ID: 1078145019

View in Genome Browser
Species Human (GRCh38)
Location 11:8716523-8716545
Sequence ATTTGCTGAGGAGTGAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 401}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078145019_1078145031 27 Left 1078145019 11:8716523-8716545 CCTCTCCTCACTCCTCAGCAAAT 0: 1
1: 0
2: 1
3: 29
4: 401
Right 1078145031 11:8716573-8716595 CTGTTCTCACCCAATCAATCTGG 0: 1
1: 0
2: 0
3: 15
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078145019 Original CRISPR ATTTGCTGAGGAGTGAGGAG AGG (reversed) Intronic
900920138 1:5664815-5664837 AGTTTCTGAGGTCTGAGGAGAGG - Intergenic
902412030 1:16217431-16217453 AGGTGCTGAGGAGGGAGGGGCGG - Intergenic
904306389 1:29592853-29592875 GTATGTTGAGGGGTGAGGAGTGG + Intergenic
905092586 1:35441255-35441277 CCTGGCTGAGAAGTGAGGAGAGG - Intronic
905145599 1:35884574-35884596 AGTTTCTGGGGAGTGGGGAGAGG - Intronic
905479243 1:38249893-38249915 ATTCACTAAGGAGGGAGGAGAGG + Intergenic
905791275 1:40791070-40791092 ATTTGCTCAGGAGAGAGTGGGGG - Intronic
906852473 1:49266676-49266698 TTTTGCTGAGGAATAAGGACTGG + Intronic
906952364 1:50345201-50345223 ATTTGTTGCAGGGTGAGGAGAGG + Intergenic
907409127 1:54272522-54272544 ATTTGCTGAGAAGGTAGGTGGGG + Intronic
907456041 1:54576116-54576138 ATTGGCCGAGGAGTGAGGGGTGG + Intronic
909095214 1:71277846-71277868 ATATTCAGAGGAGTGAGGATAGG + Intergenic
910425271 1:87114986-87115008 ATGTGCTGGGGAGTGAGTACAGG + Intronic
910747591 1:90590696-90590718 ATTGTCTGAGGGGTGAGCAGAGG - Intergenic
911821568 1:102430338-102430360 ATTTGTTGTGGGGTGGGGAGAGG + Intergenic
911980043 1:104555899-104555921 ACTGGCTGAGGAGGAAGGAGAGG - Intergenic
912745601 1:112243211-112243233 TTTTGCTGGGGAGTGGGCAGGGG - Intergenic
913355087 1:117912177-117912199 ATTTGTTGAAGAGGGAGGAAAGG - Intronic
913966335 1:143380441-143380463 GTTTGCTAGGCAGTGAGGAGGGG + Intergenic
914060709 1:144206048-144206070 GTTTGCTAGGCAGTGAGGAGGGG + Intergenic
914118441 1:144760321-144760343 GTTTGCTAGGCAGTGAGGAGGGG - Intergenic
914825027 1:151133672-151133694 GTATGCTGAGGAGTCAGGAGAGG - Intronic
915135493 1:153728476-153728498 TTTTGGAGAGGAGGGAGGAGTGG + Exonic
916054598 1:161059666-161059688 ATTTGTGGAGGAGTATGGAGTGG - Exonic
916124013 1:161553211-161553233 ATTGGCTGAGGGGTGATGAAGGG + Intergenic
916133896 1:161634573-161634595 ATTGGCTGAGGGGTGATGAAGGG + Intronic
916525042 1:165601775-165601797 ATTTGATGAGAAGTGATAAGTGG + Intergenic
917214333 1:172662619-172662641 ATGTGCTGTGGAGTGGGGTGGGG + Intronic
918055139 1:181014645-181014667 AGTTGGAGAAGAGTGAGGAGTGG - Intronic
918221843 1:182442551-182442573 ATTTCCTGAGCAGTGTGCAGAGG + Intergenic
919707027 1:200687059-200687081 AGTTGCTTAGGACTGAGTAGGGG + Intergenic
922210858 1:223485369-223485391 AGTTACTGAGGAGGAAGGAGAGG + Intergenic
922212292 1:223495516-223495538 AATGGGTGAGGAGGGAGGAGTGG - Intergenic
923321989 1:232843488-232843510 GTTTGCTGAAGAGTGAAGAAAGG + Intergenic
923813281 1:237344537-237344559 ATTTGCAGAGAAGCGAGGGGTGG - Intronic
924280797 1:242435024-242435046 AAGGGCTGGGGAGTGAGGAGGGG - Intronic
924323634 1:242873714-242873736 ATTTGCTAGGCAGTGAGGACTGG - Intergenic
924475846 1:244381176-244381198 AGTTGCTGGGGGCTGAGGAGGGG + Intronic
1062966640 10:1612200-1612222 TTTTTCTGAGTTGTGAGGAGGGG + Intronic
1063216750 10:3932262-3932284 ATTTGGTGGGGAGAGAGGTGTGG + Intergenic
1063244601 10:4205249-4205271 TGTTGCTGAGGAGAGAGGAGTGG - Intergenic
1064392154 10:14951284-14951306 ACTTGCTGAGGTGGGAGGATTGG + Intronic
1065955710 10:30691975-30691997 ATTCGCTGAAAAGTGAGGCGGGG + Intergenic
1066233065 10:33456438-33456460 ATTAGCTGAAAGGTGAGGAGGGG + Intergenic
1066640621 10:37551131-37551153 ACGTGCAGAGGAGTGAGGCGAGG + Intergenic
1066981670 10:42422386-42422408 AGTTGGAGAGGAGTGGGGAGTGG - Intergenic
1068050199 10:51940670-51940692 TGTTTCTGAGGAGTGAGGGGAGG + Intronic
1068582067 10:58753048-58753070 ATTTGCAGAGGAAGGAAGAGTGG - Intronic
1068762811 10:60732422-60732444 ATCTGCTGAGGGGTGTGGGGTGG + Intronic
1070116757 10:73536226-73536248 ATGGGGTGAGGAGAGAGGAGAGG + Intronic
1070599656 10:77856841-77856863 ACTTGCTGGTCAGTGAGGAGGGG + Exonic
1071515930 10:86297439-86297461 ATTTTCTGATGTGTGAGGAAAGG - Intronic
1071755159 10:88529151-88529173 ATCTGTAGAGGACTGAGGAGTGG - Intronic
1072701640 10:97646090-97646112 ATTTACTTAGGAGTGGAGAGTGG + Intronic
1073670534 10:105582699-105582721 ATCTGATGAGGGGTGAAGAGGGG + Intergenic
1074115899 10:110457430-110457452 AAATGGTGAGGGGTGAGGAGAGG + Intergenic
1075688562 10:124380212-124380234 AGGAGCTGAGGAGTCAGGAGAGG - Intergenic
1076896091 10:133312981-133313003 ATTTGCTGAGGAACAAGGATGGG - Exonic
1077194894 11:1274561-1274583 ATCTGCAGAGGGGAGAGGAGAGG + Exonic
1077464667 11:2728045-2728067 AGTGGCTGGGGAGGGAGGAGGGG - Intronic
1078145019 11:8716523-8716545 ATTTGCTGAGGAGTGAGGAGAGG - Intronic
1079062917 11:17265261-17265283 ATTTGCTGTGGACAGAGAAGAGG + Intronic
1080256764 11:30298642-30298664 ATTTGCTGAGGAGTGTTTAATGG - Intergenic
1080664578 11:34324552-34324574 ATTTCCTGAAGAGGCAGGAGTGG - Intronic
1080964579 11:37199447-37199469 ATTTGCTGATTAGTGAGATGTGG - Intergenic
1082167168 11:48963201-48963223 ATGTACTGAGAGGTGAGGAGGGG + Intergenic
1082793444 11:57363484-57363506 AGTTGCTCAGGAGTCAGGAGAGG - Intronic
1083290758 11:61688762-61688784 ATGTGTTGAGGGGTGAGGGGAGG - Intronic
1085024109 11:73226615-73226637 ATTTGCCTAGGATGGAGGAGTGG - Intronic
1085281926 11:75336573-75336595 ATTTGCCCAGGAGTGAGCTGAGG + Intronic
1085471518 11:76761428-76761450 GCTTGCTGAGGTGTCAGGAGGGG + Intergenic
1086434432 11:86767357-86767379 ATTTGATCAAGAATGAGGAGAGG + Intergenic
1087581200 11:100056735-100056757 GTTTTCTGGGGAGTGAGGGGAGG + Intronic
1087692274 11:101335339-101335361 ACTTGCTTAGAAGTGAAGAGGGG + Intergenic
1088230404 11:107668391-107668413 AATTGAAGGGGAGTGAGGAGGGG + Intergenic
1089261671 11:117227981-117228003 CTTTTCTGAGGAGTAAGGAGTGG - Intronic
1089529611 11:119118018-119118040 ATTTGGTGAGTAGTGTGGACAGG - Exonic
1090014459 11:123073669-123073691 ATTTGCTGTGGAGCGAGTGGAGG + Exonic
1090418948 11:126560567-126560589 ATGTAGTGAGGAGGGAGGAGTGG + Intronic
1090662026 11:128889729-128889751 ATCTGCTGAGCCCTGAGGAGGGG - Intergenic
1090768069 11:129894672-129894694 ATGTGCTGAAGGGTGATGAGGGG - Intronic
1090782108 11:130016417-130016439 ATTGCCTGGGGAGTGAAGAGAGG + Intergenic
1091016063 11:132051726-132051748 GTTAGATGAGCAGTGAGGAGTGG - Intronic
1091057813 11:132435375-132435397 ATTTGCTGAGGTTTGATTAGAGG - Intronic
1093951189 12:25166051-25166073 AGTTGCTAAGGAGGGAGTAGAGG - Intronic
1094276216 12:28678500-28678522 GATTGCTGAATAGTGAGGAGGGG - Intergenic
1095135285 12:38593824-38593846 CTTGGGTAAGGAGTGAGGAGAGG - Intergenic
1096086912 12:48871529-48871551 TATTGCTTAGGACTGAGGAGTGG - Intergenic
1096560105 12:52430002-52430024 GATTGCTGAGGAGTGGGGAGAGG - Intronic
1096608841 12:52787929-52787951 ATTTACTGAGGTGAGTGGAGGGG - Intergenic
1096693597 12:53335482-53335504 TTCTGATGAGGAGAGAGGAGTGG - Intronic
1097269824 12:57767133-57767155 ATTGGCTGAGGAGCTTGGAGAGG - Exonic
1097913460 12:64995195-64995217 ATTTGGTGGGGAGGGAGGAGAGG + Intergenic
1098054829 12:66493888-66493910 CTTTCCTCAGGAGAGAGGAGAGG - Intronic
1098261815 12:68679319-68679341 TTTTGGTGAGGAGTGAGGGAGGG + Intergenic
1098653713 12:73004822-73004844 AGTTGCCGAGGAGGGAGTAGAGG + Intergenic
1099888822 12:88564340-88564362 CTTTGCTGAGGAATCAGAAGGGG + Intronic
1100090624 12:90965022-90965044 AGTTGCTGGGGTGGGAGGAGGGG - Intronic
1100092891 12:90993117-90993139 ATTAGCTTAGGAGTGAGAAAAGG - Intronic
1100146272 12:91681657-91681679 ATTGGCTGAAGAGTGGGGAATGG - Intergenic
1101199975 12:102425437-102425459 AGTTGCTGAGTAGTGAGGGTGGG - Intronic
1101447288 12:104746348-104746370 ATTTGCTGAGCAATGAGAAAGGG - Intronic
1101963300 12:109265653-109265675 CTTTGCTGGGGAGCGGGGAGGGG - Intronic
1101995398 12:109521900-109521922 CTTTCCTGAGGCATGAGGAGTGG + Intronic
1102212528 12:111137827-111137849 ATTTGCTTAGGGGTGAGCATGGG + Intronic
1102407894 12:112689985-112690007 CTTTTCTGAAAAGTGAGGAGGGG + Intronic
1102593260 12:113973434-113973456 ATAGGCTGATGAGTGAGGGGTGG - Intergenic
1102774359 12:115505842-115505864 ATTTACTGAGGACTGACAAGGGG + Intergenic
1103830237 12:123773435-123773457 ACTTGCTGGGGAGTGAAGACAGG + Intronic
1104605063 12:130182054-130182076 GTTTGCCTAGGACTGAGGAGGGG - Intergenic
1105452901 13:20516425-20516447 ATGTGCTGAGGCTTGAAGAGGGG - Intronic
1105568532 13:21576659-21576681 ATTTGCTGAGGACTGGGGTATGG - Intronic
1106000994 13:25723193-25723215 AATTGCTTAGTAGTGGGGAGTGG + Intronic
1110270585 13:73585159-73585181 ATTTGCTGAGAGATTAGGAGTGG + Intergenic
1111361986 13:87189226-87189248 AGTTGCTAAGGAGGGAGTAGAGG + Intergenic
1112544832 13:100357024-100357046 AGTTGCTTAGGGCTGAGGAGGGG + Intronic
1114201836 14:20528310-20528332 AGGTGCTGATGAGTTAGGAGAGG - Intergenic
1114385918 14:22254396-22254418 ATTTTCTTAGGGGTGAGGATGGG + Intergenic
1114560886 14:23589637-23589659 ATGGGCTAAGGAGGGAGGAGGGG - Intergenic
1115117303 14:29896441-29896463 ATTTGCTTAGGTGATAGGAGAGG + Intronic
1117467321 14:56006411-56006433 AGACACTGAGGAGTGAGGAGAGG - Intergenic
1117772151 14:59144690-59144712 CTTTGCAGTGGAGTGAGGAATGG + Intergenic
1117848885 14:59946653-59946675 CTGTGGTGAGGAGTGGGGAGGGG - Intronic
1118399169 14:65363757-65363779 GTTTGATGAAGAGTGGGGAGTGG - Intergenic
1118634245 14:67733204-67733226 ATTTGCTTTGGAATGAGCAGGGG - Intronic
1119416107 14:74470549-74470571 ATTTGCTCAGGAAGGAAGAGTGG + Intergenic
1119835023 14:77741477-77741499 TTTTTCTCAGGAGTGAGAAGAGG + Intronic
1120540253 14:85742256-85742278 ATTTGAGGAGGAGTGGGGAGGGG + Intergenic
1121171119 14:91855193-91855215 ATTTCCTGAGGATTTGGGAGTGG - Intronic
1121795026 14:96727681-96727703 GTGTGCAGTGGAGTGAGGAGGGG + Intergenic
1121972255 14:98369052-98369074 CTGTTCTGAGGACTGAGGAGTGG + Intergenic
1122390559 14:101379118-101379140 CTTTGCAGATTAGTGAGGAGGGG + Intergenic
1125284118 15:38073564-38073586 TTTTTCCCAGGAGTGAGGAGGGG - Intergenic
1125629343 15:41134417-41134439 AGTCGCTGAGGAGGGAGTAGAGG - Intergenic
1125722299 15:41851146-41851168 ACTTTCTGAGGAGAGATGAGAGG + Exonic
1126461007 15:48914560-48914582 ATTTGGTAAGGAGTGTGTAGTGG - Intronic
1126970082 15:54100863-54100885 ATGGGCTGGGGAGTGAGAAGAGG - Intronic
1128112602 15:65086013-65086035 ATTTGCTGTGGGGTCAGGTGGGG + Intergenic
1128332298 15:66763611-66763633 ATAAGCTGGGGAGTGTGGAGTGG - Intronic
1128688294 15:69703554-69703576 ATCTGCTGAGGTGTGAGGGAAGG - Intergenic
1129248787 15:74296774-74296796 ATTTGCTGAGGAGTCAGTGCTGG + Intronic
1129460512 15:75698076-75698098 CTGTGCACAGGAGTGAGGAGGGG + Intronic
1129651106 15:77490485-77490507 AATTGCTGAGGAGTGGGATGTGG + Intergenic
1129724351 15:77893960-77893982 CTGTGCACAGGAGTGAGGAGGGG - Intergenic
1129786394 15:78313038-78313060 ATTTCTTGAGGGGTGAGAAGGGG + Intergenic
1130041770 15:80411054-80411076 AAATGGTTAGGAGTGAGGAGGGG - Intronic
1130208999 15:81905956-81905978 ATTGGCTTAGGAGGGAGTAGTGG + Intergenic
1131153931 15:90063331-90063353 ATTTCCTGGGGCGTGAGGTGGGG + Intronic
1131259736 15:90882158-90882180 AGTTCCTGCGGAGTGAAGAGGGG + Exonic
1132167688 15:99611989-99612011 ATTTGCTGGGGACTAGGGAGAGG + Intronic
1132227624 15:100154765-100154787 ATTTGCTGGGGGATGAGGGGTGG - Intronic
1132734971 16:1380960-1380982 ATTTCCTGAGCCGTGAGCAGTGG - Intronic
1134236396 16:12469645-12469667 ATTGCCCGAGGAGTGAGCAGCGG - Intronic
1134505052 16:14798413-14798435 CTGTGCTGAGGAGTCTGGAGTGG + Intronic
1134575523 16:15330496-15330518 CTGTGCTGAGGAGTCTGGAGTGG - Intergenic
1134610875 16:15606946-15606968 GTGTGGTGAGGAGTGAGGAGAGG - Intronic
1134726922 16:16426004-16426026 CTGTGCTGAGGAGTCTGGAGTGG + Intergenic
1134940515 16:18285859-18285881 CTGTGCTGAGGAGTCTGGAGTGG - Intergenic
1135995114 16:27241788-27241810 GTCTGCTGAGAGGTGAGGAGCGG - Intronic
1136023974 16:27458244-27458266 GTTTGATGAGGAGTGAGCAGGGG + Intergenic
1136071843 16:27792054-27792076 ATTTGCTGAGGGGTGGGTGGTGG - Intronic
1136076556 16:27821155-27821177 CTTTGCTGTGGTGTGAGCAGGGG + Intronic
1136170744 16:28487699-28487721 ATTTGATGACGAGTGTGGGGAGG + Exonic
1137373702 16:47932633-47932655 AATTTCTGAGGAGGGAAGAGGGG - Intergenic
1137973291 16:53007197-53007219 ACTTTCTGTGGAGTGAGGAAGGG - Intergenic
1138026057 16:53523362-53523384 ATCTGCTGACGAGTGACGCGTGG - Intergenic
1138088980 16:54158806-54158828 ATTTGCTGATGAGTTGGAAGTGG - Intergenic
1138166736 16:54809118-54809140 TTTTGCTGAGTACTGTGGAGTGG - Intergenic
1138203513 16:55107432-55107454 ATCCGCTGAGGAGAGAGGGGAGG - Intergenic
1138496528 16:57412309-57412331 CCTTGCTGAGGGGTGGGGAGAGG + Intronic
1138648584 16:58443550-58443572 ATATTCTAGGGAGTGAGGAGAGG + Intergenic
1138955811 16:61969212-61969234 AAGTGCTGTGGAGTGAGGATGGG + Intronic
1139422194 16:66855722-66855744 GGGTGCTGAGGAGTGAGGGGAGG + Intronic
1139708062 16:68755700-68755722 ACATGCTGAGGGGTGGGGAGTGG - Intronic
1139799900 16:69514073-69514095 CTTTGCTGAGGTCTGAGGATTGG - Intergenic
1139905763 16:70364702-70364724 ATCTGGTGAGGAGTAACGAGAGG + Intronic
1140199385 16:72882087-72882109 ATTTGTTGAGGGGTGAGCATTGG - Intronic
1140698985 16:77563798-77563820 ATTTGCAGAGGGGAGGGGAGAGG + Intergenic
1140977005 16:80069485-80069507 AGTCTCTGTGGAGTGAGGAGAGG - Intergenic
1141982038 16:87556812-87556834 TTTTGCTGACCAGAGAGGAGCGG - Intergenic
1142298823 16:89244441-89244463 AAGTGCTGAGGAGTGAGCTGCGG - Intergenic
1142308103 16:89296916-89296938 AGGTGCTGAGGAGGGATGAGGGG - Intronic
1144344165 17:14334951-14334973 TTTTGCTTTGGAGTGGGGAGGGG + Intronic
1145326451 17:21833355-21833377 GGTTGCTTAGGATTGAGGAGGGG + Intergenic
1146304704 17:31722090-31722112 AGTTGCTGTGGAATGAGGTGGGG + Intergenic
1149229190 17:54513314-54513336 GTCTGTTGAGGAGTGAGGGGAGG - Intergenic
1149334843 17:55625100-55625122 GGTTGCTTAGGAGTAAGGAGAGG + Intergenic
1149547599 17:57515633-57515655 ATTTCCTGAGGACTAGGGAGAGG + Intronic
1150500437 17:65645864-65645886 ATTTGCTGAGAGTTGAGGTGTGG + Intronic
1152066357 17:78114755-78114777 AGTTGCTGATGAGTATGGAGGGG + Intronic
1152083523 17:78203527-78203549 GTTTGCTTGGGACTGAGGAGGGG + Intronic
1152116699 17:78392385-78392407 AGTTACTGGGGAGTGAAGAGGGG - Intronic
1152516986 17:80831146-80831168 AGGTGCTTAGGAGGGAGGAGAGG + Intronic
1152717215 17:81905926-81905948 GTTTGTTGAGGCATGAGGAGGGG - Intronic
1153606669 18:6840615-6840637 TTGTGGTGAGGAGTGAGGAATGG + Intronic
1153985642 18:10348622-10348644 GTTTGCCTGGGAGTGAGGAGTGG + Intergenic
1155225565 18:23726364-23726386 CCTTGCTGTGGAGTGAGGCGAGG + Intronic
1156553822 18:38045322-38045344 AATAGGTGAGGAGTGGGGAGAGG + Intergenic
1157828310 18:50832629-50832651 ATGTGCTGTGGAGTGAGGCTAGG + Intergenic
1159692793 18:71511038-71511060 ATTTGCTCAGTAATGAGGAAAGG - Intergenic
1160367702 18:78342675-78342697 AGGTGGTGGGGAGTGAGGAGGGG - Intergenic
1162262326 19:9543138-9543160 AGTTGCTAAGGAGGGAGTAGAGG - Intergenic
1162446959 19:10729378-10729400 ATATTCTGAAGAGTGAGAAGCGG + Intronic
1162740745 19:12772248-12772270 ATGAGCTGAGGAGTGGGAAGGGG + Exonic
1163039939 19:14594614-14594636 CTTTGCTGAGGAGGGAGGAATGG - Exonic
1163040238 19:14596858-14596880 AGTTGCTGGGGAGTGGGGATGGG - Exonic
1164574129 19:29395680-29395702 ACTTCCTGAGGAGAGAGCAGCGG + Intergenic
1164618219 19:29679059-29679081 AGGTGCAGAGGGGTGAGGAGAGG + Intergenic
1164946189 19:32295068-32295090 GCATGCTGAGGAGTGATGAGTGG + Intergenic
1166921087 19:46229742-46229764 GGTTGCAGTGGAGTGAGGAGGGG - Exonic
1202700116 1_KI270712v1_random:157936-157958 GTTTGCTAGGCAGTGAGGAGGGG + Intergenic
925108428 2:1312686-1312708 ATTTGCTGCGGTGTGGGAAGTGG - Intronic
926309718 2:11666780-11666802 GCTTGATGATGAGTGAGGAGAGG + Intronic
926722460 2:15971407-15971429 CTCTGCTAAGGAGAGAGGAGAGG + Intergenic
926806677 2:16717509-16717531 TTTTGGTGAAGAGTGAGGAGAGG + Intergenic
926876956 2:17491324-17491346 ATTTGGTGGGGAGAGAGGAATGG + Intergenic
929115551 2:38441092-38441114 TTTGGCTGAGAAGTGAGGAAAGG + Intergenic
929943550 2:46353180-46353202 TTTTGGAGATGAGTGAGGAGAGG - Intronic
931421363 2:62130972-62130994 GTTTCCTGAGGAGTGTTGAGTGG + Intronic
932223845 2:70023328-70023350 ATTTGCAGGGGAGGGAAGAGAGG + Intergenic
932773150 2:74512964-74512986 ATCTGCTGGGGAGAAAGGAGGGG + Intergenic
934171049 2:89541411-89541433 GTTTGCTAGGCAGTGAGGAGGGG + Intergenic
934695906 2:96400011-96400033 TGTTGCTGAGGAGGGAAGAGGGG - Intergenic
936087312 2:109477989-109478011 ATTTCATGAGCAGTGGGGAGAGG - Intronic
937656792 2:124386093-124386115 ATTTCCTGTGGAGTGATGGGGGG + Intronic
937836063 2:126471369-126471391 TTTTGCAGAGGAATGAGGAGTGG + Intergenic
937953561 2:127406750-127406772 CTTCTCTGAGGAGTGAGGAGTGG - Intergenic
937998778 2:127715535-127715557 AACTGCTGAGTAGAGAGGAGAGG - Intronic
938215325 2:129507796-129507818 ATTTGATTAGGAGTGTGTAGTGG - Intergenic
938749086 2:134311720-134311742 CTTTGTTCAGCAGTGAGGAGTGG + Intronic
939595452 2:144117160-144117182 ATTTGCTGGAGAGTCAGGATAGG - Intronic
941772539 2:169360956-169360978 ATTTACGGAGGAGTGAGGGGAGG - Intronic
945913975 2:215683027-215683049 ATTTGGTGGGGGATGAGGAGGGG + Intergenic
946155139 2:217802179-217802201 GTTTGCTAGGGAATGAGGAGAGG + Exonic
946666921 2:222060182-222060204 ATTTGTTCAGGTGTGAGCAGTGG + Intergenic
946829066 2:223709126-223709148 TTTTTCTGGGGAGTGAGGAAAGG + Intergenic
947269116 2:228313895-228313917 ATTTGCTGACCAGAGAGGATGGG - Intergenic
947634712 2:231674144-231674166 AGCTGCTGAGGAATGAGGAAGGG - Intergenic
948391269 2:237613158-237613180 ATCTGCAGAGGGGAGAGGAGAGG - Intergenic
948953671 2:241271899-241271921 ACTTGGTGAGAAGTGCGGAGCGG - Intronic
1169049151 20:2561779-2561801 AGGTGCTGTGGAATGAGGAGGGG - Intronic
1169339835 20:4787917-4787939 TATTGTTGAGGGGTGAGGAGTGG - Intronic
1171203237 20:23258349-23258371 AGTGGCTTAGGAGTGAGCAGGGG - Intergenic
1171211085 20:23317393-23317415 ATTTGCTGAGCACTTTGGAGGGG - Intergenic
1173329052 20:42059068-42059090 TTTTGCTGCAGAGTGAGAAGTGG + Intergenic
1173466943 20:43290701-43290723 GTTTGCTCAGCAGTGAGTAGAGG - Intergenic
1173686869 20:44930213-44930235 ATTTACTGAGGAGTGATGGAGGG - Intronic
1173845636 20:46186701-46186723 ATGAGCTGAAGGGTGAGGAGGGG + Exonic
1173863309 20:46297992-46298014 ATTTGTGGAGGAGTTAGTAGAGG - Intronic
1173973839 20:47172689-47172711 ATGTGCTGCGGAGAGAGGAGGGG - Exonic
1173994967 20:47330942-47330964 AATTGATGGGGAGTAAGGAGAGG + Intronic
1175424857 20:58856852-58856874 TCTTGCTGTGGGGTGAGGAGGGG - Intronic
1176904160 21:14479579-14479601 ATTCCCTGAGGAGTGAGGTCAGG - Intergenic
1177753355 21:25314743-25314765 ATCTGGAGTGGAGTGAGGAGTGG - Intergenic
1178480853 21:32978364-32978386 ATTTGCTCAGGGGAGGGGAGGGG - Intergenic
1179435709 21:41360787-41360809 AGAGGCTGAGGAGTGAGGGGAGG - Intergenic
1181873237 22:25920033-25920055 ATTTGCTGATGATGGAGCAGTGG - Intronic
1182816827 22:33171792-33171814 ATTTGCTAGGCAGTGAGGAAGGG + Intronic
1182972638 22:34592223-34592245 ATTTGCTGGGGAGTGACCATGGG - Intergenic
1184059344 22:42072805-42072827 ATTTGCTGAGGAGTTGGATGTGG - Intergenic
1184801307 22:46762194-46762216 ATTTGCAGTGCAGTGAGGTGAGG - Intergenic
1184818688 22:46892422-46892444 ACTTGCTTAGGAGTGAGGCTGGG + Intronic
1185398436 22:50604163-50604185 AGTTGGTGAGGTGCGAGGAGCGG - Exonic
949231727 3:1757661-1757683 CTTTGCGAAGGGGTGAGGAGTGG - Intergenic
949745173 3:7282605-7282627 AGATTCTGAGGAGTAAGGAGTGG + Intronic
950156513 3:10725144-10725166 ATTTGCTGAAGTGTGAGGCCTGG - Intergenic
950579877 3:13855111-13855133 GTGTGCTCAGGAGTGGGGAGTGG - Intronic
950880836 3:16321522-16321544 GTCAGCTGAGGAGTGAGGAGGGG + Intronic
952025831 3:29080787-29080809 ATTTTGTGAGGAGTAAGAAGGGG - Intergenic
952068421 3:29601869-29601891 ATTTGCTTATGAGTGAGCATAGG + Intronic
953178479 3:40574181-40574203 TGTGGCAGAGGAGTGAGGAGTGG + Intronic
953680741 3:45036222-45036244 ATGAGCGGAGGACTGAGGAGAGG + Intergenic
954313943 3:49791031-49791053 ATTTGCTGAGAAGGGAGGGAGGG - Intronic
955409658 3:58647383-58647405 ATTGGCTGAGGAGTGATGCTGGG + Intronic
955511065 3:59680907-59680929 ATATGCTGAGGATTCAGAAGAGG + Intergenic
955990795 3:64625252-64625274 ATTGGTTGTGGAATGAGGAGTGG + Intronic
956499012 3:69861560-69861582 AGTTGCAGAGGAGAGAGAAGAGG + Intronic
957473264 3:80689274-80689296 ATTAGCTGAGGAGTTGGAAGAGG + Intergenic
957558555 3:81792239-81792261 ATTTGCTGAGGATTGGGGGGAGG + Intergenic
957877414 3:86165880-86165902 ACATGCTGAAGAGTGAGAAGGGG - Intergenic
958602873 3:96321303-96321325 ATTTTCTAAGGAGAAAGGAGAGG - Intergenic
961004272 3:123394270-123394292 ATTTGCTAAGGTGGTAGGAGTGG - Intronic
962461912 3:135621902-135621924 ATGTGCAGAGGAGGGTGGAGGGG - Intergenic
962493995 3:135921435-135921457 ATTTGAAAAGGAGTGAGCAGTGG - Intergenic
964053932 3:152428713-152428735 AGATTCTGACGAGTGAGGAGTGG + Intronic
964369787 3:155987939-155987961 AGGTGCTGATGAGTTAGGAGAGG + Intergenic
964637047 3:158869504-158869526 CCTTGCTTAGGAGTGGGGAGTGG + Intergenic
964952178 3:162308769-162308791 TTTTTCTGAGGAGTGAGCACTGG + Intergenic
967911492 3:194546051-194546073 ATCCTCTGAGGAGTGGGGAGGGG - Intergenic
968138755 3:196238742-196238764 ATTTGCTGGGGAGCAAGGTGGGG + Exonic
968612785 4:1564650-1564672 CTTTGCTGATGGCTGAGGAGGGG + Intergenic
969028722 4:4194475-4194497 GTTTGCTAGGCAGTGAGGAGGGG - Intronic
969225307 4:5793342-5793364 ATTTTCTGTGGAGTAAGGAAGGG - Intronic
972657246 4:41076367-41076389 CTTTGCTGAGGTGGGAGGAGGGG - Intronic
972776983 4:42250469-42250491 ATTTCCTGAGAAGACAGGAGGGG + Intergenic
973562173 4:52148346-52148368 ATGTGCTGAGGAGAGAAGAGAGG + Intergenic
973759720 4:54104658-54104680 ATTTTTTGAGGAGTGGGGATAGG - Intronic
974092435 4:57325927-57325949 AATAGCTGGAGAGTGAGGAGTGG - Intergenic
974292167 4:59947410-59947432 ATTTTCTGGGGAAGGAGGAGGGG - Intergenic
974628245 4:64451585-64451607 ATATGCTGGGTAGTGAGGGGAGG - Intergenic
975034954 4:69668758-69668780 TGCTGCTGTGGAGTGAGGAGGGG - Intergenic
976339264 4:83927724-83927746 ATTTGCTGAGAAATGAGCAATGG + Intergenic
978031595 4:103944042-103944064 AGTTGCTAAGGAGGGAGTAGAGG - Intergenic
978462906 4:108977225-108977247 AATAGAGGAGGAGTGAGGAGGGG + Intronic
981308472 4:143271144-143271166 ATTAGCTCAGCAGTGAGAAGAGG + Intergenic
983902944 4:173155942-173155964 GTTTGCTGAGGGGTGGGGAAGGG - Intergenic
985385062 4:189436800-189436822 ATTTGCTGAGGCAGGAGTAGGGG - Intergenic
986081518 5:4399355-4399377 ATTCGCTGAGGAATGAGGGTGGG + Intergenic
988554457 5:32224064-32224086 ATCAGCTGGGGAGAGAGGAGAGG + Intergenic
988872333 5:35404997-35405019 ATTGGCTGGGGATTCAGGAGTGG - Intergenic
989184918 5:38614462-38614484 CTTTCCTGAGAAGGGAGGAGAGG + Intergenic
989260622 5:39416038-39416060 ATATGATGGGGAGGGAGGAGAGG - Intronic
989624924 5:43420139-43420161 ACCTGCTGAGGAAGGAGGAGTGG - Intergenic
990364242 5:55053622-55053644 ATTAGCTGAGGAGTTGGCAGTGG + Intergenic
992649392 5:78842829-78842851 ATTTCCAGAGGAGTGAGGAAGGG - Intronic
992657168 5:78922196-78922218 ATTTGGTGGGGGGGGAGGAGGGG + Intronic
993118090 5:83741681-83741703 ATTTGATGAGCAGTGATGTGTGG + Intergenic
993671378 5:90764982-90765004 ATTGTCAGAGGAGTGAGGGGAGG + Intronic
993968124 5:94383071-94383093 ATTTGGAGAGGTGAGAGGAGGGG - Intronic
994067764 5:95562355-95562377 TTTTGCTGAGGTTTCAGGAGTGG + Intronic
994097522 5:95860326-95860348 TTTGGGTGAGGACTGAGGAGAGG + Intergenic
995837934 5:116416598-116416620 ATTGCCAGAGGACTGAGGAGGGG + Intergenic
996288356 5:121822480-121822502 ATTTTCTGGAGATTGAGGAGGGG + Intergenic
997375250 5:133393191-133393213 ATCCGCGGAGGAGTGAGGAGAGG + Intronic
997842876 5:137257928-137257950 ACTTGGTGAGGACTGTGGAGGGG - Intronic
998808224 5:145939390-145939412 CCTTACTCAGGAGTGAGGAGTGG + Intronic
1000307747 5:160010735-160010757 ATTTGAGGAGGAGCCAGGAGCGG + Exonic
1000680577 5:164179032-164179054 ATTTCCTTTGGAATGAGGAGAGG - Intergenic
1000716750 5:164653560-164653582 ACTTGCTCTGGAGTGAGGTGGGG - Intergenic
1001436836 5:171705728-171705750 ATTGGATGTGGTGTGAGGAGAGG - Intergenic
1001562092 5:172676534-172676556 ATTGCCTCAGGAGTCAGGAGGGG - Intronic
1002553812 5:180018714-180018736 ATTTTCTGAGCAGTGGGCAGGGG - Intronic
1003260070 6:4509022-4509044 ATTTGCTGTGGACTGTGTAGGGG - Intergenic
1004472435 6:15941269-15941291 AGCTGCAGAGGAGGGAGGAGGGG + Intergenic
1004553200 6:16669917-16669939 AGGTGCTCAGGAGTGAGGACAGG - Intronic
1005844536 6:29767183-29767205 AATGGATGAGGAGGGAGGAGAGG - Intergenic
1006067132 6:31470200-31470222 AATGGCTGAAGAGGGAGGAGAGG + Intergenic
1006171086 6:32093412-32093434 TTTGGCTGGAGAGTGAGGAGAGG + Intronic
1006904688 6:37525451-37525473 ATGGGCAAAGGAGTGAGGAGAGG + Intergenic
1007894219 6:45332966-45332988 ATTTTTTGGGGGGTGAGGAGAGG - Intronic
1008117273 6:47566616-47566638 ACCTGTTGAGGGGTGAGGAGCGG - Intronic
1008939804 6:57034502-57034524 ATTTGCAGAGGGATGGGGAGAGG - Intergenic
1009199186 6:60722970-60722992 AGTTTCTGGGGAGTGAGAAGAGG - Intergenic
1009608531 6:65906142-65906164 ATTTGCTGAGGATTGTTGTGTGG - Intergenic
1012727430 6:102832514-102832536 ATACGATAAGGAGTGAGGAGAGG - Intergenic
1013043295 6:106458111-106458133 ATTTTCTGAAGACGGAGGAGTGG + Intergenic
1013288282 6:108698897-108698919 ATGTGCTGGGGAGTGGGGAAGGG + Intergenic
1015993555 6:138974426-138974448 TTTAGCTGAGGAGTGAGGCTTGG - Intronic
1016448397 6:144156070-144156092 AAATCCTGAGGAGTGGGGAGGGG - Intronic
1018398427 6:163399364-163399386 ATTTGCAGAGTAGTGGGAAGAGG - Intergenic
1019656192 7:2197448-2197470 ATGAGAGGAGGAGTGAGGAGAGG - Intronic
1019775376 7:2909420-2909442 AGAGGCTGAGGAGTGAGGGGCGG - Intronic
1019775434 7:2909596-2909618 AGAGGCTGAGGAGTGAGGGGCGG - Intronic
1020016064 7:4832846-4832868 ATTTGGTAAGGAATGAGGACGGG + Intronic
1020989144 7:15174301-15174323 TTTACCTGAGAAGTGAGGAGTGG + Intergenic
1021405708 7:20264804-20264826 ATTGCCTGAGGACTGAGGAGCGG - Intergenic
1021795503 7:24250059-24250081 CTTTGGTGAAGAGTGAGAAGGGG + Intergenic
1021940068 7:25670268-25670290 GTTCGCAGAGGAGTGAGGAGTGG - Intergenic
1023620533 7:42067458-42067480 ATCTGATGGGGAGTGGGGAGAGG - Intronic
1023751591 7:43378310-43378332 ACTGGATGAGGAGAGAGGAGAGG + Intronic
1024097237 7:45992091-45992113 ATTTGCTGATGGGTTAGGTGTGG + Intergenic
1024360112 7:48459445-48459467 AGTGGCAGAGGACTGAGGAGAGG - Intronic
1024741267 7:52357655-52357677 ATCTGCTGAAGAGTGAAGACGGG - Intergenic
1026376272 7:69754169-69754191 ATTGGCTGAGGCATGAAGAGAGG - Intronic
1027682069 7:81233549-81233571 CTTTGCTGTGGAGTGGGGAGAGG + Intergenic
1027713289 7:81635978-81636000 CTTTGCTGGGGAGTGAGGGGAGG - Intergenic
1027818403 7:83009993-83010015 ACTTGCTCAGTAGTGAGAAGTGG - Intronic
1029406084 7:100374676-100374698 AGCTGCTGAGGCCTGAGGAGTGG - Intronic
1030034952 7:105401048-105401070 AGTGACTGAGGAGAGAGGAGGGG - Intergenic
1030643219 7:112029283-112029305 ATATGCTGGGGTGTGAAGAGTGG - Intronic
1030921125 7:115389181-115389203 TTTTGCTGTGGAGTGAGGTTAGG - Intergenic
1031192864 7:118576842-118576864 ATTTGCAGAGTAGGGTGGAGGGG + Intergenic
1031680011 7:124660730-124660752 AGTTGCTGAGAAATGAAGAGTGG - Intergenic
1031781427 7:125971712-125971734 GTTTTCTGAAGAGTGAGGTGGGG + Intergenic
1031805106 7:126298248-126298270 ATGGGGTGGGGAGTGAGGAGAGG + Intergenic
1032354773 7:131200299-131200321 GTTTGTTTAGGAGTGAGGAAGGG - Intronic
1034400025 7:150856225-150856247 ATTTACAGAGGAGTGAGGAGAGG + Intronic
1034984553 7:155500429-155500451 TTTTACTGAGGAGTGGAGAGCGG - Intronic
1035068737 7:156125813-156125835 ATTTGAGGAGGAGGGTGGAGTGG - Intergenic
1035288463 7:157821591-157821613 AGTTGATGAGGATTGAAGAGTGG + Intronic
1035371581 7:158382422-158382444 ACTTTCTGAGGAGAGAAGAGGGG - Intronic
1036939922 8:13041479-13041501 GTGAGCTGAGGAATGAGGAGAGG - Intergenic
1039718935 8:40141608-40141630 ATTTGCTGAGGAGTCAGTTTTGG + Intergenic
1041249403 8:55919808-55919830 ATTGGCTGAGGTGTGAGGCTCGG + Intronic
1042884975 8:73539030-73539052 ATTTGATGGAGAGTCAGGAGAGG + Intronic
1043346146 8:79300076-79300098 ATTTGCAGAGGAGTTTGGGGTGG - Intergenic
1044591317 8:93916853-93916875 ATTGGCTGCGCAGTGACGAGTGG - Intronic
1044603946 8:94032805-94032827 ACTTGCAGAGGAATGTGGAGTGG + Intergenic
1047033559 8:120910654-120910676 ATTTGGTGTGGAGAGAAGAGAGG - Intergenic
1047971636 8:130089454-130089476 ATGGGCTGAGGAGAGATGAGAGG + Intronic
1048304452 8:133273897-133273919 ATTTGATGAGTAGGGAGGGGGGG - Intronic
1049368588 8:142252830-142252852 AATGGCTGAGGGGTGGGGAGGGG - Intronic
1049410303 8:142470988-142471010 ATTTGGAGAGGAGTCAGGATTGG + Intronic
1049526743 8:143130707-143130729 ATCGGCTGAGGAGGCAGGAGGGG - Intergenic
1051764785 9:20511787-20511809 ACTTGCTGAAGAGGAAGGAGAGG - Intronic
1052149317 9:25094022-25094044 ATTTGGTGAGGAGGGGGCAGGGG + Intergenic
1052468504 9:28862152-28862174 CTTTGCTGATGTGTGAGGACAGG - Intergenic
1052793390 9:32899548-32899570 ATTTGCTGTGGAATAAGGTGTGG - Intergenic
1053014336 9:34653523-34653545 ATTTGGTGAGGAGTGAAAAGAGG + Intronic
1053407210 9:37887420-37887442 ATTTTGTGAGGATTGAGAAGGGG + Intronic
1053828546 9:42050560-42050582 GATTGCAGAGGACTGAGGAGAGG - Intronic
1054602015 9:67136894-67136916 GATTGCAGAGGACTGAGGAGAGG + Intergenic
1055174160 9:73297413-73297435 ATCTTTTGAGGAGTGAGAAGTGG + Intergenic
1055436544 9:76297440-76297462 AGCTTCTGAGGAGGGAGGAGAGG + Intronic
1055870432 9:80871431-80871453 ATTTACTAAGGAGGGATGAGAGG - Intergenic
1056218028 9:84423390-84423412 ATATGGTGAGGAGGCAGGAGGGG + Intergenic
1056444124 9:86648373-86648395 ATGTGCTGAGGAACGAAGAGAGG - Intergenic
1061128703 9:128693742-128693764 AGGTGCTGATGAGTTAGGAGAGG + Exonic
1061217927 9:129232486-129232508 ATTTTCTCAGGAAGGAGGAGGGG - Intergenic
1186204464 X:7186880-7186902 ACTTGCAGGGGAGTGAGGAAAGG + Intergenic
1186221174 X:7350616-7350638 ATTTGCTGAGGGGTGAGTTAAGG - Exonic
1187266294 X:17737258-17737280 ATTTGCTGAGGAGATAGCTGTGG - Intergenic
1187268290 X:17757096-17757118 ATTTGGGGAGGAGGGAGGTGAGG + Intergenic
1187320948 X:18237177-18237199 ATTTGGGGAGGAGGGAGGTGAGG - Intergenic
1187366611 X:18670710-18670732 TCTTGCTGAGGAAAGAGGAGGGG + Intronic
1187370453 X:18701391-18701413 TTTAGCTGATGAGTTAGGAGGGG - Intronic
1187435895 X:19268486-19268508 ATAGGCTGAGGTGGGAGGAGTGG + Intergenic
1188442052 X:30222597-30222619 ATTCGCTGAGGGGAGGGGAGTGG + Intergenic
1188740849 X:33779367-33779389 ATTACCTAAGGAGTGAAGAGAGG - Intergenic
1189782452 X:44529184-44529206 ATTTGCTGGGGATTGGGGGGTGG - Intronic
1190832787 X:54074208-54074230 ATTTGCTGATGAGGAAGGTGAGG + Intronic
1191976973 X:66883741-66883763 ATTTGCAGAATTGTGAGGAGAGG - Intergenic
1192014927 X:67319127-67319149 TTTTGCTTTGCAGTGAGGAGAGG + Intergenic
1192133414 X:68574438-68574460 ATTTCCTAAGGAGGGAGGGGCGG - Intergenic
1192216294 X:69161669-69161691 ATTTGCAGATGGGTTAGGAGTGG - Exonic
1194517369 X:94871541-94871563 ATTTGCTGAGCTGTAAGCAGCGG + Intergenic
1195672425 X:107481197-107481219 CTTTGCTGATGAGGGAGAAGGGG + Intergenic
1197460281 X:126732569-126732591 AATTGATAAGGATTGAGGAGTGG + Intergenic
1197892343 X:131279564-131279586 ATAGGCTGCGGAGTGGGGAGGGG - Intronic
1198220146 X:134591415-134591437 AATGGCAGAGGAGTGAGGAGTGG + Intronic
1198943536 X:141984982-141985004 AGTTGCTGAGGAGTGGGGAATGG - Intergenic
1201692009 Y:16777938-16777960 ACTTGGTGATGAGTGAGGTGTGG + Intergenic