAGTGGG - Intronic
1118951388 14:70439439-70439461 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
1118982410 14:70727494-70727516 GCCACTTGAGTGGCAGTAGCCGG - Intronic
1119878447 14:78080228-78080250 GCTACTGGAGAGGCAGAGGCAGG - Intergenic
1121310415 14:92932629-92932651 GCGGCTGGAGGGGCAGGAGGAGG + Exonic
1121843613 14:97154850-97154872 GCTGCCCGGGTGGCAGGAGGTGG + Intergenic
1122098639 14:99389531-99389553 ACTGCTGGAGTGGCAGAGGAGGG + Intergenic
1122228169 14:100291696-100291718 CCAGCAGGAGTGGCAGCAGCTGG + Exonic
1122292409 14:100686864-100686886 GGGGCTGGAGAGGCAGGAGGGGG + Intergenic
1122303403 14:100745468-100745490 GCTACTGGAGAGGCTGAAGCAGG - Intergenic
1122596841 14:102899599-102899621 GCTGGAGGAGTGCCTGGAGCTGG - Intronic
1122679625 14:103448120-103448142 GCTGGTGGTTTGGCAGGGGCTGG + Intronic
1123180135 14:106461565-106461587 GCTCCTGGATGGGCAGAAGCAGG - Intergenic
1123219805 14:106844808-106844830 GCTGCAGGAGGGGCCGGTGCGGG - Intergenic
1123473713 15:20572324-20572346 GCTGCTGGAGCTGCAGGAGATGG + Intergenic
1123644296 15:22428029-22428051 GCTGCTGGAGCTGCAGGAGATGG - Intergenic
1123665605 15:22607928-22607950 GCTGCTGGAGCTGCAGCAGATGG - Intergenic
1123734013 15:23167335-23167357 GCTGCTGGAGCTGCAGGAGATGG + Intergenic
1123752151 15:23364724-23364746 GCTGCTGGAGCTGCAGCAGATGG + Exonic
1123980480 15:25597449-25597471 GCTGCTGGTGGAGCAGGAACCGG - Intergenic
1124284516 15:28388646-28388668 GCTGCTGGAGCTGCAGGAGATGG + Exonic
1124298181 15:28522968-28522990 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1124319430 15:28702342-28702364 GCTGCTGGAGCTGCAGCAGATGG - Exonic
1124483086 15:30093089-30093111 GCTGCTGGAGCTGCAGCAGATGG + Exonic
1124489534 15:30145157-30145179 GCTGCTGGAGCTGCAGCAGATGG + Exonic
1124520497 15:30404129-30404151 GCTGCTGGAGCTGCAGCAGATGG - Exonic
1124538160 15:30562090-30562112 GCTGCTGGAGCTGCAGCAGATGG + Exonic
1124544626 15:30614151-30614173 GCTGCTGGAGCTGCAGCAGATGG + Exonic
1124564581 15:30801580-30801602 GCTGCTGGAGCTGCAGCAGATGG + Intergenic
1124612805 15:31220087-31220109 GCTGCTGGTCTGACAGGAGGCGG - Intergenic
1124753993 15:32393170-32393192 GCTGCTGGAGCTGCAGCAGATGG - Exonic
1124760493 15:32445495-32445517 GCTGCTGGAGCTGCAGCAGATGG - Exonic
1124778143 15:32603567-32603589 GCTGCTGGAGCTGCAGCAGATGG + Exonic
1124959073 15:34381829-34381851 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1124975699 15:34528050-34528072 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1125609248 15:40959752-40959774 GCTCCTGGAGAGCCAGGAGTCGG + Intergenic
1125671726 15:41478287-41478309 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1125702960 15:41704544-41704566 GCTGCTGGGGAGGCTGAAGCAGG + Intronic
1125728865 15:41881965-41881987 GCGGCTGGAGGAGCAGGGGCGGG - Exonic
1125790486 15:42361778-42361800 ACTGCTGGTGTGTCAGGATCTGG - Intronic
1125860736 15:42997126-42997148 GCTGCTGATCTGGCAGGAGGCGG - Intronic
1125884610 15:43219450-43219472 CATGCTGCAGTGGCTGGAGCTGG - Intronic
1125966740 15:43880887-43880909 GCTGCTGCAATGGGAGGAGGAGG + Intronic
1126369618 15:47932369-47932391 GATGCTGGAAAGGCAGGATCAGG + Intergenic
1127147150 15:56036018-56036040 CCTACTGGTGAGGCAGGAGCAGG - Intergenic
1127439962 15:58996467-58996489 GCTACTTGGGTGGCTGGAGCAGG + Intronic
1127793935 15:62422645-62422667 GCTGCTGGAGTGCCAGGAGATGG - Intronic
1127931020 15:63597616-63597638 GCGGCTGGAGTGCCAGCAGATGG - Exonic
1128003458 15:64216111-64216133 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1128281968 15:66403118-66403140 ACTGCTGCAGTGGAAGGAGGTGG + Intronic
1128562678 15:68678942-68678964 GCTGCTGGAGGGGCAGGGAGGGG - Intronic
1128748951 15:70134827-70134849 GCTGCTGGGGTAGCTGGAGTAGG - Intergenic
1129038671 15:72665980-72666002 GCTGCTGGAGCTGCAAGAGTTGG + Exonic
1129169221 15:73797734-73797756 GCTGCAGGACTGGCAGGAGCGGG + Intergenic
1129169253 15:73797828-73797850 GCTGGGGGAGTGGGAGGATCTGG + Intergenic
1129211220 15:74071250-74071272 GCTGCTGGAGCTGCAAGAGTTGG - Exonic
1129319824 15:74768298-74768320 GCGGCTGGAGGGGAAGGAGATGG - Intergenic
1129399183 15:75269837-75269859 GCTGCTGGAGCTGCAAGAGTTGG + Exonic
1129402790 15:75294113-75294135 GCTGCTGGAGCTGCAAGAGTTGG + Exonic
1129476319 15:75786534-75786556 GCTGCTGGAGCTGCAGGAGCTGG + Intergenic
1129487997 15:75895072-75895094 GCTACTGGGGTGGCTGAAGCAGG + Intronic
1129522331 15:76193756-76193778 GCTGGTGGGGAGGCAGGGGCAGG - Intronic
1129524237 15:76203997-76204019 GCTGCTGGGATGGCAGCGGCGGG - Exonic
1129530652 15:76261633-76261655 GCTGCTGTGGCGGCAGCAGCAGG + Intronic
1129610553 15:77051744-77051766 GCTACTGGAGAGGCTGAAGCAGG + Intronic
1129667643 15:77588408-77588430 CCAGCTGGAGGGGCAGGCGCGGG - Intergenic
1129716261 15:77852843-77852865 GGAGCAGGAGAGGCAGGAGCGGG + Intergenic
1129728353 15:77915524-77915546 TCTGCTGGAGCTGCAAGAGCTGG - Intergenic
1129777263 15:78244954-78244976 GAAGCTGGAGTGGGAGGAGGCGG - Intronic
1130312479 15:82767438-82767460 GGAGCTGGTGTGGGAGGAGCTGG + Intronic
1131051963 15:89354295-89354317 GCTGCTGCAGTGGACAGAGCTGG - Intergenic
1131071855 15:89471103-89471125 CCTGCTGGAGTGCCCAGAGCAGG + Intergenic
1131188667 15:90295321-90295343 CCTGCTGGAGATGCAGGGGCAGG + Intronic
1131466053 15:92655614-92655636 GCAGCAGCAGCGGCAGGAGCGGG + Exonic
1131838907 15:96416272-96416294 GCAGATGGAGTGGCAGGGCCAGG - Intergenic
1132089913 15:98939826-98939848 GCAGGAGCAGTGGCAGGAGCTGG + Intronic
1132135727 15:99336789-99336811 TCTGCTGAAGTTGCAGGGGCCGG - Intronic
1132426737 15:101724327-101724349 GCGCCTGGAGCGGCAGGAGGAGG - Exonic
1132507278 16:317398-317420 GCTGCTCGGGAGGCAGGTGCAGG + Intronic
1132583129 16:694358-694380 GCTGCAGGAGCTGGAGGAGCTGG - Exonic
1132691049 16:1182112-1182134 GCTGTGGCAGGGGCAGGAGCAGG + Intronic
1132702819 16:1229299-1229321 CCTGCTGGAGCTGGAGGAGCCGG - Exonic
1132705507 16:1241569-1241591 CCTGCTGGAGCTGGAGGAGCCGG + Exonic
1132967690 16:2668078-2668100 ACTGCTGGGGTGGCAGGTACTGG + Intergenic
1133164553 16:3937365-3937387 GCTGCTTGAGCGGCTGAAGCGGG + Intergenic
1133203445 16:4218633-4218655 GCTGCTGGTGATGGAGGAGCAGG - Intronic
1133205759 16:4232620-4232642 GCTGCTTGGGAGGCTGGAGCAGG - Intronic
1134172107 16:11976854-11976876 GCAGCTGGAGCGGCGGGAGCCGG - Intronic
1134247633 16:12551837-12551859 GCTGCTGGGGACACAGGAGCAGG + Intronic
1134388233 16:13794152-13794174 GCTGGAGGAGGGGCAGGGGCTGG - Intergenic
1134401361 16:13913437-13913459 TCTGGAGGAGTGGCAGGGGCAGG - Intergenic
1134690254 16:16186502-16186524 GCTGCTGATTTGGCAGGAGGTGG - Intronic
1135424244 16:22324448-22324470 GCTGCTGGAGGGGAGGGGGCTGG + Intronic
1136153306 16:28366047-28366069 GCAGCTGGAGTTGGAGGAGAAGG - Intergenic
1136209780 16:28749220-28749242 GCAGCTGGAGTTGGAGGAGAAGG + Intergenic
1136248716 16:28989846-28989868 TCTGCGGGAGGGGCAGGAGCTGG + Intronic
1137247625 16:46718525-46718547 GCTGCTTGGGAGGCAGGTGCTGG + Intronic
1137506194 16:49056003-49056025 GCTGGAGGAGAGGCATGAGCTGG + Intergenic
1137613493 16:49834466-49834488 TCTGCTGGAGAGGCTGGAGCCGG - Intronic
1138130877 16:54478927-54478949 GCTGCTGGAGCTGCAGGTGTTGG - Intergenic
1138455230 16:57117135-57117157 GCTGCCGCAGGGGCAGGAGAAGG + Intronic
1138508179 16:57489420-57489442 GCTGCTGGTCTGACAGGAGGCGG + Intergenic
1139310188 16:66021515-66021537 GGTGGAGGAGTGGCAGGCGCTGG - Intergenic
1139441027 16:66966909-66966931 GATGCTGGGGTGGCAGGTACTGG - Intronic
1139461158 16:67123463-67123485 GCTACTGGGGAGGCTGGAGCAGG + Intronic
1139890646 16:70251504-70251526 GCTGCAGGAGGCGCTGGAGCCGG - Exonic
1141094186 16:81151183-81151205 GCTACTTGAGTGGCTGAAGCAGG + Intergenic
1142019340 16:87771174-87771196 GCTGCTGGAGAGGCTGAGGCAGG + Intergenic
1142142901 16:88480446-88480468 GGTGCTGGTGGGGGAGGAGCGGG + Intronic
1142245763 16:88969418-88969440 GCTGCGGGGGTCGCAAGAGCGGG + Intronic
1142274135 16:89107097-89107119 GCTTCTGAGGTGGCAGGAGCAGG - Intronic
1142319745 16:89373429-89373451 GGTGCTGGCGTGGCTGGAGAGGG - Intronic
1142424559 16:89994433-89994455 GTTCCAGGGGTGGCAGGAGCCGG - Intergenic
1203146448 16_KI270728v1_random:1806284-1806306 GCTACTGGAGAGGCTGAAGCAGG - Intergenic
1142495118 17:302134-302156 GATGCCGCAGTGGCAGCAGCTGG - Intronic
1142767112 17:2071115-2071137 GCAGCTGGAGTGACAGGGGCTGG + Intronic
1142875113 17:2847702-2847724 GCTTCAGGAGTAGCAGCAGCTGG + Intronic
1142897920 17:2994182-2994204 GCTGATTTAGTGGCAGAAGCAGG + Intronic
1143618943 17:8070193-8070215 GCTGCTGGGGAGGCTGAAGCAGG + Intergenic
1144439323 17:15267156-15267178 GCTGCTGGAGATGGAGGACCTGG - Intergenic
1144741192 17:17583262-17583284 GCTACTGGAGAGGCTGAAGCAGG + Intronic
1144762570 17:17715656-17715678 ACTGCTGGAAGGTCAGGAGCGGG - Intronic
1145098622 17:20054307-20054329 GCTGCAGGAGAGACAGGAGCTGG - Intronic
1145235309 17:21203758-21203780 GCTGCTGGGTGGTCAGGAGCTGG - Intronic
1145248841 17:21286436-21286458 GCTGCTATGGTGGCTGGAGCCGG + Intronic
1145266266 17:21380953-21380975 GCTGCTGAAGTGGCAGCATGAGG + Intronic
1145404092 17:22570676-22570698 GCGGCTGGAGTGGTAGGAGACGG + Intergenic
1145722807 17:27089083-27089105 GCGGCTGGAGCGGTAGGAGAAGG - Intergenic
1145866308 17:28244108-28244130 GCTACTGGGGTGGCTGAAGCAGG - Intergenic
1145937086 17:28720703-28720725 GCTTTAGGAGGGGCAGGAGCTGG - Exonic
1145995698 17:29103631-29103653 GCTGCTGGAGTGCTTGGATCTGG - Exonic
1146911490 17:36651239-36651261 GATGCTGTAGTGGAAAGAGCAGG + Intergenic
1146970955 17:37072037-37072059 GCTGCTTGAGAGGCAGAGGCAGG - Intergenic
1147188314 17:38724869-38724891 GCTGCAGCAGTAGCAGCAGCAGG + Exonic
1147436937 17:40422244-40422266 GCTGCTGCAGAGGCTGAAGCAGG - Intergenic
1147512627 17:41084451-41084473 GCAGCTGGGGCGGCAGCAGCTGG - Exonic
1147513882 17:41097773-41097795 GCAGCTGGGGCGGCAGCAGCTGG + Exonic
1147514365 17:41101871-41101893 GCTGCTGGAGATGCAGCAGCTGG + Exonic
1147514370 17:41101886-41101908 GCAGCTGGGGTGGCAGCAGGTGG + Exonic
1147515966 17:41117899-41117921 GCAGCTGGGGTGGCAGCAGGTGG + Exonic
1147516584 17:41123673-41123695 GCTGCTGGAGATGCAGCAGCTGG + Exonic
1147517952 17:41140041-41140063 GCAGCTGGAGATGCAGCAGCTGG + Exonic
1147518887 17:41149378-41149400 GCAGCTGGAGATGCAGCAGCTGG + Exonic
1147519870 17:41160497-41160519 GCAGCTGGGGTGGCAGCAGGTGG + Exonic
1147768905 17:42854548-42854570 GCTGCTGGAGATGGAGGAGCAGG + Exonic
1147793072 17:43025265-43025287 GCGGCTGCAGTTGCAGGGGCGGG + Exonic
1147949259 17:44097882-44097904 GCTGCTGCAGTGGCAGTGACAGG - Intronic
1148073176 17:44920595-44920617 GTTGGCGGAGGGGCAGGAGCTGG + Intergenic
1148105862 17:45118492-45118514 GCTGCAGGGGTGGCAGGAGAGGG + Exonic
1148105951 17:45118959-45118981 GCTGCTGAAGCGGCCGGAGCTGG - Exonic
1148115253 17:45171592-45171614 GCTGCTGGAGTGTCGGGGGAGGG + Intergenic
1148382388 17:47209477-47209499 GCTGGTGCAGGGGCTGGAGCTGG - Exonic
1148464712 17:47857928-47857950 GCTGCTGGAGTTGGGGGAGGTGG - Intergenic
1148793187 17:50184980-50185002 GGTGCTGGGCGGGCAGGAGCGGG + Exonic
1149589009 17:57813761-57813783 GCTACTGGGGTGGCAGAGGCAGG + Intergenic
1150266254 17:63834199-63834221 GCTGCAGGATGGGCACGAGCGGG - Exonic
1150302188 17:64055867-64055889 GCTGCTGCTGCTGCAGGAGCTGG + Exonic
1150765535 17:67998895-67998917 GCTCCTGGGGTGGCACCAGCTGG + Intergenic
1151537720 17:74748383-74748405 GGCGCTGGGGTGGCAGGGGCGGG - Intergenic
1151556712 17:74850426-74850448 GCTGGAGGAGTGGCTGGGGCGGG - Intronic
1151681420 17:75624705-75624727 TCTGCTGGGGTGGCAGGGCCGGG + Intergenic
1151810934 17:76441436-76441458 GCTGCAGGAGGGGCAGGAAAGGG - Intronic
1151929758 17:77224862-77224884 GCTTCTGATATGGCAGGAGCAGG + Intergenic
1151947845 17:77329238-77329260 GCAGCTGGAGAGGGAGGATCAGG + Intronic
1151969556 17:77450723-77450745 GAGGCTGGAGAGGCAGGAGCTGG + Intronic
1152021175 17:77781159-77781181 ACTGCTGGAGTTGGAGGGGCAGG - Intergenic
1152029642 17:77834137-77834159 GCTGCTGGGGTGGTGGGGGCAGG - Intergenic
1152112834 17:78366526-78366548 GCCCTTGGAGAGGCAGGAGCTGG + Intergenic
1152122063 17:78424911-78424933 GTTCCAGGAGTGGCAGCAGCTGG + Intronic
1152279109 17:79374988-79375010 GCTGGTGGAGCGGCAGGGGAAGG - Intronic
1152317253 17:79588416-79588438 GCTCCTGGAGTGGCAGGAGGAGG - Intergenic
1152587092 17:81193972-81193994 GCTGCGGGAGCAGCTGGAGCGGG - Exonic
1152587103 17:81194026-81194048 GCTGCTGCAGTCGGATGAGCGGG - Exonic
1152600802 17:81261210-81261232 GGAGCCGGGGTGGCAGGAGCCGG - Intronic
1152630669 17:81409455-81409477 GGTTCTGGAGGGCCAGGAGCGGG + Intronic
1152693079 17:81729945-81729967 GCTGCTGGGGAGGCTGAAGCAGG + Intergenic
1152730644 17:81967977-81967999 GCCGCTGTTGCGGCAGGAGCAGG - Intergenic
1152732015 17:81977242-81977264 GCTGCTGGAGTGGAGGAAGCCGG + Intronic
1152753530 17:82077551-82077573 CCTGCTGGAGAGGCAGGGGAGGG - Intergenic
1152982554 18:292608-292630 CCTGCTTGAGTGGCTGGGGCAGG - Intergenic
1153447071 18:5186039-5186061 GCAGCTGGAGCTGTAGGAGCTGG + Intronic
1153705468 18:7740528-7740550 GCTACTGGAGAGGCTGAAGCAGG - Intronic
1153979595 18:10297673-10297695 GCTTCTGGAGGGGGAGAAGCAGG - Intergenic
1154049030 18:10935796-10935818 GCTGCTGGCGAGGCAGGAGCAGG - Intronic
1154994349 18:21625720-21625742 GCTACTGGAGAGGCAGAGGCAGG - Intronic
1155078809 18:22387524-22387546 TCTGCTGGAGTAACAGGTGCTGG + Intergenic
1156270019 18:35522035-35522057 GCTGCTGGAGTGGCAGGAAGGGG + Intergenic
1157479035 18:48040978-48041000 GCTCCTGGTGGTGCAGGAGCAGG - Exonic
1157867095 18:51196930-51196952 CCTGCTGGAGGAGGAGGAGCTGG - Exonic
1158016575 18:52791057-52791079 GCTGGTGGTGTGGTTGGAGCTGG + Intronic
1159142409 18:64413602-64413624 GCTGCTGGAGAGACTGGGGCAGG + Intergenic
1159153550 18:64553024-64553046 GCTGCTGATGTGACAGGAGGTGG - Intergenic
1159231398 18:65611597-65611619 GCCATTGGAGTGGCAGGACCTGG - Intergenic
1160493167 18:79354768-79354790 GCAGCTGGAGCTGAAGGAGCCGG + Intronic
1160498290 18:79388020-79388042 GCTGGTGGAGTGGCAGGGGGAGG - Intergenic
1160698579 19:496019-496041 GCTACTGGAGTGGCTGAGGCAGG + Intronic
1160701091 19:507773-507795 GCTGCTGCTGCAGCAGGAGCTGG - Exonic
1160734140 19:654148-654170 TGTGCTTCAGTGGCAGGAGCAGG - Intronic
1160792617 19:929555-929577 GCTGTTGCAGCGGCAGCAGCGGG + Exonic
1160810605 19:1011387-1011409 GGTGCTGGTGTGGCAGCAGATGG + Exonic
1160818333 19:1046540-1046562 CCTGCTGCAGCGGGAGGAGCAGG + Intronic
1160827185 19:1086046-1086068 CGTGCTGGAGGGACAGGAGCAGG - Exonic
1160881837 19:1324523-1324545 GCAGCTGGTGTGGCTGGAGCAGG + Intergenic
1160972053 19:1773877-1773899 GCTGCTGGAGCAGGAAGAGCAGG + Intronic
1161008144 19:1946722-1946744 GCTGCTGGAGAGGCTGAGGCAGG - Intronic
1161078600 19:2299216-2299238 GCTGCCGGGGAGGCAGGAGGGGG + Intronic
1161120803 19:2525204-2525226 GCTGTGGGAGGGGCGGGAGCAGG + Intronic
1161283204 19:3456654-3456676 GCTGGTGGGGTGGGAGGGGCAGG + Intronic
1161293190 19:3506578-3506600 GCTCCTGGAGGGGCCTGAGCTGG - Intronic
1161484133 19:4525632-4525654 GCTGCAGGAGACGCTGGAGCTGG - Exonic
1161680841 19:5679018-5679040 GCTGCTTGAGAGGCTGAAGCAGG - Intronic
1161913063 19:7208889-7208911 GCTACTCGAGAGGCAGAAGCAGG + Intronic
1161937870 19:7383150-7383172 GCAGCTGGAGGGGCCGGAGAAGG - Exonic
1161988845 19:7672584-7672606 GCTGCTGGTCTGACAGGAGGTGG + Intergenic
1162030139 19:7913672-7913694 CCTGCTGGGGTGGCCAGAGCAGG + Exonic
1162100356 19:8335187-8335209 GCTGCCCGAGCTGCAGGAGCAGG - Exonic
1162336178 19:10061936-10061958 GCTACTAGAGAAGCAGGAGCTGG + Intergenic
1162364133 19:10237799-10237821 GCTGCTGGATTGAGAGGAGCCGG - Intergenic
1162412221 19:10513375-10513397 GATGCTGGTGTGCCTGGAGCAGG - Exonic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162754878 19:12852020-12852042 GCTGCTGGAGTGCCTGGTGAGGG + Exonic
1162805466 19:13135934-13135956 GCCGGTGGGGTGGCAGCAGCAGG + Exonic
1162883372 19:13677301-13677323 GCTACTGGAGAGGCTGAAGCAGG + Intergenic
1162992836 19:14314567-14314589 GCTGCTGCTGTGGCCTGAGCAGG + Intergenic
1163287113 19:16355758-16355780 GCGGCTGCGGCGGCAGGAGCAGG - Exonic
1163322198 19:16581399-16581421 GGTGCTGGAGTGCCTGGGGCAGG - Intronic
1163435499 19:17292807-17292829 GCTTCAGGAATGCCAGGAGCAGG + Exonic
1163616851 19:18334270-18334292 GCTGCTGGTCTGGCAGAAGGCGG - Intergenic
1163766267 19:19165122-19165144 GGTGCTGGGGATGCAGGAGCAGG + Intronic
1163833096 19:19556954-19556976 GCTACTCGAGAGGCTGGAGCGGG + Intergenic
1164014180 19:21237471-21237493 ACTGCTGGAGTGCCAGGGTCAGG + Intronic
1164084380 19:21888060-21888082 ACTGCTGGGGTGGCAGGTACTGG + Intergenic
1164156983 19:22602983-22603005 GCTGCTGGAGTTGCAGGAGCTGG + Intergenic
1164428458 19:28166148-28166170 GCTGGTAAAGTAGCAGGAGCTGG + Intergenic
1164623499 19:29711875-29711897 GATGCTGGCCTGGCTGGAGCAGG - Intronic
1165210356 19:34230992-34231014 GCTGCTGATGTGACAGGAGGTGG + Intergenic
1165293304 19:34906185-34906207 GCAGCGGCAGTGGCAGCAGCGGG - Intergenic
1165313012 19:35039973-35039995 GCGGCCGGCGGGGCAGGAGCTGG - Intronic
1165455496 19:35908177-35908199 CCAGCAGGAGAGGCAGGAGCAGG + Exonic
1165873391 19:38989081-38989103 GCGGCTGGACTGGCATCAGCCGG + Intergenic
1166083259 19:40458288-40458310 GCGGCAGGGGTGGCAGGGGCGGG + Intronic
1166213970 19:41323895-41323917 TCTGCTGGGGGAGCAGGAGCCGG - Exonic
1166326050 19:42051824-42051846 GCGGCAGGAGGGGCAGGAGCTGG - Intronic
1166651892 19:44581206-44581228 GGTGCTGGTGTGGGTGGAGCTGG - Intergenic
1166666932 19:44685745-44685767 GCTACTGGAGAGGCAGAGGCAGG + Intergenic
1166748368 19:45152699-45152721 GCTGCTGGCGGTGCAGGCGCAGG - Exonic
1166789770 19:45391935-45391957 GGAGCTGGTGGGGCAGGAGCAGG + Exonic
1166862174 19:45816875-45816897 GCTGCTGGGGCGGCAGCTGCAGG + Exonic
1166898068 19:46036435-46036457 GCAGCTGCAGGGGCAGGAGGAGG - Intergenic
1167145998 19:47681072-47681094 GCTGCTGGAGGCCCAGGGGCAGG - Exonic
1167254884 19:48421480-48421502 GAGGCTGGCATGGCAGGAGCTGG - Intronic
1167288222 19:48610736-48610758 GCTGCTGGCGGTCCAGGAGCAGG + Exonic
1167490131 19:49788056-49788078 GCTGCTGGAGTGGCTGACGTGGG - Intronic
1168080217 19:54004670-54004692 GAGGCTGGCGTGGCCGGAGCAGG - Intronic
1168268945 19:55239355-55239377 GCTGCTGCAGAGGCAGGACAGGG + Intronic
1168288157 19:55344658-55344680 GCAGCTGTGGTGGCAGGAGCAGG + Intronic
1168688462 19:58362608-58362630 GCGGCGGGAGTGGTTGGAGCCGG + Intronic
925041669 2:735866-735888 ACTGCAGGAGAGGCAGGAGTGGG + Intergenic
925216078 2:2096958-2096980 GCCGCTGGCGTGAGAGGAGCTGG - Intronic
925352645 2:3212393-3212415 GCTCCTGGTGTGGGAAGAGCTGG - Intronic
925404602 2:3597808-3597830 ACTGCTGCTGAGGCAGGAGCCGG + Intronic
925531640 2:4869475-4869497 TGAGCTGGGGTGGCAGGAGCAGG - Intergenic
925665216 2:6246921-6246943 GCTGCTGGGGAGGCAGAGGCAGG + Intergenic
925891442 2:8438209-8438231 GCTGCTGATCTGGCAGGAGGCGG - Intergenic
926547723 2:14262712-14262734 GCAGCTTATGTGGCAGGAGCAGG + Intergenic
927419227 2:22912611-22912633 GCAGCTGGAGCGCCAGAAGCAGG + Intergenic
927484050 2:23476966-23476988 GCTACTGAAGGGACAGGAGCTGG + Intronic
928199718 2:29239880-29239902 GCTGCTGGGTTGGCAGGAAGGGG - Intronic
928245766 2:29625774-29625796 GCTGCTGGAGGGCCAGGCTCTGG + Intronic
928296637 2:30089712-30089734 GTTGGGGGAGTGGAAGGAGCAGG - Intergenic
928504939 2:31941195-31941217 GCAGCTGGAGTGGCAGTACAAGG - Intronic
929083626 2:38146750-38146772 GCTGCGGGGGTGGCGGGAGAAGG - Intergenic
929600172 2:43199774-43199796 GGGGCTGGAGAAGCAGGAGCTGG + Intergenic
929895884 2:45960572-45960594 GCTGCTGGTCTGACAGGAGGTGG + Intronic
931431851 2:62214798-62214820 GCATCTGGAGTGACAGGACCAGG - Intronic
931989370 2:67774418-67774440 GTGGCTAGAGTGGCAGGAGTTGG - Intergenic
932292406 2:70593738-70593760 GCTGTGGGACTGGCAGCAGCAGG - Intergenic
932593709 2:73081499-73081521 GCGGCAGCAGTGGCAGCAGCGGG + Intronic
932757212 2:74417214-74417236 CCTGGGGGGGTGGCAGGAGCAGG + Intronic
932763711 2:74457429-74457451 GCTGCTGAAGCGCGAGGAGCGGG + Exonic
932783086 2:74575482-74575504 GCAGCTGGACTGGGATGAGCTGG - Exonic
934527482 2:95060483-95060505 CCTGCTGGAATGGAAGGGGCAGG + Intergenic
934559732 2:95306950-95306972 GCTGCTGGGGAGGCGGGAGGAGG - Intronic
934744856 2:96752680-96752702 GCTGCTGGGGAGGCAGAGGCAGG - Intergenic
935091184 2:99896424-99896446 CCTGCAGAAGTGGCAGGAGTGGG - Intronic
935531249 2:104234801-104234823 GCTGCTTGAGAGGCTGGGGCAGG + Intergenic
936258367 2:110936003-110936025 GCTGCTGAACTGACAGGAGGTGG + Intronic
936636563 2:114265480-114265502 GCTGAAGGAGTGACAGGTGCAGG + Intergenic
937424486 2:121787212-121787234 GCTACTTGAGTGGCAGAGGCAGG - Intergenic
938312132 2:130300380-130300402 GCGGCTGGAGTGGTAGGAGAAGG - Intergenic
940210704 2:151253802-151253824 GTGGCTGGAGTGGAATGAGCTGG - Intronic
942266691 2:174234573-174234595 GCTGCTTGAGAGGCTGAAGCGGG - Intronic
942278965 2:174342303-174342325 GCGGCTGGGCAGGCAGGAGCCGG + Intergenic
942420425 2:175801491-175801513 GCTACTGAAGTGACAGGAGGTGG + Intergenic
942792806 2:179779999-179780021 GCTGCTGGGGTTGGAGGAGAGGG + Intronic
943563119 2:189487009-189487031 GCTACTGGAGAGGCTGAAGCAGG - Intergenic
943988935 2:194660905-194660927 GCTGCTGGACTGGCATGTGCAGG - Intergenic
944302770 2:198143309-198143331 GCTGCTGATGTGACAGGAGTGGG + Intronic
944402915 2:199348880-199348902 GATGCTGGTGAGCCAGGAGCCGG + Exonic
944772200 2:202925750-202925772 GCTGCTTGAGTAACAGGAGCTGG + Intronic
945157050 2:206849955-206849977 GCTGCTGACCTGGCAGGAGGTGG + Intergenic
945194887 2:207228581-207228603 TTTGCTGGAGTGGGAGGAGGGGG - Intergenic
945881403 2:215328481-215328503 GGCGCTGGAGTGGAAAGAGCTGG - Intronic
946023698 2:216659206-216659228 GCTGCTGGAGTGCCAGCACCCGG + Intronic
946153499 2:217791809-217791831 GCAGTTGTAATGGCAGGAGCTGG + Intergenic
946295126 2:218777924-218777946 GGAGGTGGAGTGGCAGGAGATGG + Intergenic
946431449 2:219628954-219628976 TCTGGTGGAGTGGGAGGAGAGGG - Intronic
947873657 2:233453781-233453803 GCTGGGGGAGCTGCAGGAGCAGG + Intronic
947929832 2:233955184-233955206 TCTGCTGGAGTGGAACCAGCTGG + Exonic
948388993 2:237598633-237598655 GATGCTGGAGGGGACGGAGCAGG - Intronic
948863464 2:240763950-240763972 GGTGCTGGGGTGGGAGGGGCTGG - Intronic
948907605 2:240987146-240987168 GCTGCTGGGGGTGGAGGAGCAGG + Intronic
949044275 2:241863790-241863812 GCTTCTGCAGTGGGAGGCGCCGG + Intergenic
1168745275 20:233846-233868 GGACCTGGAGTGGCAGGACCTGG - Intergenic
1169068642 20:2708316-2708338 GCTGCTGGGGTTGCGGGAACAGG + Intronic
1169140974 20:3227379-3227401 GGGGGTGGAGTGGCAGTAGCAGG + Intergenic
1169201051 20:3710399-3710421 GCTGCTGGAGTGGACTGATCTGG + Intergenic
1170744035 20:19082169-19082191 GCTGCTGATCTGGCAGGAGGTGG - Intergenic
1170933127 20:20787075-20787097 GCTGCTGTGGTGGCAGAAGTGGG - Intergenic
1171467215 20:25338219-25338241 GCTGGTGGAGTGGGAGGAGGAGG - Intronic
1172033496 20:31996913-31996935 GCGGCTGGAGTACCAGAAGCCGG - Exonic
1172108068 20:32528420-32528442 GCTGCTGGAGTGGGGAGGGCAGG - Intronic
1172398716 20:34630366-34630388 GCTGCTGGAGTTGTGAGAGCAGG - Intronic
1172504565 20:35452001-35452023 GCTGCTGAACTGACAGGAGGTGG - Intronic
1172642112 20:36446797-36446819 GCTGCGGGAGCGGAAGTAGCTGG - Exonic
1172846946 20:37935236-37935258 GCTGCAGGAATTGCAGGGGCTGG - Intronic
1172896343 20:38302930-38302952 GCTGCTGCAGAGGGAGGGGCAGG + Intronic
1173030201 20:39349836-39349858 GCTACTGGAGAGGCTGAAGCAGG + Intergenic
1173486899 20:43447779-43447801 GCTGCTTGGGAGGCTGGAGCAGG - Intergenic
1173567263 20:44050868-44050890 GCTGGTAGAATGGCAGGACCAGG + Intronic
1173690867 20:44960153-44960175 GTTGCGGGAGTTGGAGGAGCAGG + Intronic
1174194853 20:48765922-48765944 GCTGCTGATGTGACAGGAGGCGG - Intronic
1174475536 20:50793597-50793619 GCTACTGGAGAGGCAGATGCAGG - Intergenic
1174598962 20:51708621-51708643 GCTGCTTGAGTGGCCGAGGCAGG + Intronic
1175367833 20:58467658-58467680 GCTGCAGGGGTGGAAGGAGATGG + Exonic
1175392170 20:58634414-58634436 TCTGCTGGATGGGCAGGAGCCGG - Intergenic
1175448539 20:59042988-59043010 GCAGCTGGAGGGGCCGGCGCGGG + Intergenic
1175480458 20:59307031-59307053 GCTACTGGAGAGGCTGAAGCAGG + Intronic
1175504083 20:59469746-59469768 GCTGCTGCATTGGAAGGCGCTGG - Intergenic
1175541040 20:59747813-59747835 GCTGCTGGAGATGATGGAGCAGG + Exonic
1175777716 20:61663588-61663610 GCTGCTGGGACGGCAGGACCGGG + Intronic
1175888961 20:62307657-62307679 GCTGCTGGAGCAGAAGGGGCTGG - Exonic
1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG + Exonic
1176088752 20:63309736-63309758 GCTGCTGGAGTAGCGGGAGTGGG - Exonic
1176284501 21:5012367-5012389 GCTGCTGGAGGGACAGGGGCAGG + Intergenic
1176649096 21:9529470-9529492 GCGGCTGGAGAGGTAGGAGAAGG - Intergenic
1177791565 21:25728028-25728050 GCTGCTGGAGAGGAAGAAGAGGG - Intronic
1178418772 21:32426511-32426533 GCTGGTGGGGTGGCAGGGGTTGG - Intronic
1178513801 21:33229833-33229855 GCCGCTGGCGGGGCTGGAGCAGG - Intergenic
1178785135 21:35646726-35646748 TCTGCTGCTGTGGCAGCAGCAGG + Intronic
1178860237 21:36282862-36282884 GCTACTGGGGAGGCAGAAGCAGG + Intronic
1179086823 21:38225723-38225745 GCTTCTGGAGTGACCAGAGCAGG + Intronic
1179513738 21:41892280-41892302 GGAGCTGGAGAGGCGGGAGCAGG + Intronic
1179658874 21:42862252-42862274 TCTGCTGGAGGGGCAGGAAGGGG + Intronic
1179714144 21:43279159-43279181 GCAGCTGGTGTGGCAGAGGCAGG + Intergenic
1179812038 21:43877954-43877976 GCTGGTGGTGGGGCAGGAGGCGG - Intronic
1179819932 21:43930759-43930781 CCTCCTGGGGTGGCAGGAGGTGG + Intronic
1179872680 21:44251108-44251130 GCTGCTGGAGGGACAGGGGCAGG - Intronic
1179926831 21:44539365-44539387 GCAGCTGGCCTGGCAGGAGGAGG + Exonic
1179931675 21:44574909-44574931 GCAGCTGGGTTGGCAGGAGGAGG - Exonic
1179934095 21:44591483-44591505 GCAGCTGGGCTGGCAGGAGGAGG + Exonic
1179935542 21:44601616-44601638 GCAGCTGGCCTGGCAGGAGGAGG - Exonic
1179936975 21:44612258-44612280 GCAGCTGGAGGCACAGGAGCGGG - Exonic
1179937078 21:44612795-44612817 GCAGCTGGGCTGGCAGGAGGAGG - Exonic
1179940790 21:44638055-44638077 GCAGCTGGGCTGGCAGGAGGAGG - Exonic
1179942144 21:44647237-44647259 GCAGCTGGACTGGCAGGAGGAGG - Exonic
1179949664 21:44702683-44702705 GCAGCTGGGCTGGCAGGAGAAGG - Intronic
1180035886 21:45249004-45249026 GCTGCTGGCATAGAAGGAGCTGG + Intergenic
1180049968 21:45326604-45326626 GATGCTGTGGGGGCAGGAGCAGG - Intergenic
1180128613 21:45809633-45809655 GCTGCTGTAGTGGCAGCGGCAGG - Intronic
1180224774 21:46385894-46385916 GCTGCAGCAGAGGCGGGAGCGGG + Exonic
1180639153 22:17284108-17284130 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
1180796773 22:18609673-18609695 GCGGCGCGAGTGCCAGGAGCTGG - Exonic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1180951722 22:19723476-19723498 GGTGCGGGCGTGGCAGGGGCGGG + Exonic
1180976365 22:19850984-19851006 TCTGCTGGAGTTGGGGGAGCTGG + Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181224951 22:21385598-21385620 GCGGCGCGAGTGCCAGGAGCTGG + Exonic
1181253681 22:21549215-21549237 GCGGCGCGAGTGCCAGGAGCTGG - Exonic
1181816646 22:25442577-25442599 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
1182583968 22:31332553-31332575 GCTTCTGGAGTGCCAAGTGCAGG - Intronic
1182693709 22:32181700-32181722 TCTGCTGGAGTGACTGGAGGAGG - Intergenic
1182867263 22:33614597-33614619 CCTGCAGGAGGAGCAGGAGCTGG - Intronic
1183083966 22:35475148-35475170 GTGGATGGGGTGGCAGGAGCAGG + Intergenic
1183199488 22:36376071-36376093 GCTACTGGAGTGGCTGAGGCAGG - Intronic
1183402692 22:37613920-37613942 GCTGCAGGGGTGGGAGGAGTGGG + Intronic
1183411734 22:37658908-37658930 GCTGCTGGAGCGGCTGGCGCGGG + Exonic
1183651812 22:39159871-39159893 GCTGCTGGAGAGGCTGAGGCAGG + Intergenic
1183736018 22:39645396-39645418 GCAGCTGCAGAGGCAGGGGCGGG + Intronic
1183816306 22:40303797-40303819 GTTACTGGAGTGGCTGAAGCAGG + Intronic
1183922011 22:41177259-41177281 GTCGTTGGAGTGGCAGGAGTGGG - Exonic
1184175683 22:42787521-42787543 GCAGGAGGGGTGGCAGGAGCTGG + Intergenic
1184189121 22:42883203-42883225 GCTGCTCTGCTGGCAGGAGCAGG - Intronic
1184209156 22:43025088-43025110 GCTGGAGGAGCGGCAGGAGGGGG - Intergenic
1184344348 22:43903864-43903886 GCTACTGGAGAGGCTGAAGCAGG + Intergenic
1184530149 22:45050383-45050405 GTTCCTGGATTTGCAGGAGCTGG + Intergenic
1184531118 22:45056325-45056347 GCGGTTGGATTGGCAGGAGAAGG - Intergenic
1184594540 22:45505881-45505903 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
1184660272 22:45962439-45962461 GCCCCTGGAGGGGGAGGAGCTGG - Intronic
1185157298 22:49201761-49201783 GGGGCTGGAGTGGCTGGGGCAGG - Intergenic
1185278901 22:49961558-49961580 GGTGCTGGAGCGGCCCGAGCCGG + Exonic
1185365919 22:50436704-50436726 GCTCCTGGAGTGGGAGGAAAGGG - Intronic
1185408741 22:50672155-50672177 GCTGGTGGGTTGGCAGGAGGCGG + Intergenic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
949518353 3:4827183-4827205 GGTGCTGTCGGGGCAGGAGCAGG - Intronic
949606623 3:5660539-5660561 GCAGCTGGTGTGGCCGGAGCAGG + Intergenic
949757376 3:7428030-7428052 GCTTCTGTAGTGGCTGGTGCTGG - Intronic
950005743 3:9689945-9689967 CCTCCTGCAGTGGAAGGAGCAGG - Exonic
950298268 3:11850832-11850854 GCTGATGGAGGGGAAGGAGAGGG + Intergenic
950515270 3:13460804-13460826 GCTGCTGCTGTGGCGGGGGCTGG + Intergenic
950784472 3:15422511-15422533 GCTGCTTGAGAGGCAGAGGCAGG + Intronic
950900725 3:16495024-16495046 GCGGGTGGAGTGGAAGGAGACGG + Intronic
951565868 3:24012074-24012096 GCTGCTGGAGAGGCTGAAGGCGG - Intergenic
952242192 3:31542952-31542974 GCTGCTCGAGAGGCTGGGGCAGG + Intronic
952312497 3:32202780-32202802 GCTGCTGGAGGGAGAGCAGCTGG - Intergenic
952858928 3:37796016-37796038 TATGCTGGAGAGACAGGAGCTGG - Intronic
952892290 3:38051378-38051400 CCTGCTGCCGTAGCAGGAGCTGG + Intronic
953314980 3:41918711-41918733 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
953389818 3:42527622-42527644 GAAGCTGGCCTGGCAGGAGCTGG - Intronic
953768105 3:45759553-45759575 GCTGCTCAGGAGGCAGGAGCTGG + Intronic
953885438 3:46712272-46712294 GCAGTGGGAGTGCCAGGAGCAGG + Exonic
954034356 3:47842944-47842966 GCTGCTGCATAGCCAGGAGCAGG - Intronic
954266218 3:49472168-49472190 GCTGGTGGAGTGGCAGGAAGAGG + Intronic
954340005 3:49945768-49945790 GCTGCTGGGGAGGCTGGGGCAGG + Intronic
954451046 3:50571917-50571939 GGTGCAGGAGTGGCAAGAGTGGG + Intronic
954493588 3:50930929-50930951 CCTGCAGCAGTGGCAGGAGAGGG + Intronic
954707606 3:52489397-52489419 GCTGCTGCAGGGGCTGGAGCTGG - Exonic
954796102 3:53161933-53161955 GCGGCTGGACTGGCAGGGGGCGG - Intronic
955399026 3:58578006-58578028 GCTGCTGAAGGGGCTGGTGCTGG - Intronic
956646966 3:71465824-71465846 GCTGCTGATGTGACAGGAGGCGG - Intronic
958671458 3:97210835-97210857 TCAGCTGGATTGGCAGGAGTGGG + Intronic
960950125 3:122993779-122993801 GCTGTGGGGGAGGCAGGAGCGGG - Intronic
961029546 3:123589884-123589906 GCTGTTGGTCTGGCAGGAGGTGG + Intergenic
961365877 3:126398929-126398951 GCTGCAGGAATGGATGGAGCCGG - Intronic
961445986 3:126982093-126982115 GCTCCTGGGGAGGGAGGAGCGGG + Intergenic
961825112 3:129595216-129595238 CATGCTGAAGTGGAAGGAGCTGG - Intronic
961858209 3:129893553-129893575 GCGGCCGCAGTGGAAGGAGCAGG - Intronic
962278624 3:134033754-134033776 GCTGCTGGGGAGGCAAGAGAAGG + Intronic
965363847 3:167774618-167774640 GCTGCTGGTCTGACAGGAGGTGG - Intronic
965672060 3:171157546-171157568 GCAGCTGGAGCAGCAGCAGCGGG - Exonic
965783863 3:172316117-172316139 GCTGCTCGAGTGGCCGAGGCAGG - Intronic
965911898 3:173788707-173788729 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
966558035 3:181285713-181285735 GCTGCTGGGGTTAAAGGAGCCGG - Intergenic
966721240 3:183064527-183064549 GCTGGTGGCGTGCCATGAGCAGG - Intronic
966940169 3:184741134-184741156 GGGCATGGAGTGGCAGGAGCTGG - Intergenic
966990410 3:185224387-185224409 GCTACTGGAGAGGCTGAAGCAGG + Intronic
967281222 3:187825923-187825945 GCTGCTGGGGAAACAGGAGCAGG - Intergenic
967516979 3:190381441-190381463 GAAGCTGGAGTGGCAGGTGATGG - Intronic
968503526 4:961731-961753 GCAGGTGGAGCGGCAGGAGGTGG - Exonic
968504556 4:965827-965849 GCTCAAGGAGAGGCAGGAGCCGG + Intronic
968646607 4:1744248-1744270 GCTGCAGGTGTGGCAGGAGGGGG + Intronic
968761277 4:2443778-2443800 CCTGCTGGGGAGGCAGGAGAAGG - Intronic
968917876 4:3505103-3505125 GCTGCGTGCGTGGCAGGACCCGG - Intergenic
968969859 4:3788164-3788186 GGGGCAGGAGGGGCAGGAGCTGG - Intergenic
969042992 4:4315528-4315550 TCTGCAGCAGTGTCAGGAGCAGG + Intronic
969203278 4:5622649-5622671 GCAGCTGGAGGGGGAGGAGAGGG - Exonic
969283789 4:6189920-6189942 GCTGCAGGCGTGGCAGGAGAGGG + Intronic
969308849 4:6340535-6340557 GCTGCTGGATTGGATGGAGAGGG - Intronic
969320614 4:6410221-6410243 TCTGCTGGAGTAGTGGGAGCAGG + Intronic
969411593 4:7031951-7031973 GCTCCTCGAGGTGCAGGAGCAGG + Exonic
969583407 4:8078414-8078436 TCTGCTGGAGGGGCAGGCCCAGG - Intronic
969626086 4:8306485-8306507 GCAGTAGGAGGGGCAGGAGCAGG - Exonic
969762752 4:9201415-9201437 GTATCTGGAGTGGCAGGAGAGGG + Intergenic
969781761 4:9409825-9409847 GCTGCTGGAGTGCCAGGGCTGGG - Intergenic
970664307 4:18319337-18319359 GGTGCTGGGGGAGCAGGAGCGGG + Intergenic
971622418 4:28872595-28872617 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
972359347 4:38313354-38313376 ACTCCTGGATTGGCAGGTGCAGG + Intergenic
972467872 4:39374693-39374715 GCTGCTTGAGAGGCTGGGGCAGG - Intergenic
972480185 4:39489304-39489326 GCTTCTGGAGTGACTAGAGCAGG - Intergenic
972613026 4:40672616-40672638 GCGGCTGGAGTGGAGTGAGCCGG + Intergenic
973597462 4:52507191-52507213 GGAGCTGGTATGGCAGGAGCAGG - Intergenic
973672441 4:53235040-53235062 GCAGCCAGAATGGCAGGAGCAGG - Intronic
974279556 4:59774849-59774871 GCTACTCGAGAGGCAGCAGCAGG + Intergenic
975078813 4:70249340-70249362 GTTGGTTCAGTGGCAGGAGCTGG - Exonic
975496343 4:75039688-75039710 GCTACTGGAGTGTTAGAAGCGGG - Intronic
975617122 4:76257569-76257591 GTGGTTGGAGTGGCAGGAGCAGG - Intronic
975841784 4:78481887-78481909 ACTCCTGGTGTGGCAGAAGCTGG - Intronic
976154549 4:82128569-82128591 GCTGCTGCAATGGCTGGAGTTGG - Intergenic
978976688 4:114884282-114884304 GCTGCTGGGGAGGCAGGAAGAGG + Intronic
980696002 4:136356210-136356232 ACTGCTCGAGTGCCAGGTGCAGG - Intergenic
981365508 4:143897355-143897377 GCTACTTGAGAGGCAGAAGCTGG + Intronic
981375510 4:144010355-144010377 GCTACTTGAGAGGCAGAAGCTGG + Intronic
981386125 4:144132545-144132567 GCTACTTGAGAGGCAGAAGCTGG + Intronic
981490572 4:145335051-145335073 GCTACTGGAGAGGCTGAAGCAGG + Intergenic
981751404 4:148095667-148095689 GCTGATGGAGTGACAGAGGCAGG + Intronic
981913259 4:150007173-150007195 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
982073163 4:151713497-151713519 GCTGATGGAGTTGCAGCAGCTGG - Intronic
982145340 4:152382578-152382600 GCTGTTTGACTGGCAGGAGCAGG - Intronic
982667658 4:158285690-158285712 GCTGCAGAAGAGGCATGAGCAGG + Intergenic
982767875 4:159368741-159368763 GCTGCTGGTCTGACAGGAGACGG - Intergenic
984272269 4:177561040-177561062 GCTACTGGGGTGGCTGAAGCAGG + Intergenic
984801329 4:183719612-183719634 GCTACTGGAGAGGCTGAAGCAGG + Intergenic
984940234 4:184924867-184924889 GATGCTGGGGTGGCTGGAGTGGG - Intergenic
985501692 5:251742-251764 GCAGCTAGAGTGGCAAGACCAGG + Intronic
985735185 5:1575884-1575906 GCAGCTAGAGTGGCATGACCAGG - Intergenic
985773801 5:1829611-1829633 GCTACTTGAGAGGCTGGAGCAGG - Intergenic
986167575 5:5288847-5288869 ACAGCTGGAGTGGCAGGATCAGG - Intronic
986556030 5:9010418-9010440 CCTGAGGGAGTGGCAGGAGTTGG - Intergenic
986607420 5:9536020-9536042 GCTGCTGCTATGACAGGAGCAGG - Intronic
986970602 5:13331952-13331974 ACAGCTGGAGTGGCAGCAGTTGG - Intergenic
987282616 5:16426213-16426235 GCAGCTGTGGTGGCAGGAGAGGG + Intergenic
987313396 5:16701619-16701641 GCTGCAGGAGCGGCGGGACCAGG - Exonic
987744068 5:21947886-21947908 GGAGCTGGAGTAGCAGCAGCTGG - Intronic
988100460 5:26669800-26669822 GCAGCTGAAGGTGCAGGAGCTGG - Intergenic
988504223 5:31807786-31807808 GATGCTGGGCTGGCAGGAGGGGG + Intronic
988540071 5:32100564-32100586 GGAGCAGGAGTGGCAGGAGCGGG + Intronic
988599215 5:32623908-32623930 GCTGCAGGAGTGGCAGGGACTGG + Intergenic
988628313 5:32900902-32900924 GAAGCTGGAGTGGCAGCAGCTGG + Intergenic
989231828 5:39095742-39095764 GCTGCTGGGGAGGCTGAAGCAGG + Intergenic
990330715 5:54722847-54722869 GCTGCTTGAGTGGCTGAGGCAGG - Intergenic
990400296 5:55430357-55430379 GCCCCAGGAGTGGCAGCAGCAGG - Intronic
991451441 5:66754992-66755014 TCGAGTGGAGTGGCAGGAGCTGG + Intronic
991463367 5:66883150-66883172 CCTGGTGGATTGGCAGGAGGAGG + Intronic
991593609 5:68279679-68279701 GCTGCTGGAATGACAGGATTTGG - Exonic
991764272 5:69958023-69958045 GGAGCTGGAGTAGCAGCAGCTGG - Intergenic
991783055 5:70160124-70160146 GGAGCTGGAGTAGCAGCAGCTGG + Intergenic
991843504 5:70833095-70833117 GGAGCTGGAGTAGCAGCAGCTGG - Intergenic
991875497 5:71160451-71160473 GGAGCTGGAGTAGCAGCAGCTGG + Intergenic
992361166 5:76039642-76039664 GCTACTCGAGAGGCAGGGGCAGG + Intergenic
992870439 5:81000016-81000038 GGGGCTGGAGTGGCTGGGGCTGG + Intronic
993183471 5:84585472-84585494 GCTGCTGATCTGGCAGGAGGTGG - Intergenic
994362856 5:98874598-98874620 GCTGCTCGAGAGGCTGAAGCAGG + Intronic
994625704 5:102215748-102215770 GCTGCTGGGGAGGCTGAAGCAGG + Intergenic
994843590 5:104956830-104956852 GCTTCTAGAGTGGCAGGATAGGG + Intergenic
994985184 5:106924098-106924120 GCTGCTGGTCTGACAGGAGGTGG - Intergenic
995876138 5:116792264-116792286 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
996324775 5:122259996-122260018 GTTGCAGGAGTGGAAGCAGCAGG - Intergenic
996720765 5:126628126-126628148 GCTGGTGGACTTGCAGCAGCTGG - Intergenic
997303479 5:132823083-132823105 GCTCCTGCAGCGGCAGGAGGAGG - Exonic
997740888 5:136252769-136252791 GCTGCTGATCTGACAGGAGCTGG + Intronic
997845214 5:137279804-137279826 GCTGCTGGATTGGAAGGGCCAGG - Intronic
997882730 5:137604777-137604799 GCTGCTGGAGAGTGCGGAGCTGG - Intergenic
997963710 5:138341230-138341252 GGTGCTGCAGTGGCAGAAGACGG + Exonic
998040170 5:138946528-138946550 GCTGCTGGAGTGATGGGTGCTGG - Intergenic
998103612 5:139454728-139454750 GCTCATGGAGTGGCAGATGCAGG + Intronic
998385900 5:141756977-141756999 GGTGCGGGAGTGTCAGGAGCAGG - Intergenic
999264177 5:150255728-150255750 GCTGCTGAGGAAGCAGGAGCTGG + Intronic
999447560 5:151652265-151652287 GCCGTTGGTGGGGCAGGAGCTGG + Intergenic
999500089 5:152138199-152138221 TCTGATGGAGTGGAAGGGGCAGG - Intergenic
999883907 5:155898787-155898809 GCAGTTGGAGTGGCAAGAGAAGG + Intronic
1000188853 5:158888778-158888800 GTTCCTGGAGTGGCAGAGGCTGG - Intronic
1001476958 5:172057414-172057436 GCTGCAGGAGAGGCACCAGCTGG - Exonic
1001482231 5:172096346-172096368 CCTGCTGGTGTGGGAGGGGCAGG - Intronic
1001865007 5:175096248-175096270 GCTGCGGTGGTGGCAGGAGAGGG + Intergenic
1002106223 5:176880604-176880626 GCTGGGGGAGGGGCAGGGGCAGG - Exonic
1002119303 5:176989546-176989568 GCTACTGGAGAGGCTGGGGCAGG + Intronic
1002123358 5:177022810-177022832 GTTGCTGGAGGGCCAGGAGCCGG + Exonic
1002252608 5:177939059-177939081 GCTGCTGGGGAGCCTGGAGCTGG + Intergenic
1002401726 5:178994875-178994897 GCCGCTGGCGTGGCTGGCGCAGG - Exonic
1002508161 5:179695159-179695181 GCTGCTGGGGAGGCTGGGGCAGG - Intronic
1002560486 5:180078595-180078617 GCTGCTGATGTGACAGGAGGTGG - Intergenic
1002596127 5:180324761-180324783 GCTGCTGGTGTCGCAGGACTCGG - Intronic
1002617934 5:180467161-180467183 GCTGCTGGAGAGGCAGGGTGTGG + Intergenic
1003278022 6:4668894-4668916 GGTTCTGGAGTGGCAGGCACAGG - Intergenic
1003310519 6:4965950-4965972 GCTGCAGGGGTGGCAGAAGGTGG - Intergenic
1003675461 6:8200572-8200594 GCTACTGGAGTTGCAGGTTCAGG + Intergenic
1004196820 6:13512731-13512753 GCTGCTGGAGTGCCTGGACTAGG + Intergenic
1004911100 6:20285040-20285062 ACTGCAGGAGCGGGAGGAGCAGG + Intergenic
1005463658 6:26091543-26091565 GCTGCAGCAGTTGCTGGAGCTGG + Exonic
1005623748 6:27644254-27644276 GCTACTGGAGAGGCTGAAGCAGG + Intergenic
1005873451 6:29994515-29994537 CCTGCTGGAAGGGCAGGAGGGGG - Intergenic
1006183453 6:32167408-32167430 GCGCCTGGAGCGGCTGGAGCAGG + Exonic
1006221429 6:32495365-32495387 GCTGCTGGAGTGCCAGGGCTGGG - Intergenic
1006277104 6:33013819-33013841 CCTGCTGGAGTGGGAGGAGCTGG - Intergenic
1006443881 6:34068226-34068248 GCAGCTGGAGAGGCAGAGGCTGG + Intronic
1006501744 6:34463822-34463844 GCTGCTGGAGTGGGAGTGGGGGG + Intergenic
1006612222 6:35301018-35301040 CCTCCTTGACTGGCAGGAGCTGG + Intronic
1006749319 6:36366689-36366711 GCCGCTGGAGAGCCAGGAGCAGG - Exonic
1006782182 6:36639486-36639508 GCCGGAGGAGTGGCAGGAGGAGG - Intergenic
1006833168 6:36981203-36981225 CCTGCTGGAGTAGCAGGGCCAGG + Intronic
1006875914 6:37296148-37296170 GCTACTGGAGAGGCTGAAGCAGG + Intronic
1007112734 6:39322420-39322442 GCTGCTAGAGAGGCAGGCGGAGG - Exonic
1007367477 6:41405218-41405240 GCTGAAGGAGTGGGAGGGGCAGG + Intergenic
1007629154 6:43263203-43263225 TCAGCTGGGGTGGCAGGGGCTGG - Exonic
1007887927 6:45253679-45253701 GCTACTTGAGAGGCTGGAGCAGG + Intronic
1008880014 6:56372129-56372151 ACTCCTGGAGAGGAAGGAGCCGG + Intronic
1009469151 6:64010295-64010317 GGTGGTGGTGTGGCAGGGGCAGG + Intronic
1010985134 6:82414851-82414873 GCTGCTGGAGGAGCAGCAGTGGG + Intergenic
1011090544 6:83593579-83593601 GCAGCTGCAACGGCAGGAGCAGG + Exonic
1012705653 6:102525571-102525593 GCTGCAAGACTGGCAGAAGCAGG + Intergenic
1013411531 6:109888148-109888170 GCTTCTGGGGTGACTGGAGCAGG + Intergenic
1014783978 6:125597175-125597197 GCTGCTGGGGTGGGAGAAGCTGG - Intergenic
1014894918 6:126890265-126890287 GCTCCTGGAGTAGCAGAACCTGG + Intergenic
1015275045 6:131375521-131375543 ACTGCTGGAGGGCCAGAAGCTGG - Intergenic
1015544937 6:134352161-134352183 GCAGCTGGAGGGCTAGGAGCTGG - Intergenic
1015974034 6:138771407-138771429 GCTGCTTGAGTGGCTGAAGTGGG - Intronic
1015979583 6:138825469-138825491 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1016886800 6:148966846-148966868 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
1017884965 6:158591324-158591346 GTTGCTGATGTGGAAGGAGCAGG + Intronic
1017908356 6:158772096-158772118 GTAGCTGGTGTGGCAGGAGCAGG - Intronic
1017944323 6:159081187-159081209 GCTGCTGGGGTGGCTGAGGCAGG + Intergenic
1017950271 6:159130240-159130262 GCTGATGGTGGGGCAGGGGCAGG - Intergenic
1017987917 6:159460672-159460694 GTGGCTGGAGCTGCAGGAGCAGG - Intergenic
1018117245 6:160599229-160599251 GCTGCTAGAGAGGCTGAAGCAGG + Intronic
1018152334 6:160951925-160951947 ACGGCTGGAGAGACAGGAGCAGG + Intergenic
1018174129 6:161164359-161164381 GGGGATGGAGTTGCAGGAGCTGG - Intronic
1018786743 6:167114241-167114263 GCAGCTTGTGTGGCAGGAGGTGG - Intergenic
1018894343 6:168002967-168002989 GCTGCTGGTCTGACAGGAGGTGG + Intronic
1018980259 6:168596134-168596156 GCTGCTGGAGAGGAATGAACAGG + Intronic
1018980274 6:168596252-168596274 GCTGCTGGAGAGGAATGAACAGG + Intronic
1018980282 6:168596311-168596333 GCTGCTGGAGAGGAATGAACAGG + Intronic
1018980290 6:168596370-168596392 GCTGCTGGAGAGGAATGAACAGG + Intronic
1018980307 6:168596489-168596511 GCTGCTGGAGAGGAATGAACAGG + Intronic
1019169447 6:170123970-170123992 GCTGCTGTGGTGCCAGCAGCAGG - Intergenic
1019291324 7:251952-251974 GCGGCTGGAGTGGCAGCAGTGGG - Intronic
1019294670 7:267389-267411 GGTCCTGGGGAGGCAGGAGCAGG - Intergenic
1019417455 7:934081-934103 GGTGCTGGAGAGCCGGGAGCCGG + Intronic
1019417526 7:934291-934313 GGTGCTGGAGAGCCGGGAGCCGG + Intronic
1019448292 7:1082715-1082737 GATGGGGCAGTGGCAGGAGCTGG - Intronic
1019463525 7:1173930-1173952 GCTACTGATGTGGCAGGAGGAGG - Intergenic
1019530095 7:1498998-1499020 GCTGCTGGCGGTGCAGAAGCTGG - Exonic
1019568627 7:1697365-1697387 GCTGCTGGAGGGGCCTGTGCAGG + Intronic
1019641339 7:2105397-2105419 TCTGCTGGCCTGGCAGCAGCAGG + Intronic
1019659671 7:2217119-2217141 GCTGCTAGAGTGGCAGAAGTGGG - Intronic
1019682407 7:2358636-2358658 GCTACTGGAGAGGCTGGGGCAGG - Intronic
1019709506 7:2511811-2511833 GCTGCGGCAGGGGCAGGGGCTGG - Intergenic
1020039853 7:4993644-4993666 GCTGCTGGTGTGGCAGCAGGAGG + Intronic
1020119626 7:5495755-5495777 GACGCTGCAGTGGAAGGAGCAGG - Intronic
1021206422 7:17786627-17786649 CCTGCTGGAAGGGCAGGAGGGGG + Intergenic
1021610644 7:22454673-22454695 GCTGCAGGTGCTGCAGGAGCTGG + Intronic
1022094551 7:27130562-27130584 GCTGCTGCAGCGGCAGGTGCTGG + Exonic
1022727520 7:32994578-32994600 GCTGCTGGTGTGGGTGGAGTGGG - Intronic
1022857751 7:34332231-34332253 ACTGCTGAAGTTGCAGGTGCAGG - Intergenic
1022970936 7:35516594-35516616 CCTGCTGGACTGCCTGGAGCTGG - Intergenic
1023191274 7:37585606-37585628 GCTGGTGTTGTGACAGGAGCAGG + Intergenic
1023254827 7:38302465-38302487 GCTGCTGGAGTTGCAGGGTCTGG - Intergenic
1023425936 7:40036050-40036072 GCTGCTGGGGTGGCTGAGGCAGG + Intronic
1023522220 7:41060022-41060044 GCTTCAGGTGTGGCAGGAGAAGG + Intergenic
1023780104 7:43647470-43647492 TCTGATGGAGGAGCAGGAGCAGG + Intronic
1023920925 7:44629322-44629344 CCTGAGGGAGTGGAAGGAGCTGG + Intronic
1024075609 7:45816453-45816475 GCTGCTGGGGCAGCATGAGCAGG - Intergenic
1024294723 7:47833043-47833065 TCTGCTGGACTGGCAGGAAGGGG + Intronic
1024520377 7:50300596-50300618 GCTGCTGGGGGTGAAGGAGCAGG - Intergenic
1024766262 7:52664479-52664501 GTGGCTGGAGTGGCTGGAGCAGG - Intergenic
1025046066 7:55693071-55693093 GCTGCTGGTGTGGGTGGAGTGGG + Intergenic
1025051844 7:55739343-55739365 GCTGCTGGGGAAGCATGAGCAGG + Intergenic
1025057770 7:55778972-55778994 GCTGTTGTAGTGGCTGGGGCTGG - Intergenic
1025258288 7:57399841-57399863 GCTGCAGGAGCCGCAGGAGCTGG + Intergenic
1025610347 7:63071889-63071911 GCTGCAGGAGCTGCAGGAGCTGG - Intergenic
1025651401 7:63472870-63472892 GCTGTTGCAGTGGCTGGAGCTGG + Intergenic
1025828597 7:65031111-65031133 GCTGTTGCAGTGGCTGGGGCTGG + Intergenic
1025916125 7:65867523-65867545 GCTGTTGCAGTGGCTGGGGCTGG + Intergenic
1026217005 7:68358474-68358496 GCTGCTGGGGTGGCAGATGAGGG + Intergenic
1026740000 7:72973170-72973192 GCTACTGGAGAGGCTGAAGCGGG + Intergenic
1026797264 7:73374325-73374347 GCTGCTGGAGAGGCTGAAGCGGG + Intergenic
1026806809 7:73434034-73434056 GCTGCTGCTGTGGCAGCTGCTGG + Exonic
1027103733 7:75391900-75391922 GCTACTGGAGAGGCTGAAGCGGG - Intergenic
1027232990 7:76282764-76282786 GCGGCTGGAGCTCCAGGAGCGGG - Exonic
1027549246 7:79570522-79570544 GCTACTGGAGTGGAAGGTGGTGG - Intergenic
1028177411 7:87674333-87674355 GCTGCTATCATGGCAGGAGCAGG + Intronic
1029379755 7:100205295-100205317 GCTGAGGGAGTGGCAGTAGGTGG - Exonic
1029537012 7:101163034-101163056 GCTGCAGGAGCAGGAGGAGCTGG - Exonic
1030216015 7:107044652-107044674 GCGGCTGGAGCGGGAGGAGCAGG + Exonic
1030532745 7:110730634-110730656 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
1030624569 7:111830643-111830665 GCTGGTGGAGAGGGAGAAGCTGG - Intronic
1031069411 7:117145093-117145115 GCTGCTTGAGAGGCTGAAGCAGG + Intronic
1031596870 7:123658973-123658995 GATGCTGCAGGGGCAGGAGTTGG - Intronic
1031711530 7:125052959-125052981 GCTGCTGGGGAGGCAGAGGCAGG - Intergenic
1032151592 7:129434308-129434330 GCTGCTCGACCGGCCGGAGCGGG - Intronic
1032159880 7:129502297-129502319 GCTGCCGGAGCGGCGGGCGCGGG - Intergenic
1032197239 7:129796484-129796506 GTGGCTGGAGTGGGAGGGGCTGG - Intergenic
1032293549 7:130613264-130613286 GCTGCTGGTCTGGCAGGAGGCGG + Intronic
1032531388 7:132623553-132623575 GCTGCTATGGTGGAAGGAGCTGG - Intronic
1032564587 7:132928583-132928605 GCTACTGGAGAGGCTGAAGCAGG + Intronic
1032939537 7:136772874-136772896 GCTACTGGAGAGGCTGAAGCAGG - Intergenic
1033109583 7:138562487-138562509 GCTTCTGTACTGGCAGGAGTGGG + Intronic
1033119356 7:138653226-138653248 GCTGCTGGAGAAGCTGCAGCAGG + Intronic
1033164358 7:139026755-139026777 GCAGCTGGAGCTGCAGAAGCTGG - Exonic
1033659194 7:143392052-143392074 CCTGCTGGAGTGGCCGGTTCTGG + Intronic
1033754227 7:144384722-144384744 GCTGCTGGGGTGGGGGTAGCTGG + Intergenic
1033818282 7:145102187-145102209 GCTGCTCGGGTGGCTGAAGCAGG - Intergenic
1034778656 7:153856153-153856175 GCCACTGGAGTGGCAGGAACAGG - Intergenic
1034966108 7:155392142-155392164 GCTGGTGAGGTGGCAGGAGAAGG - Intronic
1035168042 7:157003209-157003231 CCTGCTGGAGGCGCAGGGGCCGG + Intronic
1036033388 8:4994717-4994739 GCTGCGGGAGGGGGAGAAGCGGG + Exonic
1036078009 8:5522588-5522610 GCTGCTGCAGAAGCTGGAGCTGG - Intergenic
1036226261 8:6960259-6960281 GATGCTGCAGTGACAGGAGGTGG + Intergenic
1036466557 8:9003114-9003136 GCTGCTGGAGTCGCCGCGGCCGG + Exonic
1036551833 8:9822884-9822906 GCTACTGGAGAGGCTGAAGCAGG - Intergenic
1036784137 8:11674404-11674426 GCTACTGGAGAGGCTGAAGCAGG + Intergenic
1036837663 8:12088905-12088927 GCTGCTGGAGTGCCAGGGCTGGG + Intergenic
1036859456 8:12335153-12335175 GCTGCTGGAGTGCCAGGGCTGGG + Intergenic
1036926013 8:12906535-12906557 GCTATTGGAGTGGCTGAAGCAGG + Intergenic
1037751812 8:21687130-21687152 GCTGCTGGAGACGGAGGAGAAGG + Intergenic
1038286327 8:26209304-26209326 GCTACTGGAGAGGCTGAAGCAGG - Intergenic
1039070716 8:33647176-33647198 GCTGCTGGTCTGACAGGAGGCGG + Intergenic
1039550347 8:38438958-38438980 CCTGCTGGACTCGCAGGGGCAGG - Intronic
1039850386 8:41359667-41359689 GCTACTGGAGAGGCTGAAGCAGG - Intergenic
1041162994 8:55063657-55063679 GCAGGTGGAGGGGCAGGACCAGG + Intergenic
1041368104 8:57130662-57130684 GCTGAGGGAGGGGAAGGAGCAGG - Intergenic
1041491479 8:58438065-58438087 GCGGCTGGAGATGCAGCAGCTGG - Intronic
1041706681 8:60853520-60853542 GCTGCTGCAGGGTCAGGAGAGGG - Intronic
1042144471 8:65713793-65713815 GCTACTGGAGAGGCAGAGGCAGG - Intronic
1042316800 8:67434709-67434731 GCTGCAGCAGTGGCAGCAGCAGG + Intronic
1042539949 8:69898008-69898030 GCTGCTCAAGAGGCTGGAGCAGG + Intergenic
1042829260 8:73009015-73009037 ACTGCTCGAGTGCCAGGTGCAGG + Exonic
1042928466 8:73990507-73990529 GCTGCTGGTCTGACAGGAGCTGG - Intergenic
1043414671 8:80034388-80034410 TCTGCAGAAGTGGCAGGGGCCGG - Intronic
1043863046 8:85343527-85343549 GCTCATGGAGTGACAGGAGCAGG + Intronic
1043982422 8:86657724-86657746 GCTGCAGGAGCTGCAGGAGCTGG - Intronic
1044989146 8:97779937-97779959 GCTGCTGGGGAGGCAGAGGCAGG + Intronic
1044995975 8:97838563-97838585 GCTAGTCGAGTGGCAGGAGGGGG + Intronic
1045057585 8:98382729-98382751 GCCGCTGGAGTGGACGGTGCAGG - Intergenic
1045136233 8:99221818-99221840 GCTGCTGGGGAGGCTGGGGCAGG - Intronic
1045319736 8:101073135-101073157 GCTACTGGAGAGGCTGAAGCAGG - Intergenic
1045484685 8:102621904-102621926 GCTGCAGGAGTGGCAGAAGCTGG - Intergenic
1045487813 8:102645930-102645952 GCTGCTGCAGTGGACCGAGCAGG - Intergenic
1047132768 8:122039544-122039566 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
1047408515 8:124605259-124605281 GCTGCTTCGCTGGCAGGAGCTGG - Intronic
1047807236 8:128373210-128373232 GCTGCTGGAGATGCAGGTGCTGG + Intergenic
1048179198 8:132179972-132179994 GCTGGGGTAGGGGCAGGAGCAGG - Intronic
1048697957 8:137049782-137049804 GCTGCTGGAGCTGCTGGAGCTGG - Intergenic
1048966044 8:139615351-139615373 GCTGATTGAGTGGTAGGAGTTGG + Intronic
1049010038 8:139881200-139881222 ACTCCAGGAGTGGCAGCAGCTGG + Intronic
1049018786 8:139939852-139939874 GCTGGTGCAGAGGCAGGTGCAGG + Intronic
1049168148 8:141139798-141139820 GCTGCTGGGAAGGCAGGAGCAGG - Intronic
1049595550 8:143481698-143481720 GGAGCTGGATTGGCAGCAGCCGG - Intronic
1049608158 8:143539260-143539282 GCTGCTGGGGTACCAGGGGCCGG + Exonic
1049612509 8:143562068-143562090 GCTGCTGGAGGGCCTGGAGGGGG + Exonic
1049655334 8:143794636-143794658 GCAGCTGGAGGGGCGGGTGCTGG - Intronic
1049740856 8:144240208-144240230 GGTGCTGGGGTGGCAGAGGCTGG + Intronic
1050258796 9:3819525-3819547 GATGTTGGTGTGGCAGGAGAAGG - Intergenic
1050848568 9:10255997-10256019 GCTGCTGAACTGACAGGAGGTGG - Intronic
1051551095 9:18330336-18330358 GATGCAAGAGTGGCAGGATCAGG - Intergenic
1051792515 9:20823053-20823075 GCTGCTGGAGTAGCTTGATCAGG - Exonic
1052051969 9:23859225-23859247 GATGCAGGATTGGCAGGAGGTGG + Intergenic
1053418349 9:37960971-37960993 GCTGCTGGTCTGGCAGGAGCTGG + Intronic
1054089686 9:60833798-60833820 CATGCTGGAGTGGCAGAGGCGGG + Intergenic
1054799809 9:69335870-69335892 GCTACTGGAGAGGCAGAGGCGGG + Intronic
1055093931 9:72390698-72390720 GCTACTGGAGTGGCTGAGGCAGG + Intergenic
1055247505 9:74264644-74264666 GCTGCTGATCTGGCAGGAGGTGG + Intergenic
1055429659 9:76230676-76230698 GCTGCTGATGTGACAGGAGATGG - Intronic
1055577149 9:77671614-77671636 GGAGCTGGAGTGGAATGAGCAGG - Intergenic
1055699417 9:78926577-78926599 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
1056189187 9:84167905-84167927 GCTGCTGATCTGGCAGGAGGTGG - Intergenic
1056556921 9:87697282-87697304 GCAGCAGCAGTGGCAGGAGCAGG - Intronic
1057397273 9:94691295-94691317 CATGCTGCAGAGGCAGGAGCAGG - Intergenic
1058896018 9:109401339-109401361 GCTACTGGATTGGCAGCACCAGG - Intronic
1059038791 9:110789665-110789687 GCTGCTTGAGAGGCTGAAGCAGG + Intronic
1059310865 9:113388305-113388327 GCTGCTGCAGTGGCTGAAGGAGG - Exonic
1060196281 9:121625631-121625653 GCTGATGGGATGGCAGGATCAGG + Intronic
1060219028 9:121754747-121754769 GCTCCTGGGGTTGCAGGACCAGG + Intronic
1060945823 9:127568978-127569000 GCGGCGGGAGCGGCGGGAGCGGG - Exonic
1060975282 9:127761627-127761649 GCTGCTGGAGAGCCAGAGGCTGG - Exonic
1061042917 9:128150073-128150095 ACTGGTGAAGGGGCAGGAGCAGG - Intronic
1061062455 9:128257498-128257520 GCTGCTGGAGCTGCAGGAGCTGG - Exonic
1061133866 9:128722551-128722573 GCTGCGGCAATGGGAGGAGCAGG - Exonic
1061199658 9:129129946-129129968 GCTGCTTGGGTGGCTGAAGCAGG + Intronic
1061203680 9:129151073-129151095 GCCGCTGGGGTGCCAGCAGCAGG - Intergenic
1061263779 9:129494204-129494226 GCAGCTGGGGTGGCCAGAGCTGG - Intergenic
1061582298 9:131545625-131545647 GGAGCTGGAGGGGCAGGTGCCGG + Intergenic
1061582303 9:131545640-131545662 GGTGCCGGAGGGGCAGGTGCTGG + Intergenic
1061582336 9:131545745-131545767 GGTGCTGGCGGGGCAGGTGCTGG + Intergenic
1061582357 9:131545815-131545837 GCTGCTGGAGGGGCAGGTGCTGG + Intergenic
1061700483 9:132411286-132411308 GGTGCGGGAGTGGAAGGCGCAGG + Intronic
1061970391 9:134041759-134041781 GCTGGCGGAGCTGCAGGAGCAGG - Exonic
1061976631 9:134071359-134071381 GCTGCTGATCTGACAGGAGCCGG + Intergenic
1062033103 9:134370960-134370982 CCTGAGGGAGTGGCAGGAGCCGG + Intronic
1062096354 9:134705971-134705993 GCTGCTGTGATGGCAGGTGCAGG - Intronic
1062192045 9:135253129-135253151 GCTCCTGGAGCTGGAGGAGCAGG + Intergenic
1062262613 9:135670464-135670486 ACTGCTGGTGTGGACGGAGCTGG + Intergenic
1062290834 9:135793659-135793681 GCTGCTGGAGGGGCCGGCCCTGG + Intergenic
1062460095 9:136659401-136659423 GCTGCAGGAGGTGCAGGAGGAGG - Exonic
1062601364 9:137320008-137320030 GGTGCAGGGCTGGCAGGAGCGGG - Intronic
1203779984 EBV:95941-95963 GGAGCGGGAGGGGCAGGAGCAGG + Intergenic
1203779989 EBV:95956-95978 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203779995 EBV:95974-95996 GCAGGAGGAGGGGCAGGAGCAGG + Intergenic
1203780013 EBV:96019-96041 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780019 EBV:96037-96059 GCAGGAGGAGGGGCAGGAGCAGG + Intergenic
1203780033 EBV:96073-96095 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780039 EBV:96091-96113 GCAGGAGGAGGGGCAGGAGCAGG + Intergenic
1203780049 EBV:96118-96140 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780063 EBV:96154-96176 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780069 EBV:96172-96194 GCAGGAGGAGGGGCAGGAGCAGG + Intergenic
1203780079 EBV:96199-96221 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780093 EBV:96235-96257 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780099 EBV:96253-96275 GCAGGAGGAGGGGCAGGAGCAGG + Intergenic
1203780112 EBV:96286-96308 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780117 EBV:96301-96323 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780131 EBV:96337-96359 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780136 EBV:96352-96374 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780141 EBV:96367-96389 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780146 EBV:96382-96404 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780155 EBV:96406-96428 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780164 EBV:96430-96452 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780173 EBV:96454-96476 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780183 EBV:96481-96503 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780193 EBV:96508-96530 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780202 EBV:96532-96554 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780211 EBV:96556-96578 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780220 EBV:96580-96602 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780226 EBV:96598-96620 GCAGGAGGAGGGGCAGGAGCAGG + Intergenic
1203780231 EBV:96613-96635 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203626832 Un_KI270750v1:33018-33040 GCGGCTGGAGAGGTAGGAGAAGG - Intergenic
1185932559 X:4219245-4219267 ACTGATGGAGTGCCAGGAGCTGG - Intergenic
1186191007 X:7067613-7067635 GCAGCTGTAGTGGCAGGAGATGG + Intronic
1187087178 X:16052498-16052520 GCTGCTTGGGAGGCTGGAGCAGG + Intergenic
1187285503 X:17899728-17899750 GCTGCTGCAGTGGCAGTAGGCGG - Intergenic
1188282399 X:28286333-28286355 GCTGCTTGAGAGGCAGAGGCAGG + Intergenic
1188356623 X:29199661-29199683 GCTGCTGATGTGACAGGAGGCGG + Intronic
1188898196 X:35695627-35695649 GCTACTGGGGAGGCAGGGGCAGG + Intergenic
1189235499 X:39483938-39483960 GCTGATGTGGTGGCTGGAGCTGG - Intergenic
1190259867 X:48790990-48791012 GGTGATGGAGTGGGAGGAGGGGG + Intronic
1190299624 X:49049392-49049414 GCTGCTGCTGTGACAGAAGCTGG + Intergenic
1190621423 X:52290296-52290318 CCTGCTTGAGTGCCAGGAGCAGG + Intergenic
1190733046 X:53236976-53236998 GCTCCTGGAAGGGCAGGAGCAGG + Intronic
1190747490 X:53333256-53333278 GCTACTCGAGTGGCCGGGGCAGG - Intergenic
1192778456 X:74269267-74269289 GCTGCTTGAGAGGCTGAAGCAGG + Intergenic
1193620695 X:83749975-83749997 ACTGCTCGAGTGCCAGGTGCAGG - Intergenic
1196236222 X:113283857-113283879 GCTGTTGTAGTGGCAGGTGTGGG + Intergenic
1196283951 X:113857911-113857933 CCTGTTGGAGTGGCAGGGGGAGG - Intergenic
1197821026 X:130540989-130541011 GCGGGGGGAGTGTCAGGAGCTGG + Intergenic
1197992634 X:132334451-132334473 CCTGCTCAAATGGCAGGAGCTGG + Intergenic
1198022282 X:132670897-132670919 GCTGCTGGAGTGGATGGCTCTGG + Intronic
1198259575 X:134953763-134953785 CCTGCTGGGGTGGCAGGGGGAGG + Intergenic
1198480221 X:137033922-137033944 GCTGCGGGCGCGGCAGGAGCGGG + Intergenic
1199419102 X:147622491-147622513 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
1199792943 X:151171921-151171943 GCTGCTGGGATGGGAGGAGCAGG + Intergenic
1200000145 X:153056120-153056142 CGTGCGGGAGGGGCAGGAGCCGG + Intergenic
1200062382 X:153489314-153489336 GCTGAAGGAGGGGCAGGTGCAGG - Intronic
1200137537 X:153882338-153882360 GCTGCTGCAGTGGCTGGATGGGG - Intronic
1200380242 X:155829637-155829659 GCAGCAGCAGTGGCAGCAGCAGG - Intergenic
1201063480 Y:10068866-10068888 CCTCGTGGAGTGGCAGGAGGAGG - Intergenic
1201707746 Y:16955293-16955315 GCTGCTGGGGTGGCAGGTACTGG - Intergenic
1201713564 Y:17018388-17018410 ACTGATGGAATGTCAGGAGCTGG - Intergenic
1202372795 Y:24209850-24209872 CCTGCTGGAGCTGCAGGGGCAGG - Intergenic
1202497987 Y:25460270-25460292 CCTGCTGGAGCTGCAGGGGCAGG + Intergenic