ID: 1078153705

View in Genome Browser
Species Human (GRCh38)
Location 11:8780112-8780134
Sequence CTGTAAGTATGAATGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078153705 Original CRISPR CTGTAAGTATGAATGGAAGG AGG (reversed) Intronic
902048747 1:13545212-13545234 CTGGAAGGATGAATGATAGGTGG + Intergenic
902701015 1:18172051-18172073 CTGTAAGCATGGCTGCAAGGTGG - Intronic
904048915 1:27626383-27626405 CTGTAAGGATGACTGGACTGGGG - Intronic
905302966 1:36998065-36998087 CTGAATGAATGAATGGGAGGGGG + Intronic
905885950 1:41492050-41492072 AAGTAAGTAGGAATGGAAAGAGG - Intergenic
905929421 1:41776840-41776862 CTGTAAGAGTGAAGGGAGGGAGG - Intronic
910160471 1:84267154-84267176 CAGTAAGAGTGTATGGAAGGAGG - Intergenic
910418150 1:87024144-87024166 CTATCAGGATTAATGGAAGGAGG + Intronic
912729156 1:112086444-112086466 ATGGAAGTATGAATGGAATAAGG + Intergenic
912932028 1:113972784-113972806 TTGTAAGTATGACAGGAAGAGGG - Intronic
915036678 1:152933513-152933535 CTGTAAGTATGCATGTGAGGGGG + Intergenic
915060403 1:153177445-153177467 GTGCTAGTATGAATGTAAGGTGG - Intergenic
915463006 1:156081040-156081062 CTGAGTGTAGGAATGGAAGGGGG - Intronic
920449615 1:206049598-206049620 CTGTAAGGATGAATAGAAAAAGG - Intronic
921382436 1:214538197-214538219 AGGAAAGAATGAATGGAAGGAGG + Intronic
921728835 1:218554078-218554100 CTGTAAGTTTGAGTGGATGAGGG - Intergenic
921917513 1:220628639-220628661 GTGTAAGAATGAATAGAAGAGGG - Intronic
923398465 1:233590919-233590941 CTGTAACTTTGAATGGAATAAGG - Intergenic
1063383276 10:5600120-5600142 CTGGAGGCATGAATGGATGGCGG - Intergenic
1068972058 10:62969447-62969469 CTGTAAGAATGAAAGAAAGATGG + Intergenic
1070430668 10:76334566-76334588 CTGTAAATATTAATGGCTGGAGG - Intronic
1071583206 10:86792727-86792749 CTGGAAATATGAATTCAAGGAGG + Intronic
1071831896 10:89380285-89380307 CAATAAGCATGAATGGAAGGAGG - Intronic
1072689225 10:97560538-97560560 CTGTAACTATGTATGGAAACTGG + Intronic
1073699816 10:105914154-105914176 CTGTTAGTAGGAATGTAAGTTGG + Intergenic
1073764609 10:106668457-106668479 CTGGAAGCATGAATGAGAGGAGG - Intronic
1077796568 11:5498642-5498664 CTGTAACTCTGAAGGGAATGAGG - Intronic
1077911811 11:6578870-6578892 CTGAAAATATGAATGAAAGCAGG - Intronic
1078153705 11:8780112-8780134 CTGTAAGTATGAATGGAAGGAGG - Intronic
1078812019 11:14777654-14777676 CTTTAAGAATGAAGGGGAGGAGG + Intronic
1080640934 11:34157854-34157876 CGGTAAGAAGGGATGGAAGGGGG - Intronic
1081726579 11:45333971-45333993 CTGTTAGCATGAAAGAAAGGGGG + Intergenic
1085048703 11:73368344-73368366 GTGTCTGTATGAATGGAATGGGG - Exonic
1086453658 11:86941147-86941169 ATGTAAATATGTAGGGAAGGTGG - Intronic
1087012950 11:93530543-93530565 CTGTGAGCATGAATGAAAGCAGG - Intronic
1088361122 11:108991156-108991178 CTTTAAGAATGAATGGGAGCAGG + Intergenic
1088989043 11:114935560-114935582 CTGGAGGTAGGTATGGAAGGAGG + Intergenic
1089625036 11:119745807-119745829 CTGCAAGGATGAAGGGGAGGTGG + Intergenic
1089935870 11:122363460-122363482 CTGTAAGACCAAATGGAAGGAGG - Intergenic
1093534709 12:20209755-20209777 CTGTAAGAAGGAAGGGAATGAGG + Intergenic
1094343999 12:29446253-29446275 TTGTAGGGATGAAAGGAAGGAGG + Intronic
1096278310 12:50229762-50229784 CTTTAACTCTGAATGCAAGGAGG - Intronic
1096446853 12:51700886-51700908 TTTGAAGTATGAATGGAAGTTGG + Intronic
1098366853 12:69712454-69712476 CTGTATCTATGAATGAATGGAGG + Intergenic
1099732165 12:86519030-86519052 TCCTAAGTCTGAATGGAAGGCGG + Intronic
1100584228 12:95964500-95964522 CCCTAAGTATTTATGGAAGGGGG + Intronic
1101417897 12:104524571-104524593 GTGGATGGATGAATGGAAGGAGG - Intronic
1106430175 13:29673448-29673470 ATGTAAATGCGAATGGAAGGTGG + Intergenic
1107341166 13:39407922-39407944 TTCTGAGAATGAATGGAAGGTGG + Intronic
1107395840 13:40016363-40016385 CTGGAAGTTTTAATGGTAGGAGG + Intergenic
1111097357 13:83533621-83533643 CTGAAAGAAGGAATGGAATGAGG + Intergenic
1111711600 13:91821845-91821867 CTGTAACTATGAATAGAATCTGG + Intronic
1113762237 13:112857188-112857210 CTGTAAGAATGAAGAGATGGGGG - Intronic
1114823957 14:26054395-26054417 TTCTAAGTATAAATGGCAGGTGG - Intergenic
1115137330 14:30126884-30126906 CTGGAAGTAAGAATGGATTGGGG - Intronic
1119242865 14:73076367-73076389 CTGTAAGTATAACTTAAAGGAGG + Exonic
1120998480 14:90434722-90434744 CAGTAAGTCTTCATGGAAGGTGG - Intergenic
1121554577 14:94826518-94826540 AGGTAGGGATGAATGGAAGGAGG + Intergenic
1122600689 14:102920224-102920246 ATGTATGCATGAATGGACGGTGG - Intergenic
1122794259 14:104198084-104198106 ATGGAAGGATGAATGGAAAGAGG - Intergenic
1122915216 14:104855277-104855299 GTGGAAGGATGAATGGAGGGGGG + Intergenic
1122915282 14:104855487-104855509 GTGGAAGGATGAATGGAGGGGGG + Intergenic
1125779570 15:42252382-42252404 CTGTAAAAATGAATGGGAGCTGG - Intronic
1125931009 15:43600175-43600197 CTGTAAGTATTAATGGACTGGGG - Exonic
1125944173 15:43699991-43700013 CTGTAAGTATTAATGGACTGGGG - Intergenic
1126430314 15:48576549-48576571 CTGGAGGAATGAAGGGAAGGTGG + Intronic
1128739824 15:70075971-70075993 CAGTCAGTATGAATGGACAGGGG + Intronic
1128820341 15:70646700-70646722 CTGAAAGGCTTAATGGAAGGAGG + Intergenic
1135898503 16:26432832-26432854 ATGAATGAATGAATGGAAGGAGG + Intergenic
1139056620 16:63193767-63193789 TTGTAAGTATGAATTGAACATGG - Intergenic
1139188662 16:64836616-64836638 CTGCAACTGTGAATGGAAGGAGG - Intergenic
1141321005 16:83008753-83008775 CTGTGAAGATGAAAGGAAGGAGG - Intronic
1141657925 16:85426008-85426030 CTCTAAGAATGAATGGAAAATGG + Intergenic
1146820910 17:35983025-35983047 ATGGAAGGATGAAGGGAAGGAGG - Intergenic
1147329088 17:39685978-39686000 CTGTAAGTATGAGTGTATGTGGG - Exonic
1150502770 17:65667048-65667070 CTGGAAGTATGCAGGGAGGGTGG + Intronic
1153729917 18:8000507-8000529 ATGTAAATATGAATTGAAGCTGG - Intronic
1156345933 18:36257239-36257261 CTATAAAGATGAATGGAAGCTGG - Intronic
1156379040 18:36540817-36540839 ATGTAAGTATGAATGGGATTAGG - Intronic
1156462799 18:37331119-37331141 CTGGAAGTCTGAATGGAGAGGGG - Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158729294 18:60004412-60004434 CTGTTACTATTAATTGAAGGAGG + Intergenic
1159545494 18:69835588-69835610 ATGTAAGCATGGATGGATGGTGG - Intronic
1161881549 19:6957924-6957946 CTGTAAGTGCAAATGGAAGGAGG - Intergenic
1164941267 19:32253546-32253568 CTGTAAGTTGGAAGGGAGGGAGG - Intergenic
1168383364 19:55942889-55942911 CTGTATGTATTTATGGAAAGCGG + Intergenic
926554758 2:14343379-14343401 CTGTTAGTAGGAATGTAAGTTGG + Intergenic
926628707 2:15117798-15117820 CTGTAAGCAGGAGTGGGAGGAGG - Intergenic
927728006 2:25443117-25443139 CTGTTAGGTTGAATGGATGGAGG + Intronic
929896448 2:45964590-45964612 ATGTAACTGTGAATGGATGGAGG + Intronic
929959802 2:46487944-46487966 CTGATAGTATGAGTGGAGGGGGG + Intergenic
931207007 2:60157535-60157557 CTGAAAGAATGAATGGAAGTTGG - Intergenic
931351395 2:61491959-61491981 CTGTATGTATCAATGGAAATAGG - Intronic
932176004 2:69603032-69603054 AAGTAAGGATGAATGGATGGAGG + Intronic
935136576 2:100309383-100309405 CTCTAAATATGATTGGAGGGAGG - Intronic
935892114 2:107689716-107689738 ATGTAAGTCTGAGTGAAAGGCGG + Intergenic
938200478 2:129368446-129368468 CTCTAATTATGAAGGTAAGGGGG - Intergenic
938965556 2:136385326-136385348 CAGGAAGTATAAATGGAAAGAGG + Intergenic
942127761 2:172844492-172844514 CTGTAAGGAGGAGAGGAAGGAGG - Intronic
942746347 2:179237875-179237897 CTGTAAGTATTAATTGTAAGTGG + Intronic
945486171 2:210398677-210398699 ATGTAGGTATGCATAGAAGGTGG - Intergenic
945567526 2:211420463-211420485 CTGGAAGTATAGATGGGAGGTGG + Exonic
947342203 2:229151943-229151965 CTGCAAGTCTCAATGAAAGGAGG + Intronic
1170910444 20:20561403-20561425 CTGTATGTATGAAAGGAGGCAGG - Intronic
1175297031 20:57915526-57915548 CAGAAAGAAGGAATGGAAGGGGG - Intergenic
1175370143 20:58482861-58482883 CTGTAAGTGCAGATGGAAGGAGG - Intronic
1175447169 20:59031189-59031211 CAGTTAGTAAGAATGGAAGCAGG - Intronic
1175533954 20:59694424-59694446 CTGTAAGTATAAAATGAAAGAGG + Intronic
1177989745 21:28022769-28022791 CTGGAAGACTGTATGGAAGGAGG + Intergenic
1180733461 22:17999386-17999408 CTGGAAGTTTGAGTGGGAGGAGG + Intronic
1181138291 22:20785015-20785037 CTGCAGGGAGGAATGGAAGGAGG - Intronic
1181528536 22:23503001-23503023 ATGGAAGGATGAATGGATGGAGG - Intergenic
1182710231 22:32318017-32318039 CTGTGAGGATGAGTGAAAGGGGG - Intergenic
1182904256 22:33921871-33921893 GTGTGAGAATGGATGGAAGGAGG + Intronic
1184093743 22:42305647-42305669 CTGGAAGGACGAATGGGAGGTGG - Intronic
1185239307 22:49734122-49734144 CTGGAACCATGTATGGAAGGTGG + Intergenic
949515037 3:4800074-4800096 CTGTAGGGATGACTGGAAGCAGG + Intronic
950571102 3:13800562-13800584 CTGTAAGTTCGAGTGGAATGTGG + Intergenic
950662006 3:14472414-14472436 CTGGAAGTCTGACTGGAGGGGGG - Intronic
951625087 3:24651582-24651604 CTGTAAGTATGAATGAGAGCAGG - Intergenic
953060214 3:39421728-39421750 CTGTTAGTATGGAAGAAAGGAGG - Intergenic
953325340 3:42008069-42008091 CTGTAAGTAGGATAAGAAGGGGG - Intergenic
953773903 3:45799589-45799611 ATAGCAGTATGAATGGAAGGAGG - Intergenic
954044008 3:47913813-47913835 CTGTGACTATGATTGGAATGTGG - Intronic
956254509 3:67269698-67269720 CTGTAAGTTTGAGGGGAAAGTGG + Intergenic
959044313 3:101454834-101454856 CTGTAGGTGAGAATGGAAAGTGG + Intronic
961920604 3:130421427-130421449 CTGTAGGTCTGAATGAAATGGGG + Intronic
961995307 3:131235691-131235713 CTGTGAGTATGAATGGGATAAGG - Intronic
962669229 3:137688121-137688143 CTGCTAGAAGGAATGGAAGGTGG - Intergenic
963265857 3:143239349-143239371 CTGAAAGAATGAACGGAAGAAGG + Intergenic
965129270 3:164673980-164674002 ATGAAAGTATGAAGGCAAGGTGG - Intergenic
969197861 4:5577447-5577469 CTATAATTAGGACTGGAAGGTGG + Intronic
971780110 4:31022654-31022676 CTGAAAGTAGGAATGGAGGAAGG - Intronic
973555118 4:52074767-52074789 TTATAAGTATGAATGGTGGGGGG + Intronic
974730126 4:65853022-65853044 CTATAGCCATGAATGGAAGGTGG - Intergenic
976173334 4:82326892-82326914 CTTTCAGTATCCATGGAAGGAGG - Intergenic
977917806 4:102613402-102613424 CTGTGAGAAAGAAAGGAAGGAGG - Intronic
978328633 4:107587301-107587323 ATGTAAGTATTCAAGGAAGGAGG - Intergenic
979173530 4:117632751-117632773 CTGTTGGTAGGAATGGAAGCAGG + Intergenic
979463512 4:121009770-121009792 CAGTAAGTATGCTTGTAAGGTGG - Intergenic
980461554 4:133121598-133121620 CAGTAAGTATGAATAAAAGAGGG - Intergenic
983944772 4:173573296-173573318 ATGGAAGTAAGAATGGAAGAGGG - Intergenic
985111445 4:186550599-186550621 CAGTAAATATTAATAGAAGGAGG + Intronic
986624692 5:9712784-9712806 GTGTATGTATGAAAGGAATGTGG + Intergenic
986635000 5:9812448-9812470 CTCTAAGTGTGAAGGTAAGGGGG + Intergenic
986928686 5:12792363-12792385 CTGTAAGTGTGGATGGTATGGGG + Intergenic
987845204 5:23274911-23274933 ATTTAAGTATCAATGCAAGGCGG + Intergenic
988713836 5:33804801-33804823 CTATAGGAATGAATGGAATGGGG - Intronic
994039368 5:95240826-95240848 CTGTAAGTATGAAAAGAATGTGG - Intronic
997184383 5:131866732-131866754 CTGACAGTATGCATGGAAGCAGG + Intronic
997374287 5:133385692-133385714 CTGTAATTAAAAAAGGAAGGAGG - Intronic
999707493 5:154286872-154286894 CACTATTTATGAATGGAAGGAGG - Intronic
1001763587 5:174227052-174227074 CAGTAAGAATGAATGGATGTTGG - Intronic
1002643009 5:180639512-180639534 ATGGAAGGATGAATGGATGGTGG + Intronic
1002877051 6:1220014-1220036 CTGTAGGTATGAAGGTAGGGAGG + Intergenic
1003134450 6:3423566-3423588 CTGTAAGTTAAAAAGGAAGGAGG + Intronic
1005639180 6:27778524-27778546 CTGTAAGTATGGAAGGAGGAGGG - Intergenic
1008618406 6:53247743-53247765 CTGTAGGAATGAGTGTAAGGTGG + Intergenic
1008918612 6:56818283-56818305 CTGTTATCATGAAGGGAAGGAGG + Intronic
1009338112 6:62519008-62519030 CCGTCAGAATGAAGGGAAGGAGG - Intergenic
1012014535 6:93834524-93834546 CTAGAAGGAGGAATGGAAGGTGG + Intergenic
1013981485 6:116134833-116134855 CTGAAAGTAGGCATGGTAGGAGG + Intronic
1015858401 6:137650011-137650033 CAGTAACAAAGAATGGAAGGAGG + Intergenic
1015891065 6:137970103-137970125 ATGGAAGGATGGATGGAAGGAGG + Intergenic
1016317773 6:142808768-142808790 ATGGAAGGATGAATGGATGGAGG + Intronic
1017349523 6:153423254-153423276 CTGTCAGTAAGAAAGGAAGATGG - Intergenic
1017988994 6:159470041-159470063 CTGTCAGTGTGAATGGAGGCAGG - Intergenic
1018522108 6:164661558-164661580 CTCTAAATATAAATGGAAAGAGG - Intergenic
1018618787 6:165711127-165711149 CTTTAAGCATGAAGGGGAGGCGG + Intronic
1020672371 7:11132700-11132722 CTGTTAGTAGGAATGTAAGTTGG - Intronic
1026794442 7:73357602-73357624 CTGGAAGTCTGACTGGAAAGGGG + Intronic
1027784534 7:82564344-82564366 CTGGAAGTGGGAATGGGAGGAGG + Intergenic
1029017354 7:97327987-97328009 TTGTAAGTATAATTGGAAGGTGG + Intergenic
1030821456 7:114097658-114097680 GTGGAAGTGGGAATGGAAGGTGG - Intronic
1031986923 7:128169252-128169274 CTGTGAGAATGTCTGGAAGGGGG - Intergenic
1032393761 7:131574408-131574430 ATTTAAGCAGGAATGGAAGGCGG - Intergenic
1032643937 7:133800075-133800097 CTGTAAGTATAAATGTAGAGAGG - Intronic
1033040301 7:137911540-137911562 CTGAAAGTATGAATGGGACCGGG + Intronic
1035106586 7:156446348-156446370 CTTAAAGTGTGAATGGAAGCTGG + Intergenic
1035765489 8:2101585-2101607 ATGTTGGTGTGAATGGAAGGAGG - Intronic
1037075310 8:14709444-14709466 CTTACAGTATGAATGGAAGGAGG + Intronic
1037400168 8:18487699-18487721 CTGTAAGTAGGAATGTAGGATGG + Intergenic
1039738090 8:40354025-40354047 CTGGAAGGATGAGTGGGAGGTGG + Intergenic
1039928995 8:41965866-41965888 CTGAAAGTAGGAATGGTAGGTGG + Intronic
1041143983 8:54852413-54852435 CTGGAAGTATGTTTGAAAGGGGG + Intergenic
1041174596 8:55181445-55181467 CTGGAAGGATGAAAGGAAGGAGG - Intronic
1041276274 8:56161531-56161553 CTGTAACTCAGAATGGAAAGTGG - Exonic
1043682627 8:83048808-83048830 CTGTAATTATGAATGGTTAGCGG - Intergenic
1044891412 8:96840182-96840204 CTGTAAATATCAAAGCAAGGTGG + Intronic
1045960816 8:107965895-107965917 ATGTAACTATCAAAGGAAGGCGG + Intronic
1046132943 8:109990831-109990853 CTATAGGTAGGAATCGAAGGAGG + Intergenic
1047181610 8:122593969-122593991 CTGAAAGGATCAATAGAAGGAGG - Intergenic
1047347814 8:124045489-124045511 CTGAAAGTATGTATGCAAAGAGG + Intronic
1047893007 8:129333797-129333819 CTCTCAGTAAGAATGGAAGAAGG + Intergenic
1048812059 8:138297660-138297682 CTGGGAGTATGAAGAGAAGGAGG + Intronic
1051899900 9:22026332-22026354 CTGTAAGGATGAATGGGATCGGG + Intronic
1055357926 9:75456593-75456615 CTGTAAGTATGTGTGAAAAGGGG + Intergenic
1058553059 9:106136386-106136408 CTGTGAGAATGCATGGGAGGAGG - Intergenic
1058737231 9:107904891-107904913 CTGAAAGAATGCTTGGAAGGAGG + Intergenic
1059043505 9:110840257-110840279 CTGTAAAGCTGAATGTAAGGTGG + Intergenic
1059927997 9:119230934-119230956 AGGTAAGGATGAATGCAAGGAGG - Intronic
1060229784 9:121818171-121818193 CTGTGAGATTGAATGGGAGGGGG + Intergenic
1060983751 9:127808310-127808332 CAGTAAGTCTGATTGGAATGGGG + Exonic
1061981025 9:134103720-134103742 CTGGAAGGATGGATGGATGGTGG - Intergenic
1185711667 X:2308797-2308819 AAGCAAGAATGAATGGAAGGAGG + Intronic
1187956551 X:24524327-24524349 CTGGAAGTAGGTATGGAAGCTGG + Intronic
1194589771 X:95785639-95785661 CTGTAAGAATGTATGAAAGCAGG + Intergenic
1196830093 X:119768979-119769001 TTGTCAGAATGAAGGGAAGGAGG - Intergenic
1197708543 X:129650660-129650682 CAGTAAGTATGGATGGAACAAGG + Intronic
1199474350 X:148229300-148229322 TTGGCAGGATGAATGGAAGGGGG - Intergenic
1199663386 X:150076520-150076542 CTGTTAGTGGGAATGGAAGATGG - Intergenic