ID: 1078154905

View in Genome Browser
Species Human (GRCh38)
Location 11:8791035-8791057
Sequence CTTTGGGAACAGATTCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 235}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078154905 Original CRISPR CTTTGGGAACAGATTCAGGA AGG (reversed) Intronic
900466758 1:2829409-2829431 CTTTGGGAACAGAAAAGGGAAGG - Intergenic
904448221 1:30592283-30592305 ATTTTGGAAGAGATTGAGGAGGG - Intergenic
904616072 1:31750638-31750660 CTCTGGGACCAGCCTCAGGAAGG - Intronic
904970605 1:34416752-34416774 TTTCGGGAACAGATTCATAAGGG + Intergenic
906849385 1:49231585-49231607 CTTTTGCATCAGATTCAGGCTGG - Intronic
908909920 1:69061603-69061625 CTTTAGGAACAGTTTAGGGAGGG - Intergenic
910536021 1:88298589-88298611 CACTGGGAACAGACTTAGGAAGG - Intergenic
911510736 1:98805459-98805481 CATTGGGAACAGACTAGGGAGGG + Intergenic
911724133 1:101223908-101223930 CTTTGGGAAGTGATTGAGGATGG + Intergenic
912245327 1:107956142-107956164 CTATGAGCACAGATGCAGGAAGG + Intronic
912781921 1:112558753-112558775 CTTTGGGCCTATATTCAGGAGGG + Intronic
913121058 1:115741184-115741206 ATTTGGAAACAGATTTTGGAGGG - Intronic
913334654 1:117698147-117698169 GATTGGGAACAGCTTCAAGAAGG + Intergenic
914264100 1:146022802-146022824 CTTTGGGAGCTGAGGCAGGAGGG + Intergenic
914334887 1:146705049-146705071 CCTTCGGAACAGATGCAGGATGG - Intergenic
915447009 1:155979605-155979627 CTTTGGGGCCAGAATCAGGCAGG - Intronic
915719729 1:157975914-157975936 CTGTGGGTATACATTCAGGAAGG - Intergenic
915932512 1:160069237-160069259 GTTAGGGAACAGATGAAGGATGG - Intronic
917449138 1:175132232-175132254 TTTGGGAAACAGATTCAGTAGGG + Intronic
922788797 1:228298245-228298267 CTTTGAGAAGAGATCCAGGATGG + Intronic
922789459 1:228303159-228303181 CTCTGAGAAGAGATCCAGGATGG + Intronic
923035220 1:230280754-230280776 CTTTGGGGAAAGAATTAGGAAGG + Exonic
924681138 1:246235366-246235388 CTTTTGCAACATATTCAGGAAGG - Intronic
1063040515 10:2332811-2332833 CCTTGGGAAGAGCTCCAGGAAGG - Intergenic
1064107595 10:12513193-12513215 CTTGTGGAGCACATTCAGGAAGG - Intronic
1064642905 10:17432333-17432355 TTTTGAGAATAGATTCTGGAAGG + Intronic
1064786353 10:18901427-18901449 TTTTGAGAACAAATTCAGAAGGG - Intergenic
1068462447 10:57345001-57345023 GTTTGGGATCAGAATCAGAATGG - Intergenic
1068852835 10:61764024-61764046 CCTTGGGAAAAGGTTCATGAAGG - Intronic
1070663925 10:78330132-78330154 CTTTGGGAAAAAAGCCAGGAGGG - Intergenic
1070841232 10:79489374-79489396 CTCTGGGAACAGATTGAGCCAGG - Intergenic
1072219613 10:93316358-93316380 ACTTGGGAACAGGTTGAGGAGGG + Intronic
1074102395 10:110364148-110364170 CCTCGGGAACATATGCAGGAAGG + Intergenic
1074493219 10:113957081-113957103 GTTTGGGAACAGCCTCAGTAGGG + Intergenic
1074958738 10:118419203-118419225 CTTTGACAACAGATTCCTGAAGG + Intergenic
1075277337 10:121105999-121106021 CTTTGGCAACACATTCATGGAGG + Intergenic
1075439452 10:122467830-122467852 TTTTGGAAACACATTCAGAATGG - Intronic
1075554782 10:123422496-123422518 CCCCGGGTACAGATTCAGGATGG + Intergenic
1075667025 10:124238674-124238696 TTTTGGGAACAGAATGACGAAGG - Intergenic
1075946116 10:126434642-126434664 CTTTAGTAGGAGATTCAGGAAGG - Intronic
1076021436 10:127076944-127076966 CTTTGAGAACAGAGGCAGGGAGG + Intronic
1077468723 11:2746871-2746893 CACTGGGGACAGATCCAGGAAGG + Intronic
1077949126 11:6935459-6935481 CTGAGGGAACAGATTCATGCAGG + Intronic
1078154905 11:8791035-8791057 CTTTGGGAACAGATTCAGGAAGG - Intronic
1079767450 11:24412925-24412947 TTTTGGGAACAGTTTCCAGAAGG + Intergenic
1081691989 11:45084956-45084978 CTTTGGGGAGAGAATCAGAAAGG + Intergenic
1082990684 11:59205134-59205156 CCATGGGAACAGACCCAGGATGG - Exonic
1083953042 11:65967346-65967368 CTCGGGGACCAGACTCAGGATGG + Exonic
1085508607 11:77074071-77074093 CTTAGGGAGCAGATGGAGGATGG + Intronic
1086832517 11:91583261-91583283 TTTAGGGAACAAATTGAGGAGGG + Intergenic
1087550729 11:99644915-99644937 GTTTGGAAACAGTTTCTGGAAGG - Intronic
1089772171 11:120811067-120811089 ATTTGGGAACAGGATCAGGCAGG + Intronic
1091224424 11:133949102-133949124 CTTTGGGAAGAGATGCTGGGAGG - Intronic
1091534724 12:1395045-1395067 CTTTGAGAACAGATACAGCTGGG + Intronic
1091569094 12:1669052-1669074 CTTTGGAAAGAAATTCAGCAAGG - Intergenic
1093720172 12:22431921-22431943 TTTTTGGAATAGTTTCAGGAAGG - Intronic
1093842839 12:23926002-23926024 CTGTGAGAACAGACTCAGTAAGG + Intronic
1094211599 12:27899101-27899123 CTTTGGGAACAGGGAGAGGATGG - Intergenic
1095359021 12:41313252-41313274 CTTTTGTAACAGATGAAGGATGG - Intronic
1095909746 12:47414216-47414238 CTTCAGGAACAATTTCAGGAAGG + Intergenic
1096329396 12:50697082-50697104 ACTTTGGAACAGACTCAGGAAGG - Exonic
1098208076 12:68133930-68133952 CTTTGGGGTCAGCTACAGGAAGG + Intergenic
1098696907 12:73571211-73571233 CTTTGGTACCAGACTAAGGATGG - Intergenic
1100593236 12:96049100-96049122 CTTTGGGAACAGAGTGAGAAAGG - Intergenic
1101547621 12:105731372-105731394 ATTTGGGGCCAGATTCTGGAAGG + Intergenic
1101883229 12:108640120-108640142 CTCTGAGAACAGATTCAAGTGGG + Intergenic
1102599733 12:114020707-114020729 CTCTGGGAACAGAGACAAGAAGG + Intergenic
1107361475 13:39622562-39622584 CTTTTGGAATAGTTTCAGTAAGG - Intergenic
1108824037 13:54390162-54390184 CTTGAGGAACAGTCTCAGGAGGG + Intergenic
1109486831 13:63034742-63034764 CTTTGGGTACAATTTAAGGAGGG + Intergenic
1110785834 13:79524587-79524609 CATAGCAAACAGATTCAGGATGG + Intronic
1111412629 13:87896238-87896260 CAGTGGGAGCAGAGTCAGGATGG - Intergenic
1111808971 13:93074063-93074085 ATTTTGACACAGATTCAGGAGGG - Intergenic
1112093377 13:96106673-96106695 ATTTGAGTACAGATACAGGATGG + Intronic
1112333977 13:98498951-98498973 CTTTGAAAACAGCTTCAGGCAGG + Intronic
1112945175 13:104919506-104919528 CTTTAACAACAGATTTAGGAAGG + Intergenic
1115683298 14:35766096-35766118 CTTTAGGATCAGATACTGGAGGG + Intronic
1115996529 14:39201323-39201345 TTTTGGTAACAGTTTCAGGAAGG - Intergenic
1117369660 14:55065398-55065420 CTTTGGGAAGAGCTCGAGGAAGG + Exonic
1117720672 14:58625908-58625930 CTTTGGGAAGAGAAGCGGGATGG + Intergenic
1118728088 14:68644595-68644617 CTTTAGGCAGAGATTCAGGAAGG - Intronic
1119792112 14:77360690-77360712 CTTTGGGTATATATTCAGAATGG + Intronic
1120866510 14:89299750-89299772 CTTTGGCAACAGTTTCACGGAGG + Intronic
1121191624 14:92035829-92035851 CTTTGGGAGCACTTTGAGGAGGG - Intronic
1121449024 14:93996205-93996227 CCTTGGGTTCAGACTCAGGAGGG - Intergenic
1121696874 14:95920792-95920814 CTTAGGGCACATATCCAGGAAGG - Intergenic
1122110223 14:99494934-99494956 CTTTGGGAAATGATTCTGAATGG - Intronic
1122385393 14:101341843-101341865 CTTTGGAAACTGATTCAGTGTGG - Intergenic
1123901800 15:24884460-24884482 GATTGGGTACAAATTCAGGAAGG + Intronic
1124490675 15:30153151-30153173 CTATGGGACCAGGTTCAGGGAGG - Intergenic
1124752858 15:32385178-32385200 CTATGGGACCAGGTTCAGGGAGG + Intergenic
1125327668 15:38553435-38553457 CTTTGGCAACAGATTATGTAAGG - Intronic
1125373821 15:39006653-39006675 CTTTGGGTACACATCCAGTATGG - Intergenic
1125385367 15:39131013-39131035 GTTTGGGAACAGATTGTGTAAGG - Intergenic
1128052100 15:64673681-64673703 CTTACGGAACAGATTCTGCATGG + Intronic
1128499728 15:68219585-68219607 CTTTGGGAAAAGCTTCATCAGGG - Intronic
1128592535 15:68913620-68913642 CTTGGGGTACAGTTTCAGCAGGG - Intronic
1130765968 15:86871564-86871586 CTTAGTGAACAGAGTGAGGAAGG - Intronic
1133008500 16:2897579-2897601 CTTGGGGAACATAGTCAGGTGGG + Intronic
1133129637 16:3668878-3668900 CTCAGGAAACACATTCAGGATGG + Intronic
1133985432 16:10664716-10664738 ATTAGGAAACAGATTCAGAAGGG + Intronic
1134278066 16:12794200-12794222 CTTTGGGGGCAGTTTCAGCACGG + Intronic
1134865204 16:17600709-17600731 CTTTGGGAACAAATATAGGAAGG + Intergenic
1135909595 16:26546988-26547010 TTCTGTGGACAGATTCAGGAAGG + Intergenic
1137543192 16:49378472-49378494 CTTAGGAAAGAGATTCAGGAAGG + Exonic
1139998736 16:71006187-71006209 CCTTCGGAACAGATGCAGGATGG + Intronic
1143336630 17:6176391-6176413 CTTTGAGAGGTGATTCAGGAGGG - Intergenic
1143588327 17:7863628-7863650 ATTTAGAAACAGTTTCAGGATGG - Intronic
1146487128 17:33252100-33252122 GATTGGGAGAAGATTCAGGAGGG - Intronic
1148492715 17:48033575-48033597 CCTTGGGACCAGATCCAGGTTGG + Intronic
1149123279 17:53196272-53196294 CTCTGGGAAGAGAGGCAGGATGG + Intergenic
1150976917 17:70097869-70097891 CCTAGGAAACAGATTCAAGAGGG - Intronic
1151006137 17:70438212-70438234 GTCTGGGAACAAATACAGGAAGG - Intergenic
1152331159 17:79674130-79674152 CTGGGGGAACAGATTCAGAGAGG + Intergenic
1155771537 18:29706821-29706843 CTTTTGGAATAGTTTCAGTAGGG + Intergenic
1155871922 18:31041202-31041224 CTTTGCGAAGGGATTGAGGATGG - Intronic
1156995231 18:43457787-43457809 ATTTGGGAAGTGAGTCAGGAAGG - Intergenic
1157260679 18:46173689-46173711 CTTTCGGAAGGGCTTCAGGAGGG + Intronic
1160084810 18:75766696-75766718 ATTTGAGAATATATTCAGGAGGG + Intergenic
1160233121 18:77063759-77063781 CTCTTGGAAAAGATTAAGGAGGG + Intronic
1162574651 19:11492000-11492022 CTTTGGGAAAAAATAAAGGAGGG - Intronic
1163187542 19:15649598-15649620 CTTTGTGGACAGCTTCAGGAAGG + Intronic
1163189561 19:15666657-15666679 CTTTGTGAACAGTTTCAGGAAGG + Intergenic
1163229674 19:15992749-15992771 CTTTGTGGATAGTTTCAGGAAGG - Intergenic
1167772385 19:51529521-51529543 CTTGGGGAGGAGATTCTGGAGGG - Intronic
926124895 2:10265890-10265912 CTTTGTCAACAGTTTGAGGAAGG + Intergenic
926235250 2:11037154-11037176 CTTTTGGAATAGTTTCAGTAGGG + Intergenic
926308912 2:11660299-11660321 GTTTGAGAAGAGATTCAGGTCGG - Intronic
926973194 2:18487147-18487169 CTTTGAGAACAGCTGCAGTACGG + Intergenic
927031413 2:19123997-19124019 CTTTGGGGACAGGCTCAGGATGG - Intergenic
927386844 2:22544373-22544395 CTTTGGGAACAGATTTTGACTGG - Intergenic
928732680 2:34250650-34250672 CTGTGGGAGAAGATGCAGGAAGG + Intergenic
928986359 2:37186151-37186173 CTTAGGGAACAGCTTCTGGAAGG - Intronic
929277625 2:40042924-40042946 CTTTTGGAACAAAATCAGGACGG + Intergenic
929903023 2:46022304-46022326 CTTTAGAATCAGATTCTGGAGGG - Intronic
930039691 2:47111359-47111381 ATTTTGAAACACATTCAGGAGGG + Intronic
930487484 2:52026309-52026331 CATTGGGAACAGAGACGGGAGGG + Intergenic
932089665 2:68794822-68794844 TTTTTGGAACAGTTTCAGGAGGG + Intronic
934667963 2:96187056-96187078 CTTTGGGAACACATTCCGGGAGG - Intronic
935351983 2:102158957-102158979 TTTTGGGAACAGAACCAAGAGGG + Intronic
936005981 2:108888417-108888439 TTTTTGGAATAGTTTCAGGAGGG + Intergenic
936780586 2:116028134-116028156 CTCTGAGAAGAGCTTCAGGATGG + Intergenic
938239026 2:129728672-129728694 CATTGGGAACAGCTCTAGGAGGG + Intergenic
940136117 2:150437326-150437348 GTTTGGGAACAGATTGTGGAAGG + Intergenic
941513393 2:166441501-166441523 AATTCGGAACACATTCAGGAAGG + Exonic
942272158 2:174287245-174287267 GATTGGGAACAGGTTCAGGTTGG + Intergenic
943708445 2:191061297-191061319 GATTGGGGACAGATTCTGGAAGG - Intronic
943994587 2:194745115-194745137 CTTTGGAAACAAAATCAGCATGG - Intergenic
947498971 2:230658690-230658712 CTTTGGGAAGAGCTTGAAGAGGG - Intergenic
947536473 2:230942961-230942983 CTAGGGGAACAGAAGCAGGATGG - Intronic
949076014 2:242058350-242058372 CTCTGGGAACAGCTGCAGGCAGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169266976 20:4172721-4172743 TTTTGGGAACCGATTCTGCACGG + Intronic
1169280007 20:4259020-4259042 CTTTGAGAAAAGATTCAATAAGG + Intergenic
1169458149 20:5770872-5770894 CATGGCAAACAGATTCAGGATGG + Intronic
1169839137 20:9915450-9915472 CTTTGGGAAGAGGTTCAAGTAGG + Intergenic
1170553208 20:17494730-17494752 CTTTGGGAAACTATACAGGAAGG - Exonic
1170881319 20:20298723-20298745 ATTTGGGAACAGCATGAGGAAGG + Intronic
1173734114 20:45347752-45347774 TATTGGGAAGAGATTCAGAAGGG + Intronic
1175994035 20:62804548-62804570 CTTTGGGGACATTTTCGGGAGGG + Intergenic
1177264559 21:18765598-18765620 AGTTGGGAACAGATAGAGGAAGG - Intergenic
1177910426 21:27024471-27024493 CTTTGCTAACAGATGCAGGGAGG + Intergenic
1179610244 21:42545587-42545609 ATTTGAGAACAGCTTCAGAAAGG - Intronic
1181103625 22:20558251-20558273 CTTTGGGAAAGGTGTCAGGAAGG - Intronic
1182012145 22:27009996-27010018 CTTAGGGAAAAGAAACAGGAAGG + Intergenic
1184080964 22:42219940-42219962 CTTTCTGAACAGTTTCAGAAGGG + Intronic
949535595 3:4993770-4993792 ATAAGGAAACAGATTCAGGAAGG - Intergenic
949624111 3:5848739-5848761 CCTTGGGAACATTTCCAGGAGGG + Intergenic
950542429 3:13620431-13620453 ATTTGGGAACAGATTCAGCCAGG - Intronic
950604373 3:14065045-14065067 CTTTGGGTGCAGAGCCAGGAGGG + Exonic
951335750 3:21419482-21419504 CTTTGAGAGCAGTTTCAGGAAGG + Exonic
951900044 3:27647721-27647743 CATTGGGAACTGTTTCAGGTTGG + Intergenic
952906218 3:38140681-38140703 CCCTGGGAATAGCTTCAGGAAGG - Intronic
953537206 3:43785549-43785571 CTTTGGGAATAGAATCAAGAAGG - Intergenic
954006836 3:47597915-47597937 CTTTGGGAACAGATGTAGGCTGG + Intronic
954293989 3:49664101-49664123 CTTTGGGCAGAGAAGCAGGAAGG + Intronic
954578215 3:51688514-51688536 CTTTTGAAAAAGATTCTGGACGG - Intronic
956733154 3:72215181-72215203 TCTTGGGGACAGATTCAGGTAGG - Intergenic
957971001 3:87381909-87381931 CTTTGGTAGCAGATTCAGTTAGG + Intergenic
961620047 3:128216844-128216866 CTTTGGGAAGGGATGCAGGCAGG + Intronic
964608868 3:158588766-158588788 TTTTGAGACCACATTCAGGATGG + Intronic
967102570 3:186228458-186228480 CTTTTTGAACAGATTAATGAAGG - Intronic
967371949 3:188756583-188756605 CTTTAGGGAGAGATTCAGAATGG - Intronic
968799075 4:2730219-2730241 CTTTGGTGTCAGTTTCAGGAAGG + Intronic
969180092 4:5433668-5433690 CTGTGGAAACAGATCCTGGAAGG + Intronic
969458819 4:7316757-7316779 TTTTGGTAACACATTCAGAATGG - Intronic
970294489 4:14614008-14614030 CCTTGGGCACAGTGTCAGGATGG + Intergenic
970742320 4:19252322-19252344 CTGTTGGCACAGAGTCAGGAGGG - Intergenic
970840429 4:20462194-20462216 CTTTGGGATGAGCTTCAGAATGG + Intronic
972591840 4:40495293-40495315 TTTAGGGAACAAATTGAGGAGGG - Intronic
973091880 4:46147386-46147408 ACTTGGGAGCAGAATCAGGAGGG + Intergenic
973129504 4:46633063-46633085 TTTTGGGAATAGTTTCAGTAGGG + Intergenic
978789733 4:112648653-112648675 CTTTGGGAACTAGTTCAGGAAGG - Intronic
979459218 4:120961727-120961749 CATTGGCAACAGATTCTGAAAGG - Intergenic
980253437 4:130347659-130347681 TTTTGGGAACAAAATAAGGAAGG - Intergenic
980467224 4:133201934-133201956 CTTTGGGAGCAGAGTGAAGAAGG + Intronic
981932918 4:150209667-150209689 ATTTGGAAACAGACACAGGATGG + Intronic
983205062 4:164902895-164902917 CAGTGGGAACAGGGTCAGGAGGG + Intergenic
984491146 4:180436634-180436656 CTCTGGGAACAATTTCAGGAAGG + Intergenic
985147898 4:186913335-186913357 CTTTGGGAACAGGTACCTGAGGG + Intergenic
985691165 5:1313478-1313500 CTTTGGGCACAGACCCAGGGGGG - Intergenic
986926791 5:12764295-12764317 ATTTGGGGACAAATTCAGAAGGG + Intergenic
987474400 5:18373091-18373113 CTTTGGAAGCAGAATCAGGAGGG + Intergenic
987860610 5:23482859-23482881 CTTTGGAGCCAAATTCAGGAAGG + Intergenic
990032504 5:51278654-51278676 CTTTTGGCTCACATTCAGGATGG + Intergenic
995305000 5:110635277-110635299 TTTTGGGAATAGTTTGAGGAGGG - Intronic
995750814 5:115451707-115451729 CTCTGGGCACAGACTCAGGTGGG + Intergenic
996575129 5:124970814-124970836 CCTTGGGAACAGACTGGGGAGGG + Intergenic
1000842443 5:166237855-166237877 CTTTGGGATCAGGGTAAGGATGG - Intergenic
1001747915 5:174106132-174106154 TTTTGGAAAGAAATTCAGGAAGG + Intronic
1002772374 6:300984-301006 CTTTGGCAACAGAGGCAGCAGGG - Intronic
1003079902 6:3013609-3013631 CCTTGTGAACAAATACAGGAAGG - Intronic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1010756763 6:79674053-79674075 CTTTGGAAACAGAAGTAGGAAGG + Intronic
1011368019 6:86602539-86602561 CATTGGGAACAGACTAGGGAGGG + Intergenic
1012836186 6:104271179-104271201 CTCTGGGAACTGAGTTAGGATGG + Intergenic
1013580478 6:111529387-111529409 CTTTGAGTAGAGAATCAGGAAGG - Intergenic
1014262729 6:119238146-119238168 CTTTGGGGACAAAGTCAGCATGG - Intronic
1014820708 6:125986104-125986126 CTTTGGGAACTGATTTAGTTGGG - Intergenic
1015777256 6:136826124-136826146 ATATGGCAACAGATTCAGAAAGG - Intronic
1015846725 6:137528111-137528133 CTTTGGGATGAGATTCAGGTGGG - Intergenic
1016551953 6:145291622-145291644 CTCTGGGAGAAGATTCTGGAAGG - Intergenic
1016675087 6:146755824-146755846 ATTGGGGAAAAGGTTCAGGAAGG - Intronic
1017449652 6:154542754-154542776 CTTTGGGAACTAATTCAGGAAGG - Intergenic
1017554982 6:155554088-155554110 CTGTGGGAGCATATTCAGGTTGG + Intergenic
1017675533 6:156809986-156810008 CTGAGGAATCAGATTCAGGAGGG + Intronic
1017923481 6:158890861-158890883 CTTTGGGGAAAAACTCAGGAAGG - Intronic
1018781506 6:167071043-167071065 CTTTTGGAATAGTTTCAGTAAGG + Intergenic
1019101782 6:169636913-169636935 GTTTGGCAGCAGCTTCAGGAAGG - Intronic
1019303457 7:321393-321415 CTTTGGGGAGAGATCCAGGGAGG - Intergenic
1021827800 7:24572766-24572788 CTTTGGGAAAAAATTAATGAAGG + Intergenic
1024093061 7:45963128-45963150 CTTTGGAATCAGGATCAGGATGG + Intergenic
1029412699 7:100426048-100426070 ATTTGGGAACACATTCTGAATGG - Intronic
1029493960 7:100887292-100887314 GTTTGGGAACAGAGGAAGGAAGG - Intronic
1030390487 7:108921367-108921389 CTTTGGAAACTATTTCAGGAAGG - Intergenic
1033439225 7:141363768-141363790 CTTTGAGAATAGCCTCAGGAAGG - Intronic
1035634245 8:1131517-1131539 CTTTGGGAAGTGATTCGGGTGGG - Intergenic
1037688607 8:21164339-21164361 CTTGGGAAACAGATCAAGGAAGG - Intergenic
1038760179 8:30378654-30378676 CTTTGGGATCAGGTGGAGGATGG - Intergenic
1043951923 8:86318928-86318950 CTTTGGTAAGTGATTCCGGAGGG + Intronic
1044389598 8:91633868-91633890 CTTTGGGAAGAGCTGCAGGCTGG + Intergenic
1045298049 8:100889359-100889381 TTTAGGGAACAGATTCTGGAAGG + Intergenic
1045357976 8:101406100-101406122 CTTAGGGAACAGGTTCAGGCTGG - Intergenic
1045686840 8:104721330-104721352 CTTTGGGAAATAATTCATGAGGG - Intronic
1047400359 8:124541268-124541290 ATTTGGGAAAAGAGTCAGAATGG - Intronic
1048826542 8:138432961-138432983 CTCTGGGAACAGATTTTGGATGG - Intronic
1049654016 8:143789848-143789870 CTTCGGGAGCAGACGCAGGAGGG + Intergenic
1056113502 9:83420084-83420106 TTTTGGGAACAGAGCCATGAAGG - Intronic
1056304340 9:85274275-85274297 CTTTTGGTCCAGCTTCAGGATGG + Intergenic
1056560007 9:87721877-87721899 CCTTGGAAAGACATTCAGGAAGG + Intergenic
1057678669 9:97155190-97155212 CTCTGGGCACACATGCAGGAAGG - Intergenic
1058568008 9:106307715-106307737 TTTCTGAAACAGATTCAGGAAGG - Intergenic
1058727832 9:107820190-107820212 GTTTGAGAACAGAATCACGAAGG + Intergenic
1058999898 9:110337473-110337495 CCATGGGATCAGATACAGGATGG + Intronic
1060500903 9:124154302-124154324 CTTTTGGAACAGTTTCAGTAGGG - Intergenic
1061345071 9:130017225-130017247 CTTTGGCAACAGCTTAGGGAAGG - Intronic
1203786355 EBV:130086-130108 CTTTGGGCACTGGTTAAGGATGG + Intergenic
1185934290 X:4238259-4238281 TTTTGGGACCAAATTCAGGAGGG - Intergenic
1186350455 X:8733739-8733761 CATTGTGAAGAGTTTCAGGATGG - Intergenic
1187049146 X:15678834-15678856 CTTTGGGGACACATTCAGACTGG + Intergenic
1188536709 X:31204579-31204601 CTGTGGGAACACATACATGATGG - Intronic
1193395185 X:80975498-80975520 ATTTGTGACCAGAGTCAGGATGG + Intergenic
1194911782 X:99654094-99654116 TTTTGGATCCAGATTCAGGAGGG - Intergenic
1196677151 X:118431607-118431629 CTTTGGGATCACATTCAAAAAGG - Intronic
1198387093 X:136139325-136139347 TTTTGACAATAGATTCAGGATGG + Intergenic
1198810295 X:140529159-140529181 CTTTAGGAACACACCCAGGAGGG + Intergenic
1199064847 X:143403984-143404006 TTTTGGGTACATATTAAGGAAGG + Intergenic
1200833794 Y:7713046-7713068 CTGTGGAAACAGCTTCAAGATGG + Intergenic