ID: 1078145959

View in Genome Browser
Species Human (GRCh38)
Location 11:8721966-8721988
Sequence TCCTTAACAAGCTGCTTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078145957_1078145959 -9 Left 1078145957 11:8721952-8721974 CCACTCCACATAATTCCTTAACA 0: 1
1: 0
2: 1
3: 26
4: 210
Right 1078145959 11:8721966-8721988 TCCTTAACAAGCTGCTTCCTTGG 0: 1
1: 0
2: 3
3: 13
4: 195
1078145956_1078145959 -3 Left 1078145956 11:8721946-8721968 CCGAGGCCACTCCACATAATTCC 0: 1
1: 0
2: 0
3: 14
4: 175
Right 1078145959 11:8721966-8721988 TCCTTAACAAGCTGCTTCCTTGG 0: 1
1: 0
2: 3
3: 13
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078145959 Original CRISPR TCCTTAACAAGCTGCTTCCT TGG Intronic
902064313 1:13671593-13671615 TCCTTCCCAGGCTGCTTCCCAGG + Intergenic
905226622 1:36483024-36483046 TCCCTCACAGGCTCCTTCCTGGG - Exonic
905625189 1:39485339-39485361 TACTTGAGAAGCTGCCTCCTGGG - Intronic
906323652 1:44831316-44831338 TCCTTACCAAGCTGTGTGCTTGG + Intronic
906610069 1:47195291-47195313 TCCTAACCAGCCTGCTTCCTTGG - Intergenic
907497991 1:54857917-54857939 CCCTTAACAAGCTGCATTCTGGG - Intronic
907549129 1:55289250-55289272 TCCCTAACAGACTGCTTCCATGG + Intergenic
908500722 1:64741383-64741405 TCTTTAAATAGCTGCTTCCATGG - Intergenic
908633347 1:66134994-66135016 TCCTGAAGAAGTTGATTCCTGGG + Intronic
910145169 1:84071693-84071715 TCCTTAAACAGCAACTTCCTAGG + Intergenic
910623899 1:89285742-89285764 TTTTTAACAACCTGCGTCCTTGG + Intergenic
911633712 1:100210759-100210781 TGTTAAACAGGCTGCTTCCTTGG - Exonic
912247143 1:107971181-107971203 TCCTTTTAAAGCTGCTTCTTTGG - Intergenic
913076816 1:115347150-115347172 TCCTTTACAAGCTACTCTCTGGG + Intergenic
915476800 1:156157661-156157683 TGTTTAACAAGTTGGTTCCTGGG - Intronic
915934187 1:160081266-160081288 TTCCTAAGAAGCTCCTTCCTGGG - Intergenic
916609387 1:166375929-166375951 TCCTTAATTAGCAGCTTCCTGGG + Intergenic
916741866 1:167653315-167653337 TCCTTAGCAAGCTTCTACCCTGG + Intronic
917220783 1:172726929-172726951 TCCTTTACTCACTGCTTCCTTGG - Intergenic
918206330 1:182312658-182312680 TCCTTCAGAAGCTGATGCCTAGG - Intergenic
920329513 1:205195830-205195852 TGCTGAACAAGCTCCTTTCTGGG + Intronic
920761351 1:208786423-208786445 TTCTTAACTAGCGGATTCCTGGG + Intergenic
921490901 1:215774324-215774346 TCCTAAACAAGTTACTTCTTTGG + Intronic
921932630 1:220767485-220767507 TTTTTAAAAGGCTGCTTCCTTGG + Intronic
922474555 1:225898324-225898346 TCGTTAACAATCTGCGACCTCGG - Intronic
922652864 1:227356170-227356192 TCCTTAACAAGTAGATTCCATGG + Intergenic
923402586 1:233629370-233629392 TCCTTAACAACCCTCTTCCCCGG - Intronic
1065763219 10:29002524-29002546 TGCTTAGAAAGATGCTTCCTCGG - Intergenic
1066003489 10:31126514-31126536 TCCTTAATAAACTGTTTCCCTGG - Intergenic
1066313953 10:34224929-34224951 TCCTGAACAAGCTGGTTCCCTGG + Intronic
1067655940 10:48191256-48191278 TTGTTCACAGGCTGCTTCCTTGG - Intronic
1067986455 10:51151920-51151942 TCCTTAGCAAGTGGCTTCCAGGG - Intronic
1071183366 10:83012892-83012914 GTCTTAAAAAGCTGTTTCCTAGG - Intergenic
1074059196 10:109949486-109949508 TCCTGAACAAGCTGCTCTATGGG - Intronic
1075020883 10:118951582-118951604 TCTTTAACAAACTGCTTGCCGGG + Intergenic
1077777844 11:5291373-5291395 TCCTTAACAACTTCCTTGCTTGG + Intronic
1078145959 11:8721966-8721988 TCCTTAACAAGCTGCTTCCTTGG + Intronic
1078832046 11:14987133-14987155 TCCTTTATAAGCTGCTTCTAGGG - Intronic
1079855862 11:25603291-25603313 TAATTAAAAAGCAGCTTCCTAGG - Intergenic
1079919931 11:26420427-26420449 TCCTTAGATATCTGCTTCCTGGG - Intronic
1080181126 11:29427435-29427457 CCCTTAACTACCTGTTTCCTCGG + Intergenic
1082694318 11:56341385-56341407 TCCTTCATTAGCTGATTCCTTGG - Intergenic
1083303893 11:61753003-61753025 TCCTCAACTCGCAGCTTCCTTGG + Intronic
1083475508 11:62912627-62912649 CCCTTAACAACCTGCTGGCTGGG + Intronic
1085828985 11:79879350-79879372 CCCTTCACAAGCTGCTTCTCTGG - Intergenic
1086614933 11:88805081-88805103 TCTTTAACAAACTGCCTGCTAGG - Intronic
1088366167 11:109042006-109042028 TCCTTAAAAAGCAGCTCCTTGGG + Intergenic
1089607261 11:119648687-119648709 CCCTAAACAGGCAGCTTCCTGGG - Intronic
1089934411 11:122349038-122349060 TCTTTAAAATGCAGCTTCCTTGG + Intergenic
1091135607 11:133186296-133186318 TCCTTAAAAATCTGCAGCCTGGG - Intronic
1091800592 12:3322140-3322162 TCCTTGACAGCCTTCTTCCTGGG - Intergenic
1095234089 12:39776429-39776451 CCCTTGCCAAGCCGCTTCCTAGG - Intronic
1095559188 12:43545324-43545346 ACCTTAACAATCTGATTCCTTGG + Intronic
1097913191 12:64992742-64992764 TCTTTCAAAAGGTGCTTCCTGGG - Intergenic
1100522685 12:95390470-95390492 TCCTTAAACAACAGCTTCCTAGG - Intergenic
1102506093 12:113385336-113385358 TCCTTGCCCAGCTCCTTCCTAGG + Intronic
1104517711 12:129443164-129443186 TCCTCTACAAGTTGCTTCCAAGG + Intronic
1106668648 13:31880838-31880860 TCCTTGCCAAACTGCTTCTTTGG - Intergenic
1106675244 13:31951408-31951430 TCCTTAAATAGCTGCTTCTCAGG + Intergenic
1106766996 13:32923161-32923183 ATCTTAACCAGCTGCTTTCTTGG - Intergenic
1116693794 14:48146196-48146218 TCCTTCACAGTCTGCTTTCTAGG - Intergenic
1117335592 14:54754843-54754865 CCCTTATCAAGCAGCTGCCTGGG + Intronic
1117537432 14:56715169-56715191 ACCTTAACAAGCTCTTTGCTTGG + Intronic
1118737091 14:68709309-68709331 TACTCAACAAGCTGATTCCTGGG - Intronic
1121989099 14:98537750-98537772 TGCTTAACACGGTGCTCCCTCGG - Intergenic
1122008596 14:98727122-98727144 TCATGGACAAGCTGCTTCCCAGG + Intergenic
1124642322 15:31403497-31403519 TCATTTACAAGTTACTTCCTGGG - Intronic
1125481637 15:40085120-40085142 CCCTTAACGCACTGCTTCCTAGG - Intergenic
1125545341 15:40499319-40499341 ACCTTCACACGCTGCTTCCCAGG - Intergenic
1127770263 15:62224743-62224765 TTCAGAACAAGCTGCCTCCTGGG - Intergenic
1128092454 15:64928203-64928225 CCCTTACCAGGCTGCCTCCTGGG + Intronic
1128282893 15:66411367-66411389 TGCCTAAGAAGCTACTTCCTGGG - Intronic
1129712293 15:77826524-77826546 TCCCTCACAGTCTGCTTCCTGGG + Intergenic
1130024632 15:80260627-80260649 TCCCTCAAAAGCTGCCTCCTCGG - Intergenic
1130919453 15:88332068-88332090 TCCTGAAGGATCTGCTTCCTAGG - Intergenic
1133470512 16:6070581-6070603 TCCATAGCCAGCTGCTTCTTCGG - Intronic
1134158996 16:11869293-11869315 TACTTAACAAGATGCTGCCATGG + Exonic
1138133926 16:54505005-54505027 ACCTTAACAGGATGCTTCTTGGG + Intergenic
1138582678 16:57951919-57951941 TCCTGAACTAGCTGTTTCCATGG + Intronic
1138888818 16:61115725-61115747 TCTTTAACATGCCTCTTCCTTGG - Intergenic
1140456013 16:75106023-75106045 TCCTGAAAGAGCTCCTTCCTGGG - Intronic
1140718961 16:77753145-77753167 TGCTTAACAATCTGTTTCCTTGG + Intergenic
1146289857 17:31599266-31599288 TCCTTAACAACTGGTTTCCTGGG + Intergenic
1147673882 17:42192120-42192142 TCCCCAACAAGCTGCATGCTAGG - Intronic
1150332095 17:64302563-64302585 TCTTTAAAAAGCTGATGCCTGGG - Intergenic
1151255916 17:72876349-72876371 AACTTAACAACATGCTTCCTTGG - Intronic
1155009560 18:21762600-21762622 TACTCACCCAGCTGCTTCCTAGG - Intronic
1155626283 18:27838577-27838599 TCCTTAATCAGCTTATTCCTAGG - Intergenic
1157327778 18:46681342-46681364 CCCTTAAATAGCTGCTCCCTGGG + Intronic
1157497460 18:48166630-48166652 CCCCTAACATGCTGCTTCATTGG - Intronic
1157705597 18:49803001-49803023 TCCTTAAGACTCTGCTTCCATGG - Intronic
1157824573 18:50801194-50801216 TCCTTGACAAGGTGCCTCTTTGG - Intronic
1160617551 18:80144118-80144140 TTCTAAACAAGCTGCTTGGTAGG - Intronic
1161055342 19:2188188-2188210 TCCTTAACCAGCAGCTGCATAGG - Intronic
1161750431 19:6092351-6092373 TCCGTCCCAAGCTGCTTTCTTGG - Intronic
1163054940 19:14711014-14711036 TTTTTAACAACCAGCTTCCTTGG + Intronic
1164151253 19:22553726-22553748 TCCTTCACAACTTGTTTCCTGGG - Intergenic
1165929478 19:39347193-39347215 TCCTCAACAAGCTTCTGCTTTGG + Intronic
1167241654 19:48347266-48347288 GCCTGAACAAGCTGCTTCATAGG - Intronic
1167332893 19:48867449-48867471 TCCTTAACAACCAGAGTCCTTGG + Intronic
933045284 2:77527918-77527940 TCATTAAAAAGCAGCTGCCTTGG + Intronic
933446449 2:82386153-82386175 TCTTTAACAATCCTCTTCCTTGG + Intergenic
935072369 2:99706058-99706080 ACTTTAAAATGCTGCTTCCTGGG - Intronic
938647033 2:133342302-133342324 TAGTTAAAATGCTGCTTCCTGGG - Intronic
942080073 2:172391888-172391910 TCCTTGTCCAGCTGCTTACTAGG + Intergenic
942181635 2:173386095-173386117 TCCTTAACCGGCTTCATCCTTGG + Intergenic
945462757 2:210129779-210129801 TCCTTAAAAACCTGATTCCTAGG + Intronic
946014183 2:216590854-216590876 TCCTTAATCTGCTGCTTCCTTGG + Intergenic
946059647 2:216930736-216930758 TCTTTAACAAGTGGCTTCCAAGG + Intergenic
947670378 2:231931979-231932001 TCCTTAATCAGCTGCTTCCTGGG - Intergenic
947704240 2:232261455-232261477 TCCTTAACCTGGTGCTTCCCAGG + Intronic
948094087 2:235319897-235319919 CCCACAACTAGCTGCTTCCTGGG + Intergenic
948837486 2:240632624-240632646 TCCTTGACATGGTCCTTCCTGGG - Intergenic
1169738792 20:8867318-8867340 TCCTGAAGAGGCTGCTTCATGGG + Intronic
1170552559 20:17490143-17490165 TGCTTAGCCAGCTGCTCCCTGGG - Intergenic
1170559622 20:17545649-17545671 GCATTACCAAGCTGCCTCCTAGG - Intronic
1172833411 20:37856235-37856257 TGCTGCACAAGGTGCTTCCTAGG + Intronic
1174392479 20:50226539-50226561 TCCCTGCCAAGCTCCTTCCTGGG + Intergenic
1174741239 20:53016145-53016167 TGCTTAATAATCTGCTGCCTGGG + Intronic
1178960636 21:37061509-37061531 TCCTCAGGAAGCTGCTGCCTAGG - Intronic
1181423621 22:22818881-22818903 TCCTTTACAAACTGGTTCCACGG - Intronic
1182265744 22:29113897-29113919 TTCTTAATTTGCTGCTTCCTAGG - Intronic
1184369814 22:44075149-44075171 TCCTTCACCACCTGCTTCCGGGG - Intronic
950187575 3:10954518-10954540 TCCTAAACCAGCTGCATCCATGG - Intergenic
953537044 3:43784384-43784406 TCATTAGCATGCTCCTTCCTTGG - Intergenic
954587801 3:51751837-51751859 TCCTTAACCAACACCTTCCTAGG + Intergenic
955940587 3:64143650-64143672 TGCTTAACATGCAGATTCCTGGG + Intronic
956361294 3:68450628-68450650 TTCTTAAAAATCTACTTCCTTGG - Intronic
957941893 3:87017075-87017097 TCCTGAATAAAGTGCTTCCTTGG + Intergenic
959179247 3:102957475-102957497 TCTTCAACAAACTCCTTCCTTGG + Intergenic
961177663 3:124849104-124849126 TCCTTAACAACCAGGCTCCTTGG + Intronic
961640832 3:128363945-128363967 TCCCTCAGAAGCTGCTGCCTAGG + Intronic
962558035 3:136575708-136575730 TCCTTAACAAGCAGCTTCCAAGG + Intronic
965823478 3:172708054-172708076 TCCTTAAGAAGCAGCTACTTAGG - Intronic
967140182 3:186551147-186551169 TCCTTATCCAGCTGCTTGTTTGG + Exonic
967421374 3:189276799-189276821 CCTTAAGCAAGCTGCTTCCTTGG + Intronic
967540092 3:190656999-190657021 TCCTTTCCATGCTGCTCCCTGGG - Exonic
970854453 4:20636280-20636302 TCCTTAAAAAACAACTTCCTAGG + Intergenic
971065521 4:23027611-23027633 TCCTTATGGAGCTGCCTCCTGGG + Intergenic
976048923 4:80987474-80987496 TCCTTAAAGAGCTGCTTATTGGG - Intergenic
977196331 4:94065342-94065364 TCCTAAACAGGCTGCCTCTTAGG + Intergenic
979745044 4:124202398-124202420 CCCTTAACAAGCTGTTACGTGGG - Intergenic
981062641 4:140442050-140442072 TCCTTGAAAAGGTGCTTACTTGG - Intergenic
981833316 4:149027206-149027228 TCCTTACCAAGCAGCTCCTTTGG + Intergenic
983587928 4:169375754-169375776 TCTCTAATAACCTGCTTCCTTGG + Intergenic
984705212 4:182842697-182842719 TCCTTAACAAAGTGCTTCCTAGG - Intergenic
984931014 4:184847052-184847074 TCCTTAACAAGCTGCCCACGTGG - Intergenic
990372958 5:55139391-55139413 TGCTGAACAGGCTGCTTTCTTGG - Intronic
991939826 5:71839805-71839827 CCCTTAACAAGCTCCTCGCTGGG - Intergenic
993458793 5:88158055-88158077 TCCATTTCCAGCTGCTTCCTAGG - Intergenic
994055075 5:95405835-95405857 TCCTAAACCTGCTTCTTCCTGGG - Intronic
995062644 5:107827938-107827960 TTCTTAACCAGCTGATCCCTAGG - Intergenic
998888493 5:146720508-146720530 TCCTTAAGATGCTGTTTCTTGGG + Intronic
999093337 5:148956746-148956768 TCATTAACATGCAGATTCCTGGG + Intronic
999976801 5:156920027-156920049 CCCAAAACAAGCTGCTTCCATGG + Intronic
1000055658 5:157603937-157603959 TCCTTTTAAAGCTGTTTCCTGGG - Intergenic
1001125741 5:169017730-169017752 TTATTGACAAGCTTCTTCCTTGG - Intronic
1002446689 5:179294535-179294557 ACCTCCACAAGCTGCCTCCTTGG - Intronic
1003994310 6:11523446-11523468 TCCTTAGCACTCTGCTCCCTTGG - Intergenic
1004063830 6:12223626-12223648 GACTTTAAAAGCTGCTTCCTAGG + Intergenic
1004487929 6:16085429-16085451 TCTTTAACATCCTTCTTCCTAGG - Intergenic
1005344451 6:24875647-24875669 TCCTTGGCAAGCTGCATCCCGGG + Intronic
1005420444 6:25642987-25643009 TCCTTAAAAAGATCCTTCATAGG + Intergenic
1006342710 6:33455318-33455340 TCCATGACAAGCTGCTTCTGGGG + Exonic
1006550632 6:34820306-34820328 ACCTTCCCAAGCTCCTTCCTAGG - Intronic
1007984472 6:46193897-46193919 TGGTTAACGAGCTGGTTCCTAGG + Intergenic
1009454951 6:63845636-63845658 TCTTAAAGAAGCTGCTTCTTTGG + Intronic
1009661451 6:66617345-66617367 TCTTTAAGAAGCTGTTTGCTGGG + Intergenic
1011465451 6:87651257-87651279 TCCTTCACATGCTGCTAACTTGG + Intronic
1013792852 6:113856073-113856095 TGCTTATTAAGCTGTTTCCTTGG + Intergenic
1013896534 6:115095323-115095345 TACATAGCCAGCTGCTTCCTAGG - Intergenic
1013987035 6:116207042-116207064 TTCTTAACAAACTTTTTCCTAGG + Intronic
1014580734 6:123134350-123134372 TCCTTAACAATATCATTCCTTGG - Intergenic
1017019775 6:150130841-150130863 TCCATCACTAGCTGCTGCCTTGG + Intergenic
1019890532 7:3942377-3942399 TCCCTCTCAAGCTGCTGCCTTGG - Intronic
1021338471 7:19433717-19433739 TACTTGACCAGCAGCTTCCTGGG + Intergenic
1022984106 7:35633367-35633389 TCTTTAAAGAGCTGCTTCATTGG - Exonic
1024143457 7:46485500-46485522 TCCTTAGAAAGGAGCTTCCTGGG - Intergenic
1028574762 7:92335944-92335966 TCTTTAACATGCTGCTTTCTGGG + Intronic
1031871950 7:127097188-127097210 TCCTTAGCAATGTGCTTCCAGGG - Intronic
1031967361 7:128036481-128036503 TCCTTAAAGAGCTGAGTCCTTGG - Intronic
1032431915 7:131869374-131869396 TCCTGAACCAGCTGCCTCCATGG - Intergenic
1033234251 7:139625637-139625659 TCCTTCACAGGCCACTTCCTGGG + Intronic
1034184566 7:149164670-149164692 TCTTTTACAACCTTCTTCCTTGG - Intronic
1036682669 8:10886802-10886824 TGTTTAGAAAGCTGCTTCCTGGG + Intergenic
1038431736 8:27505722-27505744 TCCTCACCATGCTGCATCCTGGG + Intronic
1038475355 8:27862444-27862466 TCCTTGACATGCTGCTGGCTGGG - Intergenic
1041703368 8:60817131-60817153 GCTTTCACAAGCTGCTTACTAGG + Intronic
1042102743 8:65291416-65291438 TCCTTGACAAGGTGCTTACTTGG - Intergenic
1043641226 8:82452531-82452553 GCCTAAACAGGGTGCTTCCTCGG - Intergenic
1044336946 8:90996546-90996568 TCCTGAAGAGGCTGCCTCCTTGG - Intronic
1045412476 8:101932396-101932418 TTATTAAAAATCTGCTTCCTGGG + Intronic
1046646456 8:116791259-116791281 TGCTTAACATGCAGATTCCTGGG + Intronic
1049699898 8:144005798-144005820 TCCTTGACAAGGTGCTGCTTGGG - Intronic
1049993401 9:1011133-1011155 TTTGTAACCAGCTGCTTCCTAGG - Intergenic
1050204778 9:3184764-3184786 TCCTTAAAATACTCCTTCCTGGG - Intergenic
1051041206 9:12814121-12814143 TGTTTAACAAGCAGCTTCCTGGG - Intronic
1052520508 9:29542109-29542131 TTCTTAAAATGCTGATTCCTAGG - Intergenic
1056131998 9:83596380-83596402 TCCTCAACAAGCTTCTTAATAGG - Intergenic
1056181148 9:84083553-84083575 TCCTCAACAAGTGGCTTCCAAGG - Intergenic
1059733653 9:117080787-117080809 CCCTTAGGAAGCTCCTTCCTAGG - Intronic
1059758300 9:117314282-117314304 TGCTGAACAAGCAGCATCCTGGG + Intronic
1185639046 X:1576339-1576361 TCCTTATCAAGATGCTTCCAAGG - Intergenic
1187779200 X:22798772-22798794 TACTTAACAAACTACTTCCATGG - Intergenic
1189755951 X:44271517-44271539 TCCTTGACGAGCTGATTCTTGGG - Intronic
1190446299 X:50528207-50528229 CCCATAGCAAGCTGCTTCTTAGG + Intergenic
1192004817 X:67199217-67199239 ACCTTAAGAAGCTGCCTACTTGG + Intergenic
1193715184 X:84928288-84928310 TCCCTAAGAAGGAGCTTCCTAGG - Intergenic
1194544739 X:95219155-95219177 CCCTCCACAAGCTGCTTCCCTGG - Intergenic
1195625958 X:107006040-107006062 TCCTTAGCATGCTTCTGCCTTGG + Intergenic
1196246343 X:113404296-113404318 GCCTTAAGAAGCTCCTTCATGGG - Intergenic
1198138908 X:133783066-133783088 TCCTGACCAAGCTGAGTCCTAGG - Intronic