ID: 1078147588

View in Genome Browser
Species Human (GRCh38)
Location 11:8732193-8732215
Sequence CTGCATATGGATTTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078147588_1078147593 -5 Left 1078147588 11:8732193-8732215 CCCAGCTCCAAATCCATATGCAG 0: 1
1: 0
2: 0
3: 9
4: 236
Right 1078147593 11:8732211-8732233 TGCAGATCTTGGCAACTACAAGG 0: 1
1: 0
2: 0
3: 10
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078147588 Original CRISPR CTGCATATGGATTTGGAGCT GGG (reversed) Intronic
901010772 1:6200563-6200585 CAGCAGCTGGCTTTGGAGCTTGG - Intronic
902290565 1:15432254-15432276 TTCCATGGGGATTTGGAGCTGGG - Intergenic
903827779 1:26157967-26157989 CCAAATGTGGATTTGGAGCTGGG + Intergenic
904969015 1:34404486-34404508 GTGAACATGGCTTTGGAGCTGGG - Intergenic
908697329 1:66858167-66858189 CTTCATCTGGTTTTGGAGTTAGG - Intronic
908980871 1:69956363-69956385 CTGCATATGGGATTGGTGCTTGG + Intronic
909330861 1:74408744-74408766 TTGCATTTGGATTTGAAGCAGGG - Intronic
910063691 1:83125238-83125260 AGGCAAATGTATTTGGAGCTGGG - Intergenic
911096844 1:94061973-94061995 CTGAATATGGATTTGGGGGGTGG - Intronic
915681664 1:157587277-157587299 CTGCACATGGATCTGTAGCGAGG + Exonic
916576596 1:166072455-166072477 CTACATATGCTTTTGCAGCTGGG + Intronic
917030641 1:170686695-170686717 CTGCATATGGATTTACCACTTGG + Intronic
917160376 1:172050768-172050790 CTGCATATGGATCTGCTGATTGG - Intronic
918595174 1:186284575-186284597 CAGCATATGAATTTGGAGGGGGG + Intergenic
918760255 1:188395663-188395685 GTGTATATGAAGTTGGAGCTAGG + Intergenic
919194077 1:194261084-194261106 CTGCATATTGAATTGGACATAGG + Intergenic
919295366 1:195692309-195692331 CTCCATATGAATTTGGGGATTGG - Intergenic
920533962 1:206725266-206725288 ATGCATTTAGATTTGGATCTTGG + Intronic
921622862 1:217345444-217345466 CTGCATATATTTTAGGAGCTGGG - Intergenic
922515007 1:226200941-226200963 CTGGATGTGGAGTAGGAGCTGGG - Intergenic
922569722 1:226627035-226627057 CTTCATGTGTATTTGGAGATAGG + Intergenic
923311666 1:232741452-232741474 CGGAATATGGATTTGGAGAAAGG + Intergenic
923512102 1:234661561-234661583 CTGCACATGCACTTGGACCTAGG - Intergenic
924072291 1:240293789-240293811 TAGCATTTGTATTTGGAGCTGGG - Intronic
1063187730 10:3665866-3665888 CTGCACATGGATTTGGATTTTGG + Intergenic
1064168049 10:13003052-13003074 CAACATATGAATTTGGAGGTGGG + Intronic
1065765658 10:29027068-29027090 CTGAATATGAATTTTGATCTGGG - Intergenic
1066986666 10:42474756-42474778 CTGAAAGTGGATTTGGAGCAAGG - Intergenic
1067553038 10:47248405-47248427 GTGCATTTGGTTTAGGAGCTTGG + Intergenic
1068103552 10:52585821-52585843 CTGCATATGGATATCCAGTTTGG + Intergenic
1068120654 10:52779611-52779633 CTGCCTATTGAATTGGAGGTGGG + Intergenic
1068949040 10:62759182-62759204 CTGTTTGTGGATTTGGAGCCAGG + Intergenic
1069216646 10:65829486-65829508 ATGTATATGGATATGGGGCTGGG + Intergenic
1072572901 10:96674020-96674042 CTGCATCTGGCTTTGTGGCTTGG + Intronic
1074325991 10:112451537-112451559 TTGGATATGAATTTGGAACTGGG + Intronic
1074670605 10:115786214-115786236 CTGCAAATGGCTTTGGAATTTGG - Intronic
1075245843 10:120821654-120821676 CAGCATATGAATTTTGAGGTGGG - Intergenic
1076761099 10:132606143-132606165 CTGCAGCTGGATGTGGGGCTGGG + Intronic
1077005328 11:352544-352566 CTCCATCTTGATTAGGAGCTGGG - Intergenic
1078145254 11:8718069-8718091 CTGCTTCTGGACTTGGAGCCAGG - Intronic
1078147588 11:8732193-8732215 CTGCATATGGATTTGGAGCTGGG - Intronic
1078586299 11:12592768-12592790 CTTCATATAGATCTGGTGCTTGG + Intergenic
1078778997 11:14419624-14419646 CTGCCTCTGGATTTTGAGGTGGG + Intergenic
1078790058 11:14533300-14533322 CTCCACATTGATTTGGTGCTGGG + Intronic
1080197702 11:29631547-29631569 CTGGATATTGATTGGGAGCAAGG + Intergenic
1082965006 11:58958227-58958249 CTCCAAATGTATTTGGAGGTGGG - Intronic
1084270157 11:68024986-68025008 CTGCTTCTGGAGTTGGAGCAGGG - Intronic
1085359721 11:75876343-75876365 CTGGATATAGACTTGGATCTAGG - Intronic
1086120857 11:83303508-83303530 CTGGATATGGACTTGGAATTGGG - Intergenic
1087713704 11:101583388-101583410 CTGCTCATGGACTCGGAGCTGGG - Exonic
1088840336 11:113622263-113622285 CTTCATAGGGTTTTGGAGCCAGG + Intergenic
1089534611 11:119153304-119153326 CAGCATATGCATTTAGAGCACGG - Intronic
1089749644 11:120641856-120641878 CTGCATCTTGAATAGGAGCTGGG - Intronic
1089823547 11:121250571-121250593 TTCCAGATTGATTTGGAGCTTGG - Intergenic
1093504556 12:19850137-19850159 TTGTAAATGGATTTGGAGCAAGG + Intergenic
1097815545 12:64069545-64069567 GTGCATATGGAATTAGAGCAGGG + Intronic
1099648474 12:85392227-85392249 CAGCATATGAATTTGGGGGTGGG + Intergenic
1099928550 12:89047381-89047403 CTACATATGGAGTTGCTGCTAGG - Intergenic
1101702218 12:107184880-107184902 CAGCATATGAATTGGGAGATGGG - Intergenic
1102787252 12:115614759-115614781 CTGCCTTTGGCTTGGGAGCTGGG + Intergenic
1104684937 12:130778632-130778654 TTGCAGATGGATTTGGTGTTGGG - Intergenic
1104711876 12:130993009-130993031 CAGCATATGGGTTAGGAGCAGGG + Intronic
1104786445 12:131452719-131452741 CTGCACATGAATCAGGAGCTGGG + Intergenic
1107319769 13:39173715-39173737 GTATATATGGATTTGGAGTTTGG + Intergenic
1107725606 13:43296156-43296178 CAACATTTGGATTTGGGGCTGGG - Intronic
1109791900 13:67259687-67259709 CTGCATCTCGAATAGGAGCTGGG - Intergenic
1111513476 13:89296973-89296995 GTGGATATGGCTTTGGAGGTGGG + Intergenic
1113557661 13:111251422-111251444 CCGCTGATGGATTTGAAGCTTGG + Intronic
1115239150 14:31237496-31237518 CTCCATATTGAATAGGAGCTGGG - Intergenic
1116593424 14:46809151-46809173 CTGCATTTTGAATAGGAGCTGGG - Intergenic
1119720054 14:76884483-76884505 CTCCATATTGAATAGGAGCTGGG - Intergenic
1119865666 14:77971422-77971444 CTACATTTTCATTTGGAGCTCGG - Intergenic
1121745276 14:96284433-96284455 CTGCATTTCAATTTGGGGCTTGG - Exonic
1122223915 14:100261565-100261587 CTGCATATGGACATGGAGGTTGG - Intronic
1124457138 15:29854122-29854144 TTGCACATGGATTTAGAGTTTGG - Intronic
1124622194 15:31280094-31280116 CAGCACATGGAGCTGGAGCTGGG + Intergenic
1125895989 15:43302068-43302090 CTCCATCTGCATTTGGACCTTGG - Intronic
1129447980 15:75632065-75632087 CTGAGTCTGGATTTGGATCTAGG - Intergenic
1130650092 15:85757532-85757554 CAGAATGTGGATTTGGAGCTAGG - Intergenic
1130875928 15:88014343-88014365 CTGCATAAGGATTTGGAAGAAGG - Intronic
1132011002 15:98276709-98276731 CAGCATATGAATTTGGGGGTGGG - Intergenic
1132083806 15:98890187-98890209 CTGCATCTTGAATAGGAGCTAGG + Intronic
1133206658 16:4238171-4238193 CTGGATTTGGGTTTGGAGCAGGG + Intronic
1134026640 16:10958970-10958992 GTGCAGAAGGATTTGGGGCTGGG + Intronic
1134386943 16:13782143-13782165 CTGCATTTTTATTTTGAGCTTGG - Intergenic
1138995947 16:62452884-62452906 TTGCATATGTATTTGTGGCTGGG - Intergenic
1139438280 16:66949248-66949270 CTGCTTTAGGATTTGGAGCCTGG - Intergenic
1141358551 16:83372898-83372920 CTGCCTATGAATATGGATCTAGG + Intronic
1142312558 16:89322591-89322613 CTGTCTTTGGAATTGGAGCTGGG - Intronic
1143099018 17:4494763-4494785 CTGCATATGGATCTCGTGTTTGG + Intergenic
1143926210 17:10373188-10373210 CTGCATAGGGATTTTGACGTTGG + Intergenic
1144268092 17:13590986-13591008 CTGAATCTGGAATTGGAGCAAGG - Intronic
1144310543 17:14010225-14010247 CTGCATATGGCTTTATAGTTTGG - Intergenic
1145010745 17:19366295-19366317 CTGCATACAGACTTGGCGCTGGG + Intronic
1147043244 17:37733953-37733975 CTGCATGTGGAGCTGGAGATGGG + Intronic
1147794182 17:43030906-43030928 CTGGATGTGGTGTTGGAGCTGGG + Intergenic
1151904507 17:77038972-77038994 TTGCATCTTGATTTGGAGCCTGG + Intergenic
1154969626 18:21394258-21394280 CTCCAAATTGATGTGGAGCTAGG - Intronic
1155044275 18:22089901-22089923 CGGCATAAGGATTAGGAGATGGG - Intronic
1157981795 18:52390258-52390280 CTGCATATCCCTTTGGAGGTAGG + Intronic
1160347179 18:78142112-78142134 CAGCATATGTATTTAGAGTTCGG + Intergenic
1161804327 19:6433710-6433732 CTGCTTAGGGATTTGAAGCCAGG - Exonic
1165938593 19:39403795-39403817 CTGCGTAAGGATTTGGAGATCGG + Intergenic
926292558 2:11542341-11542363 CTGCATCTGCTCTTGGAGCTTGG + Intronic
926711458 2:15885362-15885384 CTGCATCTTGAATTAGAGCTTGG + Intergenic
927469648 2:23363381-23363403 CTGCATTTGGAATAGGAGGTAGG - Intergenic
929133222 2:38599022-38599044 ATGCATATGGGTTGGGAGATGGG - Intronic
929490131 2:42388748-42388770 CAACATATGAATTTGGAGGTAGG + Intronic
931115896 2:59166462-59166484 CAACATATGGATTTGGGGTTGGG - Intergenic
931474237 2:62571341-62571363 CTGGAGATGGAGTTGGAGGTGGG - Intergenic
931631309 2:64303562-64303584 CTGCATTTGTATTTGGAGAGTGG + Intergenic
934517438 2:94997716-94997738 CAACATATGAATTTGGGGCTGGG - Intergenic
935334170 2:101999746-101999768 CAGCATATGGAGCTGGAGGTTGG - Intronic
936247027 2:110837169-110837191 CTGGACTTGGACTTGGAGCTGGG + Intronic
936621987 2:114109546-114109568 ATTCATCTGGATTAGGAGCTTGG + Intergenic
937982192 2:127622294-127622316 AGGAATATGGATTTGGAGATGGG - Intronic
940430331 2:153582952-153582974 TGGCATATAGATGTGGAGCTAGG + Intergenic
941024621 2:160444804-160444826 GTGCATATGTGTTTGGTGCTGGG - Intronic
942426732 2:175868084-175868106 CTGCTTATTGAATTGGACCTGGG + Intergenic
942987537 2:182161149-182161171 ATGTATATGCATCTGGAGCTGGG - Intronic
947649388 2:231772425-231772447 CTGCTTATAATTTTGGAGCTGGG - Intronic
1169216792 20:3798893-3798915 CTGCAGATTGATTTGGCTCTTGG + Intronic
1169529873 20:6473555-6473577 TTTCATATGGATTTCAAGCTGGG + Intergenic
1170996016 20:21359553-21359575 CTGAATATGCATTTAGATCTGGG - Intronic
1172919216 20:38467512-38467534 CGGCATATGAATTTGGGGCCGGG - Intergenic
1173021237 20:39269498-39269520 CTGCATCTGGCTTTTGTGCTGGG - Intergenic
1174968936 20:55252062-55252084 ATGCATATTGATTTGGCACTTGG + Intergenic
1175465385 20:59187221-59187243 TTACATGTAGATTTGGAGCTGGG - Intergenic
1175502055 20:59457453-59457475 CTGCATAGAGGTTAGGAGCTGGG - Intergenic
1175728377 20:61334689-61334711 CAACATATGGATTTGGGGGTGGG + Intronic
1177444261 21:21171236-21171258 CTGCATAGGCATTTGTAGTTTGG - Intronic
1183271610 22:36865787-36865809 CTGGAGATGGGGTTGGAGCTTGG - Intronic
1183445011 22:37847850-37847872 CAGCATAGGGAGTTGGGGCTGGG + Intronic
1184959801 22:47920766-47920788 CTACATCAGGATCTGGAGCTTGG - Intergenic
1185232004 22:49688772-49688794 CGGAAAATGGATATGGAGCTTGG + Intergenic
1185388664 22:50547800-50547822 CTGCAGCTGGACTTGGGGCTGGG - Intergenic
949405172 3:3706391-3706413 CTGCATCTTGAATAGGAGCTGGG - Intronic
950042011 3:9925788-9925810 GTGCAAGGGGATTTGGAGCTAGG - Intronic
950445510 3:13035189-13035211 CTGGATGTGGATTAGGAGCCGGG - Intronic
950762362 3:15243352-15243374 CTGCATCTTCATTTGGAGCCAGG - Intronic
951081306 3:18453439-18453461 ATCCACATGGATTTGGGGCTTGG + Intergenic
952229885 3:31418899-31418921 CACCCTATTGATTTGGAGCTTGG - Intergenic
953312914 3:41897458-41897480 TTGTATAGGGATTTGGAGGTAGG - Intronic
955045864 3:55359092-55359114 CTGCATCTTGAATAGGAGCTGGG + Intergenic
958000804 3:87746436-87746458 CTACATATGGAGCCGGAGCTGGG - Intergenic
958421424 3:93936104-93936126 CAACATATGAATTTGGAGCGGGG - Intronic
960069151 3:113409636-113409658 CTCCATCTGGAATAGGAGCTGGG + Intronic
966125823 3:176575332-176575354 CTTCATTTGTATTTGGTGCTGGG - Intergenic
966377249 3:179308953-179308975 CTGCATAAGGATTAGGAATTGGG - Intergenic
967422254 3:189286570-189286592 CTGCCTATGTATTTGGAATTGGG + Intronic
967568923 3:191004519-191004541 GTGGATATGGATTTGAATCTTGG - Intergenic
968081411 3:195849155-195849177 CTGCATCTTGAATGGGAGCTGGG - Intergenic
968128790 3:196179979-196180001 CTCCAGGTGGAGTTGGAGCTGGG - Intergenic
969038425 4:4274709-4274731 CTGCATGTGGATTTGCCACTGGG + Exonic
970355676 4:15249800-15249822 TTGTATTTGGATTTGGAGCTTGG + Intergenic
971735031 4:30437312-30437334 CTGGAAATGGATTTTTAGCTGGG + Intergenic
971831516 4:31701641-31701663 CAGCAGATGGATGGGGAGCTGGG - Intergenic
973168908 4:47114048-47114070 CTGCATATGCATCTCTAGCTTGG - Intronic
974284777 4:59850102-59850124 CTGCCCATGGATCTGGAGCTAGG + Intergenic
976624271 4:87162346-87162368 CTACATATTGATTTGAAGCCAGG - Exonic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
978766267 4:112408207-112408229 CTGCTTATGGCTATGGACCTTGG - Intronic
981659738 4:147152264-147152286 CTGCTTATGGATTAGGAACAGGG + Intergenic
986525149 5:8665418-8665440 CTGAGTATGCATCTGGAGCTGGG - Intergenic
986674090 5:10168438-10168460 CAGCCTATGGCTTTGGAGCAGGG + Intergenic
988167140 5:27608238-27608260 TTGCATTTGGATTTTGAGTTAGG - Intergenic
988425918 5:31064185-31064207 ATGCAGATGCATTTGGAGGTAGG + Intergenic
988492000 5:31712799-31712821 CTGGAAAAGGATTTGGAGCCTGG + Intronic
988940206 5:36138126-36138148 GAGCATATGGATTAGGAACTAGG + Intronic
991983553 5:72258907-72258929 GTACATATGGATTTGCAGCTGGG - Intronic
993132074 5:83911559-83911581 CTGTATATGGATTGACAGCTAGG + Intergenic
993182584 5:84573202-84573224 CTGCAGAGGAATTTGCAGCTGGG - Intergenic
994874159 5:105393241-105393263 CTGCATATGTAATTGGAGGAAGG - Intergenic
995821163 5:116234485-116234507 ATGCATATGGCTTTGAAGATGGG + Intronic
998068418 5:139177580-139177602 CTGCATAGTGGTTAGGAGCTTGG - Intronic
1000541296 5:162543262-162543284 TTGCATATGCATCTGGAGATGGG + Intergenic
1001891627 5:175344205-175344227 CTGAACCTGGGTTTGGAGCTAGG - Intergenic
1004690915 6:17991338-17991360 AAGCATTTGGATTTGGAGCCAGG + Intergenic
1005297600 6:24441810-24441832 CTGCATTTTTATTTGGAACTGGG + Intronic
1007730995 6:43946389-43946411 GTGAATGTGGATGTGGAGCTGGG - Intergenic
1008385525 6:50885494-50885516 CTGAGTATGGATTAGGAGGTAGG + Intergenic
1011617858 6:89213308-89213330 CAGCTTATGGATTTGGAGTCTGG + Intronic
1012591610 6:100988327-100988349 CTGCACATCGATTTGGATTTGGG - Intergenic
1013940173 6:115651552-115651574 CAACATATGAATTTGGAACTGGG + Intergenic
1014572598 6:123028899-123028921 CTGCCTATGAATTTGGGGGTAGG - Intronic
1014906428 6:127035003-127035025 CTGCATTTGCATCTTGAGCTTGG + Intergenic
1015133045 6:129835834-129835856 CTGCATCTTGATGTGGAGATGGG + Intronic
1015171279 6:130257000-130257022 CTACATATTAATTTGGAGTTGGG - Intronic
1015654578 6:135502842-135502864 CAACATATGCATTTGGAACTGGG + Intergenic
1016367609 6:143336591-143336613 CAGCATATGAATTTGGAAGTGGG + Intronic
1018977195 6:168574581-168574603 CTGCAGATGTGTTTAGAGCTCGG + Intronic
1019870950 7:3760674-3760696 CTGCATTTGGATGTGGTGTTTGG + Intronic
1024252421 7:47516601-47516623 CTGCTTACTGAGTTGGAGCTGGG - Intronic
1024627471 7:51220352-51220374 CTGGCCATAGATTTGGAGCTGGG - Intronic
1025026999 7:55524863-55524885 CTGGTGCTGGATTTGGAGCTTGG - Intronic
1025223226 7:57134111-57134133 CTGCATCTGGAATAGGTGCTGGG + Intronic
1025634031 7:63305778-63305800 CTGCATCTGGAATAGGTGCTGGG + Intergenic
1025648666 7:63442389-63442411 CTGCATCTGGAATAGGTGCTGGG - Intergenic
1025742007 7:64205371-64205393 CTGCATCTGGAATAGGTGCTGGG - Intronic
1025746477 7:64247313-64247335 CTGCATCTGGAATAGGTGCTGGG - Intronic
1026040082 7:66860757-66860779 CTCCCTATGGATTTGAAGCGGGG + Intergenic
1026308185 7:69160719-69160741 CAACATATGGATTTGGGGGTAGG - Intergenic
1027362208 7:77421298-77421320 CTGCACAGGGGTTTGGAGCAAGG + Intergenic
1029226882 7:99034744-99034766 CTGCCTATAGATTTGCTGCTGGG - Intronic
1029515028 7:101018590-101018612 CGGCCTCTGGATGTGGAGCTGGG - Exonic
1030214653 7:107032063-107032085 CAACATATGAATTTGGAGCAAGG - Intergenic
1031505663 7:122578899-122578921 TTGCAAATGGATCTGGTGCTAGG + Intronic
1033038156 7:137894459-137894481 CTGCATATGGAGTTTGAACCAGG - Intronic
1033834885 7:145298186-145298208 CTGGATGTTGTTTTGGAGCTTGG + Intergenic
1036080949 8:5554922-5554944 GTGGAAATGGATTTGGAACTGGG - Intergenic
1036993200 8:13623995-13624017 CTGCACAGGCATTTGGAGTTAGG - Intergenic
1040336751 8:46419947-46419969 CTGCCCATGGCTTTGGAGCAGGG + Intergenic
1040563508 8:48545572-48545594 CTGCAAATGGAGTTGGATATGGG + Intergenic
1041870859 8:62633087-62633109 CAGCATAAGGATTTGTAGTTAGG - Intronic
1042652386 8:71057688-71057710 CTGGAAATGGAATTGGAGTTGGG + Intergenic
1043750731 8:83930463-83930485 CTGTATATGTATATAGAGCTCGG + Intergenic
1050798623 9:9579891-9579913 GTTCATATGGACTTAGAGCTTGG - Intronic
1051493979 9:17698171-17698193 CTGCATCTGGACTTGAAGCCAGG - Intronic
1052506807 9:29365699-29365721 CTCCATATGGATTAGAAGTTTGG - Intergenic
1052915907 9:33924206-33924228 CTGGATATGGATTATTAGCTAGG + Exonic
1056054859 9:82811030-82811052 CTCCATCTTGATTAGGAGCTGGG + Intergenic
1056184474 9:84120202-84120224 CTGCATTTGGATTAAGAGTTAGG - Intergenic
1056401054 9:86227621-86227643 CTGCATAAGATTTTGGGGCTTGG + Intronic
1057320093 9:94004804-94004826 CAGCATATGAATGTGGAGTTGGG + Intergenic
1057868397 9:98699726-98699748 CAGCATCTGGGTTTGGTGCTGGG - Intronic
1058316789 9:103578331-103578353 CTGCATATGGTTATGCAGTTTGG - Intergenic
1058806512 9:108597632-108597654 CTGGATTGGGGTTTGGAGCTGGG - Intergenic
1060055771 9:120411759-120411781 CTGGATATGAATTTTGACCTCGG - Intronic
1062465206 9:136677828-136677850 CTGGATGTGGATTTGGAAGTGGG - Intronic
1185746616 X:2578445-2578467 ATAGATGTGGATTTGGAGCTAGG - Intergenic
1186209563 X:7235133-7235155 AAGCATTTGGATTTGGAGGTTGG + Intronic
1187124146 X:16437720-16437742 CAGCATATGGATAGGGAGGTGGG + Intergenic
1187211731 X:17238635-17238657 CTGCATATGGAGTTGGTGGCAGG + Intergenic
1187278015 X:17833224-17833246 CTTCATATGAATTTCGGGCTGGG + Intronic
1187781949 X:22837290-22837312 CTGGATATGGATTGGAAGGTGGG + Intergenic
1190444263 X:50507428-50507450 CTGAATTTGGATTTGAATCTAGG + Intergenic
1193294463 X:79818526-79818548 CAGAATATGGATAGGGAGCTGGG - Intergenic
1194462054 X:94182999-94183021 TGGCATATGGATGTGAAGCTTGG - Intergenic
1195406063 X:104514519-104514541 CAGCATATGAATTTGGGGCGGGG + Intergenic
1197025266 X:121740290-121740312 CTGCATCTGGATTTGGAGACAGG + Intergenic
1197744424 X:129921677-129921699 CTGCATAGTGATTAGGCGCTGGG + Intronic
1198202640 X:134437205-134437227 CTCCATCTGGATATGGGGCTTGG - Intergenic
1198565645 X:137902387-137902409 AAGCTTATGGATTTGGGGCTAGG + Intergenic
1198974189 X:142317224-142317246 CTGTATATGGTTATGCAGCTAGG - Intergenic
1200087989 X:153619514-153619536 CAGCACATGGCTTTGCAGCTGGG - Intergenic
1201531389 Y:14992697-14992719 TCACATATGGATTTGGTGCTAGG + Intergenic