ID: 1078157287

View in Genome Browser
Species Human (GRCh38)
Location 11:8809855-8809877
Sequence CTTTCCTAAGAGGTGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 297}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078157287_1078157292 1 Left 1078157287 11:8809855-8809877 CCCTCCTCCACCTCTTAGGAAAG 0: 1
1: 0
2: 2
3: 17
4: 297
Right 1078157292 11:8809879-8809901 CTGTGATCGACCTTTTGATGTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1078157287_1078157293 2 Left 1078157287 11:8809855-8809877 CCCTCCTCCACCTCTTAGGAAAG 0: 1
1: 0
2: 2
3: 17
4: 297
Right 1078157293 11:8809880-8809902 TGTGATCGACCTTTTGATGTGGG 0: 1
1: 0
2: 0
3: 4
4: 71
1078157287_1078157294 5 Left 1078157287 11:8809855-8809877 CCCTCCTCCACCTCTTAGGAAAG 0: 1
1: 0
2: 2
3: 17
4: 297
Right 1078157294 11:8809883-8809905 GATCGACCTTTTGATGTGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078157287 Original CRISPR CTTTCCTAAGAGGTGGAGGA GGG (reversed) Intronic
900364724 1:2306435-2306457 GTGTCCTAGCAGGTGGAGGAGGG + Intronic
901785012 1:11618800-11618822 CTTCCCTAACACGTGGAGAAAGG + Intergenic
904387950 1:30158432-30158454 CTTTATTAAGTGTTGGAGGAGGG + Intergenic
904772582 1:32888648-32888670 CTTTCCTGGGAGAGGGAGGAAGG - Intronic
904814110 1:33182179-33182201 CTTCCCTGGGAGCTGGAGGATGG - Intergenic
904907762 1:33910733-33910755 CTTTCCCAAGAGGTGGCAAAGGG - Intronic
905430434 1:37918659-37918681 GTTTCATAAGAGGTGATGGATGG - Intronic
905528438 1:38657037-38657059 GTTTCCAAAGAGGTGGGAGAGGG + Intergenic
905889576 1:41510857-41510879 CTCTCCTCAGAGCTGGAGGGCGG - Exonic
906301102 1:44682359-44682381 CTGACCTCAGAGGAGGAGGAAGG + Intronic
906632998 1:47388045-47388067 CTTTCATAACAGGTAAAGGAAGG + Intergenic
907938816 1:59067293-59067315 CCTTCCTTATACGTGGAGGAAGG - Intergenic
908358432 1:63344708-63344730 CTTTCCAGAGAGGTTGAGAAGGG + Intergenic
908779632 1:67678024-67678046 CTTTCCTAAAATAGGGAGGACGG + Intergenic
909114107 1:71513281-71513303 CTTTTTTGAGAGGTGGAGGTAGG - Intronic
909507398 1:76409052-76409074 GGCTCCTAAGAGGTTGAGGAAGG + Intronic
909857782 1:80561105-80561127 ATTTCCTTAAAGGTGGGGGAAGG + Intergenic
911135976 1:94440827-94440849 TTTTCTTGGGAGGTGGAGGATGG + Intronic
912960185 1:114189209-114189231 CTTTGCTGACAGGTGGAGGGAGG + Intergenic
913168457 1:116211003-116211025 CTCTCCTATTAGGAGGAGGACGG + Intergenic
913298266 1:117343502-117343524 CTTTCCTCACAGGTGGGAGATGG + Intergenic
913651872 1:120922766-120922788 CTTCCCTATGAGATGGAAGACGG - Intergenic
914248707 1:145904619-145904641 CCTACTTAAGAGGTGGAGGTGGG - Intronic
914434627 1:147648932-147648954 CTTTCCTAAGAGATGGATACTGG - Intronic
914830791 1:151169565-151169587 CTTTGGTAGGAGGTGGGGGAGGG - Exonic
915970658 1:160352869-160352891 GTTTCCTGAGAGATGGAGGTAGG - Exonic
916184089 1:162113830-162113852 CCTTCCTAAGAGGTGAAGGATGG - Intronic
917521096 1:175749033-175749055 CTTTTCTGGGAAGTGGAGGAGGG + Intergenic
917936314 1:179870559-179870581 CTTTCCAAAATGGAGGAGGAGGG - Intronic
918050129 1:180966484-180966506 CTTTCCTCACAGGAGTAGGAGGG + Intergenic
919690928 1:200527771-200527793 TTTTCCTTAGAGATTGAGGATGG - Intergenic
920210822 1:204327058-204327080 CTATCCCAGGAGGAGGAGGAGGG - Intronic
920968681 1:210723418-210723440 CACTCCTCAGAGGTGGAGAAGGG + Intronic
1063829243 10:9933209-9933231 CTTTACTTAGAGGTGGAGAGTGG + Intergenic
1065016624 10:21468297-21468319 CTCTCCTAACAAGTGGAGCAGGG + Intergenic
1067196698 10:44126020-44126042 CTTTCTTAATAGATGGAGGAGGG + Intergenic
1067466143 10:46500772-46500794 CTTTCCTGAGTGTTGGGGGATGG + Intergenic
1067621045 10:47883834-47883856 CTTTCCTGAGTGTTGGGGGATGG - Intergenic
1067842474 10:49691896-49691918 CTTGCCTCACAGGTGGAGGTTGG + Intronic
1068673618 10:59747737-59747759 CTTTCCTAGAAGGTAGGGGACGG + Intergenic
1069617322 10:69814314-69814336 GTTTCCCAGGAGGAGGAGGAGGG + Intronic
1070279118 10:75036082-75036104 CTTTCCCAAGAGCTGGAATATGG + Intergenic
1070425966 10:76287589-76287611 CTTTCCTAACAGGAGCAGGCTGG - Intronic
1070499109 10:77053768-77053790 CTTTCTTAAGAGATGGAGGTAGG - Intronic
1070646398 10:78205048-78205070 CTTTCCTAGGGGAAGGAGGAAGG - Intergenic
1072627982 10:97126438-97126460 TTTTCCTGAGAGGTTCAGGATGG + Intronic
1072793333 10:98335390-98335412 TTTTCCTTAGAGGTGGTGCAGGG - Intergenic
1073894710 10:108141979-108142001 CTTTCCTAAGATTAGGAGGCAGG - Intergenic
1074472084 10:113736381-113736403 TTTTCCTAAGCGGTTGAGAATGG - Intergenic
1075542759 10:123329310-123329332 CTTTCCAATGAGGAGAAGGAAGG - Intergenic
1076711994 10:132341767-132341789 CTTTCCTAAGATGTGCAGTGAGG - Intronic
1077140420 11:1021889-1021911 CTGGCCCAAGTGGTGGAGGAGGG - Intronic
1077307025 11:1873051-1873073 CTCTCCCCAGAGGTGGAGGCAGG + Intronic
1077398677 11:2341181-2341203 CAGTCGTAGGAGGTGGAGGAGGG - Intergenic
1078157287 11:8809855-8809877 CTTTCCTAAGAGGTGGAGGAGGG - Intronic
1079362318 11:19779219-19779241 TTTCCCCATGAGGTGGAGGAAGG + Intronic
1079367138 11:19819349-19819371 ATTTCCTAGGTGGTGGGGGAAGG + Intronic
1080161239 11:29179438-29179460 CTTTCCTCAGAGATGCAGTAGGG - Intergenic
1081197981 11:40184853-40184875 CTGTCCTAAGAGGTGGAAAATGG - Intronic
1081820986 11:45994481-45994503 CTTGCCTGATACGTGGAGGAGGG - Intronic
1085177981 11:74507334-74507356 ATTTCCTTAGAGGCTGAGGAAGG - Intronic
1087096664 11:94325750-94325772 CTAGCATAAGAGGTGGAGAAGGG + Intergenic
1088308509 11:108435563-108435585 CCTTGCTCAGGGGTGGAGGAAGG - Intronic
1088998725 11:115030186-115030208 ATTTTTTAAAAGGTGGAGGATGG + Intergenic
1089189319 11:116642760-116642782 CATTCCTAGGGGCTGGAGGATGG + Intergenic
1089299868 11:117492176-117492198 CTGTCATAGGAGGTAGAGGAGGG - Intronic
1090429447 11:126633963-126633985 CTTTCTGAAGAGGTGGAAGGAGG - Intronic
1091160064 11:133411814-133411836 CTTTCTCATGAAGTGGAGGAAGG - Intronic
1091601583 12:1921210-1921232 CTTCCCTGACTGGTGGAGGAGGG + Intergenic
1092972182 12:13706903-13706925 TGTTCCTGAGAGGAGGAGGAAGG - Intronic
1093078854 12:14786784-14786806 ATTTCCAAAGAACTGGAGGAGGG + Exonic
1094592579 12:31835455-31835477 CTTCCCTGAGAGGTGGAAGACGG + Intergenic
1095459220 12:42424588-42424610 CTATCTTAGGAGGTTGAGGAGGG + Intronic
1095642274 12:44499865-44499887 TTATCCTAAGAAGTGGACGAGGG - Intergenic
1095709989 12:45278072-45278094 CTTAGCTACGAGGTGGAGGGTGG - Intronic
1096755297 12:53794312-53794334 CTTTCCTAATAGATGGGGCAGGG + Intergenic
1098418932 12:70270560-70270582 TTTTCCTATGAGGAGGAAGAAGG - Intronic
1098665324 12:73154407-73154429 CTTTCATAAGAGGAGAAAGATGG - Intergenic
1100024464 12:90110959-90110981 CTTTGTTTAGAGGAGGAGGAAGG + Intergenic
1101340076 12:103835582-103835604 ATTTAGTAAGAGGTGGAGGTGGG - Intronic
1102076666 12:110065525-110065547 ATTTGCTAGGAGGTGAAGGATGG - Intronic
1103520274 12:121533253-121533275 CTTGTCTAGGAGGTGGGGGAAGG + Intronic
1103868267 12:124071493-124071515 CTGTCCAAAGTGGTGGAAGAGGG + Intronic
1103992296 12:124807356-124807378 CTGGCCTCAAAGGTGGAGGAAGG + Intronic
1104832253 12:131761379-131761401 ATCTCCTAGGCGGTGGAGGACGG - Intronic
1105506248 13:21012787-21012809 ATTTCCTAGGAGGTGGGGGGGGG - Intronic
1106027305 13:25967433-25967455 CTTTCCTTGAAGGTGGAGGGTGG + Intronic
1108355820 13:49627996-49628018 CTTGCTTAGGAGGTTGAGGAGGG + Intergenic
1108757710 13:53523747-53523769 CTTTGTTAAGAGGTGAGGGAGGG - Intergenic
1109756276 13:66764157-66764179 ATTTCTTAAGAGGTGGAATATGG + Intronic
1112051826 13:95650340-95650362 CATTCCTGGGAGGTGGAGAAAGG - Intergenic
1115412220 14:33088580-33088602 CTGCCCTCAGAGGTGGAGGCAGG - Intronic
1115546065 14:34465722-34465744 TTTCCCCAAGAGGAGGAGGATGG + Intergenic
1115764173 14:36605711-36605733 CTTGCTTAAGAGTTGGAGGCTGG + Intergenic
1116989986 14:51265465-51265487 GTTTCCTTTGAGGAGGAGGAAGG + Intergenic
1118346847 14:64947200-64947222 CTTACCTAAGAAATGGAAGATGG + Exonic
1118939009 14:70315389-70315411 TATTCCTAAGTGGTGGAGGGTGG + Intergenic
1119038252 14:71248795-71248817 CTTTCAAAGGAGGAGGAGGAGGG - Intergenic
1121549466 14:94787814-94787836 CTCTTCAAAGAGGTGTAGGAAGG - Intergenic
1121939374 14:98055259-98055281 CTTCCCCAAGATGTGGAGGCTGG - Intergenic
1123508004 15:20964846-20964868 CTTTCCCAGGAGATGGAGCATGG - Intergenic
1123565222 15:21538588-21538610 CTTTCCCAGGAGATGGAGCATGG - Intergenic
1123601485 15:21975875-21975897 CTTTCCCAGGAGATGGAGCATGG - Intergenic
1123760036 15:23424866-23424888 CTCTTCTAAGAGGTGGAGTTAGG + Intergenic
1125730121 15:41888289-41888311 CCTTCCAAAGAAGTGGAGCAAGG + Intronic
1126678917 15:51185537-51185559 CTGTCCTAGGAGGAAGAGGAAGG + Intergenic
1127272285 15:57412578-57412600 GTTCCCCATGAGGTGGAGGAAGG - Intronic
1131379725 15:91953880-91953902 CTTCCTTCTGAGGTGGAGGATGG + Intronic
1131513589 15:93063288-93063310 CGTTCAAAGGAGGTGGAGGAGGG + Intronic
1202973593 15_KI270727v1_random:265694-265716 CTTTCCCAGGAGATGGAGCATGG - Intergenic
1134050734 16:11135494-11135516 CTTTTCTGGGAGGTGGAGGGAGG + Intronic
1134456304 16:14398017-14398039 CTCTTCTAAGAGGTGGAGTTAGG - Intergenic
1134901619 16:17943281-17943303 CTCTCCGCAGAGGAGGAGGAGGG - Intergenic
1135638829 16:24102226-24102248 CTATCCTAAGTGGTGGATGGAGG - Intronic
1135644825 16:24152637-24152659 CTTTCCTAAGATGTAGAGTCAGG - Intronic
1136510751 16:30737106-30737128 CTACCCCAAGAGGAGGAGGAGGG + Exonic
1136577890 16:31135125-31135147 CTTTCCTCGGAGAGGGAGGAGGG - Intronic
1137385841 16:48041840-48041862 ATTCCCTAAAAGATGGAGGATGG + Intergenic
1137861071 16:51847717-51847739 CATGCCTAAGAGGTGGAGATAGG + Intergenic
1139349191 16:66324804-66324826 CTTTAGGAAGAGGTGGAGGTGGG + Intergenic
1139632211 16:68237555-68237577 CTTTCCCTACAGGTGGAGGCGGG + Intronic
1139853216 16:69962796-69962818 CTTCCCTGAGAAGTGGAGCAGGG + Intronic
1139882187 16:70185704-70185726 CTTCCCTGAGAAGTGGAGCAGGG + Intronic
1140301159 16:73758601-73758623 CTTTGCTAAGAGCTAGGGGAAGG + Intergenic
1140370322 16:74409800-74409822 CTTCCCTGAGAAGTGGAGCAGGG - Intronic
1140558445 16:75948259-75948281 CTGTCTTTAGAGATGGAGGAAGG + Intergenic
1141064241 16:80901079-80901101 CTTTCCTCAGAGGAGCAAGATGG - Intergenic
1142129173 16:88424961-88424983 CTGTCCTGAGAGGGAGAGGAAGG - Intergenic
1143167123 17:4902322-4902344 CAATCCTAAGGGGTGGGGGATGG + Exonic
1144779346 17:17800021-17800043 CCTTCCTCTGAGGTGGAGGGTGG - Intronic
1144899143 17:18568326-18568348 CGTTCAAAGGAGGTGGAGGAGGG - Intergenic
1146004362 17:29151524-29151546 CCTCCAAAAGAGGTGGAGGAGGG + Intronic
1146286248 17:31575892-31575914 CTTTCCTGAGAAGTTGAGGCAGG + Intergenic
1147051309 17:37796894-37796916 CTTTCCTGAGAGCTGTAGGGAGG + Intergenic
1150009680 17:61492272-61492294 CTTCCATAAGAGGGGAAGGAAGG - Intergenic
1150571551 17:66391341-66391363 CTTTTCTTGGAGGAGGAGGAAGG - Intronic
1151527117 17:74678114-74678136 CTTGCCTGAGAAGAGGAGGAAGG - Intronic
1153647071 18:7204916-7204938 CTTTCCTGTGAGGAGGAAGAGGG + Intergenic
1153826000 18:8875499-8875521 CTTTCCTAAGGGGAGCTGGATGG + Intergenic
1154021027 18:10664021-10664043 CTTTGCTAAGAGCTGCAGGAGGG + Intergenic
1154970720 18:21406095-21406117 CTTTCCTAAGAGGGAGAGGTAGG + Intronic
1155447757 18:25929746-25929768 CTTTCCTAAGAGGTCAAACAGGG - Intergenic
1155512776 18:26594184-26594206 CTTCCCTAGCAGGAGGAGGAAGG - Intronic
1155530758 18:26764055-26764077 CTTTCCTGATGGGTAGAGGAGGG + Intergenic
1157392523 18:47314703-47314725 CTTTCCTCAGGGGTGGAGTGGGG - Intergenic
1158129515 18:54137391-54137413 CTTTTCTCAGAGCTTGAGGAGGG + Intergenic
1159008507 18:63035883-63035905 CTTTCCAAATAAGTGGAGGTGGG + Intergenic
1160288966 18:77572601-77572623 CTTCCGGAAGAGGTGGAGGGTGG + Intergenic
1160802678 19:977511-977533 CTCGCCTAGGAGGTGAAGGAGGG - Intergenic
1162017522 19:7853484-7853506 CTGGCCTAACAGGTGAAGGACGG - Intronic
1162019266 19:7861292-7861314 CTTCCCTATGAAGTGGAGGGAGG - Intronic
1162199270 19:9009143-9009165 ATTTACTCAGAGGAGGAGGAAGG - Intergenic
1162482365 19:10935646-10935668 CCTTCCTAAGTGGTTGTGGAGGG + Intergenic
1162925575 19:13929361-13929383 CTGATCTAAGGGGTGGAGGAAGG - Exonic
1163203879 19:15788026-15788048 CTATACTAAGTTGTGGAGGAGGG + Intergenic
1166962199 19:46504317-46504339 CATTTCTAAGACGTGGAGGCAGG - Intronic
1167765383 19:51479094-51479116 CTGGCCTGAGAGGTGGGGGAGGG - Intronic
1168087165 19:54056636-54056658 AGTTCCCAAGAGGAGGAGGAAGG - Intronic
925673540 2:6336839-6336861 CTTTGCTCAGTGGAGGAGGAGGG - Intergenic
927626817 2:24730255-24730277 CTTTCCTAGGAGAGGAAGGATGG - Intronic
930956718 2:57211518-57211540 CCTTCAGAAGAGGTGGAGAAAGG + Intergenic
932856773 2:75241830-75241852 CTGTCCTCTGTGGTGGAGGAGGG - Intergenic
936401486 2:112168007-112168029 CTTTCTTGAGATGTGGAGGGCGG + Intronic
936495654 2:113018541-113018563 CTGACGTAAGAGGTAGAGGAAGG + Intergenic
937240774 2:120460994-120461016 CTTTCCTGATAGAGGGAGGATGG + Intergenic
937328106 2:121004402-121004424 CTTACCTATGAGTTGGAGCATGG + Intergenic
938073892 2:128322096-128322118 GTTTGCCAAGGGGTGGAGGAGGG + Intergenic
938146357 2:128838026-128838048 GTTTCCTAGGAGGTGGGGGAGGG - Intergenic
939533439 2:143393940-143393962 CATTCTTATGAGCTGGAGGATGG + Intronic
941359224 2:164531440-164531462 ATTTTCTTAGAGGTAGAGGAAGG - Intronic
942698501 2:178675692-178675714 CTTTCTTAAGACCAGGAGGAGGG + Exonic
942960757 2:181827929-181827951 ATTCCCAAGGAGGTGGAGGAGGG + Intergenic
944295839 2:198061468-198061490 GTTGCCTAAGAGGGGAAGGAAGG + Intronic
945788975 2:214279339-214279361 GTTTCTCAAGAGGTTGAGGAGGG - Intronic
946049935 2:216854163-216854185 CTTTTCTAAAAGTTGAAGGAAGG - Intergenic
946966139 2:225040419-225040441 CTTTAAAAAGAGGTGGGGGAGGG - Intronic
946989908 2:225316868-225316890 GTTTGGGAAGAGGTGGAGGAGGG + Intergenic
947821647 2:233075674-233075696 CTCTGCCAAGCGGTGGAGGAAGG - Intronic
948056213 2:235010890-235010912 CTCTCCTAGGAGAGGGAGGAAGG - Intronic
948229739 2:236341357-236341379 CTCTCCTAGGAGGAGGAGAAAGG + Intronic
1169737459 20:8852448-8852470 CTGTCCCAAGAAGTGGAGGAAGG + Intronic
1169805652 20:9556817-9556839 GTTTCCTAAGGCTTGGAGGAGGG - Intronic
1169886767 20:10408273-10408295 CTCTGCTAAGAAGTGGATGATGG + Intronic
1170866164 20:20160109-20160131 TTTTCCTAAGAAGCAGAGGAGGG + Intronic
1170882075 20:20305531-20305553 CATACCTAAAAGGTGGTGGATGG + Intronic
1171293804 20:23998906-23998928 GTTTTCTCAGGGGTGGAGGAGGG - Intergenic
1172317155 20:33964697-33964719 CATTCCTCAGTGGGGGAGGAGGG + Intergenic
1172855587 20:37999780-37999802 CTTTCATAAGAAGTGAAAGAAGG + Intronic
1175517358 20:59577796-59577818 CTTTGCTGCGAGGGGGAGGAGGG - Intronic
1175772152 20:61630589-61630611 CTTCCCCAAGAGGAGGAGGAAGG - Intronic
1175777320 20:61661535-61661557 CTTTTTTAATAGCTGGAGGAAGG + Intronic
1177394430 21:20513886-20513908 CTGCCCTAAGAACTGGAGGACGG + Intergenic
1179245911 21:39634226-39634248 CTTCCCCAAGAAGTAGAGGAAGG + Intronic
1180830251 22:18902005-18902027 CTTGCCTAAGTGGTGGGGGATGG - Intergenic
1181069460 22:20323525-20323547 CTTGCCTAAGTGGTGTGGGATGG + Intergenic
1181385863 22:22545231-22545253 TTTTCATAAGAGATGGAGGGGGG + Intergenic
1181431325 22:22883427-22883449 CTTCCCTAGGAGGTGGCAGAGGG + Intronic
1181881964 22:25988386-25988408 CTTCCCTAGCAGATGGAGGATGG + Intronic
1182292615 22:29293054-29293076 CTGTCCCTAGGGGTGGAGGAGGG - Intronic
1182893989 22:33843829-33843851 CTTTCCTAAGAGGCCAAGGCGGG + Intronic
1184710368 22:46246136-46246158 CTTTTCTAAGAACTGCAGGAGGG - Intronic
1203280340 22_KI270734v1_random:127276-127298 CTTGCCTAAGTGGTGGGGGATGG - Intergenic
949454374 3:4223352-4223374 GTTTCCTCAGCAGTGGAGGATGG + Intronic
949788357 3:7766150-7766172 CTAACCTAAAAGGAGGAGGAGGG + Intergenic
950328862 3:12139759-12139781 CTTACCTAACAGGTAGAGTATGG + Intronic
951697097 3:25456336-25456358 CTTTCTTGGGGGGTGGAGGAAGG + Intronic
952881242 3:37987336-37987358 CTTTCCTGCTAGGGGGAGGAGGG + Intergenic
953345510 3:42172149-42172171 CCCTCCTAGGAGCTGGAGGAGGG - Intronic
954593063 3:51800806-51800828 CTTCACTGAGAGGTGAAGGAGGG + Intergenic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
954904955 3:54053423-54053445 CTTTTCCAAGAGAGGGAGGAGGG + Intergenic
955496959 3:59543271-59543293 CTTCCCTAAGAGCTGGATCAGGG - Intergenic
956666406 3:71645964-71645986 ATTTCCTAAGATAAGGAGGATGG + Intergenic
956726412 3:72160247-72160269 CTTCCCTCAGAGGGGCAGGATGG - Intergenic
960613429 3:119575724-119575746 CTTCCCTGAGAGGTAGAGGTAGG - Intergenic
962307476 3:134301242-134301264 CTTTAATAAGAGGTGGAGAGGGG + Intergenic
963785978 3:149534829-149534851 CTTTCCTAGCAGCTGGAGGACGG + Intronic
963847766 3:150177432-150177454 CTTTGCTAAGAGGAGGTGTATGG + Intergenic
966148429 3:176838930-176838952 CTTTTCTCATAGGTGGGGGACGG + Intergenic
970002500 4:11378455-11378477 TTTTCTAGAGAGGTGGAGGATGG - Intergenic
970238388 4:13982012-13982034 CTTTCCTAGGCTGTGGACGAGGG - Intergenic
972340259 4:38146537-38146559 CTTCCCCAGGAGCTGGAGGAGGG - Intergenic
973376202 4:49288129-49288151 GTTTCCTAAGAGGTGTAGCCTGG - Intergenic
974500930 4:62701679-62701701 TTTTCCTAAGTGGTAAAGGAGGG - Intergenic
975544960 4:75550807-75550829 CTTTCCTAAGTGGTGCTGGCAGG + Intergenic
975780328 4:77832449-77832471 CTTTCCTGAGAAGTCTAGGACGG + Intergenic
976059244 4:81107129-81107151 ATTTCCTAAGAGGAGAAAGACGG + Intronic
976442653 4:85093412-85093434 CTTTCTTGAGAGTTGGAGGAGGG - Intergenic
976783665 4:88791026-88791048 CTGGCCTAAGAGGAGAAGGAAGG - Intronic
978281716 4:107024691-107024713 CTTTGCAAAGAGATGGAGAAAGG + Intronic
979252551 4:118580578-118580600 CTTTCCCAACAGCTGGATGAGGG + Intergenic
979799676 4:124893329-124893351 CAATCCCAAGAGGTAGAGGAGGG - Intergenic
981010271 4:139918272-139918294 CTTGCCTAAGAGGCGCTGGATGG + Intronic
984186144 4:176546115-176546137 CATTCCTAAGAAATAGAGGAAGG - Intergenic
984281388 4:177674854-177674876 CTGGCCTAAGAGGAGGAGGTTGG + Intergenic
984727400 4:183035001-183035023 CATTCCTAGGTGGTTGAGGAGGG + Intergenic
984868849 4:184309703-184309725 CTGGCCGCAGAGGTGGAGGACGG + Intergenic
985018332 4:185660800-185660822 CTTTTCTGGGAGGTGCAGGATGG + Intronic
985382809 4:189413499-189413521 GTTTCCTGAGGGATGGAGGAGGG - Intergenic
990179103 5:53140917-53140939 CTGTCCTAAGTGGTTGAAGAAGG + Intergenic
990327492 5:54692584-54692606 CTGGCCTAGGATGTGGAGGATGG + Intergenic
996349313 5:122520793-122520815 CTCTCTTTAGAGGTGGAGTAGGG - Intergenic
997206316 5:132052315-132052337 AGTTCCAAGGAGGTGGAGGAGGG + Intergenic
997835881 5:137193211-137193233 AGATCCTAAGAGGTAGAGGAAGG + Intronic
997837137 5:137204472-137204494 CTTTACTATTAGGTGGGGGAGGG - Intronic
998386032 5:141757673-141757695 CTTTTCTAGGAGCTGGAGCAGGG + Intergenic
998904886 5:146894250-146894272 CTTTCCTAAGAGTTATGGGAAGG - Intronic
999654960 5:153802338-153802360 TTGTCCTAAGAAGAGGAGGAGGG - Exonic
1001128076 5:169038845-169038867 CTTTGCTTGGAGGTGGAGGTAGG - Intronic
1001268141 5:170290121-170290143 CTTTTGGAAAAGGTGGAGGAGGG - Intronic
1001519609 5:172381695-172381717 CTGTCCACAGAGGTGGAGGTGGG - Intronic
1001716889 5:173823827-173823849 CTATCCTAAGAAGTGGAGAGGGG + Intergenic
1002107053 5:176884838-176884860 CTTTGCTCAGAGGAGGAGCATGG + Intronic
1003171282 6:3723695-3723717 TTTCCCTCAGAGCTGGAGGACGG - Exonic
1003219459 6:4145749-4145771 CTTCACGAAGAGATGGAGGATGG - Intergenic
1004749868 6:18551158-18551180 CCTTCTTAAGAAGTGGAGGGGGG + Intergenic
1005772342 6:29086440-29086462 CAGTCCTTAGAGGTGGATGAAGG + Exonic
1006254612 6:32820482-32820504 CTTCCCTCAGAGCTGAAGGAAGG + Intronic
1006349293 6:33509304-33509326 CTTTCCTCAGAGGAAAAGGAAGG - Intergenic
1007291026 6:40786888-40786910 CTTCCCTAGGAGATGAAGGAAGG - Intergenic
1007777783 6:44233399-44233421 CTTTCCTAAGCGGGGAAGGAAGG - Exonic
1011118872 6:83927813-83927835 CTGTCCTCAGAGGTCTAGGAAGG + Intronic
1011939468 6:92825278-92825300 TTTTCCATAGAGGTGGAGAAGGG + Intergenic
1012534326 6:100277639-100277661 CATTCCTGAGAGGTGGAGTTAGG + Intergenic
1012883748 6:104821179-104821201 CCTTTCAAAGGGGTGGAGGATGG + Intronic
1012907212 6:105081712-105081734 CTTTGCCCAGAGGTGGAGGTTGG + Exonic
1013280446 6:108631471-108631493 ATTTTCTAGGAGGTGGAGGGAGG + Intronic
1013787284 6:113795864-113795886 CTCTTCTGAGAGTTGGAGGATGG + Intergenic
1013796915 6:113898550-113898572 CTCTCTTCAGAGTTGGAGGATGG + Intergenic
1015701025 6:136036418-136036440 CCTTCCTAACAGGTGAAGAAGGG - Intronic
1018423402 6:163659829-163659851 ATCTCCTAAAAGGTAGAGGAGGG - Intergenic
1018832133 6:167451298-167451320 CTTTCTTGAGACCTGGAGGAAGG - Intergenic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1020800499 7:12726810-12726832 CCTTCCCAATAGGTGGAGGGAGG - Intergenic
1021919706 7:25472491-25472513 CTTTCCTACATGGGGGAGGAGGG - Intergenic
1022008271 7:26287305-26287327 TTTTCCCAAGAGATGGAGGAAGG + Intergenic
1022417246 7:30188924-30188946 CTTTCCCAGGAGGAGGAGGGAGG + Intergenic
1022736668 7:33082380-33082402 CTTTCTTAGGAGGTTGAGGTGGG + Intergenic
1027752337 7:82165218-82165240 CTTTCCTGAGAGGAGAGGGAAGG + Intronic
1027944046 7:84722997-84723019 CCTTCCTCAGTGGTGGAGGAGGG + Intergenic
1028116462 7:87002980-87003002 CGCTCCTAAGAGGAGGAAGAAGG + Intronic
1029028835 7:97447633-97447655 CTTTCATAAGAAGTGAAGGCAGG - Intergenic
1029110808 7:98212274-98212296 CTGTCCTAGGAGGTGGCGGCAGG - Exonic
1030366784 7:108655797-108655819 TTTTTCTAAGAGATGTAGGAAGG + Intergenic
1033029672 7:137813595-137813617 CATTCCTCTGAGGTGGAGGAAGG - Intronic
1035904025 8:3489622-3489644 CTTCCCTGAGAGGTGGTTGAAGG - Intronic
1036398114 8:8386037-8386059 CTTTCCTACGAGTTCCAGGAGGG - Intronic
1038489096 8:27956918-27956940 CTCTCCAAAAGGGTGGAGGACGG + Intronic
1039555424 8:38471785-38471807 TTTCCCTGAGAAGTGGAGGAGGG - Intergenic
1042209249 8:66362331-66362353 CTTTCTTGAGAAGTGGAGAAAGG + Intergenic
1043204556 8:77420626-77420648 CATTCCTAGCAGCTGGAGGATGG + Intergenic
1044995694 8:97836083-97836105 CTTTGCTAAGGGGTTGATGAGGG - Intronic
1045680674 8:104656497-104656519 TTTTCCTAGGAGATGGAAGAGGG + Intronic
1046301143 8:112292537-112292559 CTTTGCACATAGGTGGAGGATGG + Exonic
1046711805 8:117519223-117519245 CTTTTCTATGAGGACGAGGAAGG - Intergenic
1047443015 8:124895741-124895763 TTTTCCTAACATTTGGAGGAAGG - Intergenic
1053136712 9:35655410-35655432 TTTTCCTGAAAGGAGGAGGAAGG - Intergenic
1056845465 9:90033458-90033480 CTTTCCTGAGAGGTGGTGTGAGG + Intergenic
1058587261 9:106522893-106522915 CTATTCTAAAAGATGGAGGAGGG + Intergenic
1059438708 9:114290798-114290820 CTTTCTTAACAGGGGGAGCAGGG + Exonic
1060814523 9:126627582-126627604 CTTTCCCCAGAGCTGGAGCAGGG + Intronic
1061910115 9:133717812-133717834 CTTCCCAAAGAGCTGCAGGAAGG - Intronic
1062137713 9:134938442-134938464 CTTTGTCAAGAGGCGGAGGAGGG + Intergenic
1185993759 X:4920906-4920928 CTTTCATAAGAGCTCAAGGATGG + Intergenic
1186121776 X:6371328-6371350 CTTCCCTAAGAGGTAAAGGGAGG + Intergenic
1186242437 X:7584066-7584088 CTTTTCTAAGAGGTGGATCCAGG - Intergenic
1187029661 X:15472644-15472666 GGTTCCTAGGAGCTGGAGGAAGG + Intronic
1187770550 X:22691081-22691103 CTATCATAAGAGGGTGAGGAGGG - Intergenic
1187827562 X:23347126-23347148 CTTACCTAAGAGTTGGTGGGGGG + Intronic
1190528893 X:51355123-51355145 CTTGCCTAAGAGGTAGGTGAGGG - Intergenic
1192180499 X:68912875-68912897 CTTTCCTCAGGGGCTGAGGAGGG + Intergenic
1192370999 X:70512882-70512904 CTAGAATAAGAGGTGGAGGAAGG - Intergenic
1193222457 X:78942618-78942640 CTCTCCAAAGCTGTGGAGGAAGG - Intergenic
1193963108 X:87949147-87949169 CTGTGCTAAGCTGTGGAGGAAGG - Intergenic
1198463556 X:136884925-136884947 CCTTTTTAAGAGGTGGAGTAAGG + Intergenic
1199454448 X:148012104-148012126 CTTTGCTTAGAGGAGAAGGAAGG + Intronic
1200271012 X:154683485-154683507 CTTTTCTATGAGATGGGGGATGG + Intronic