ID: 1078160469

View in Genome Browser
Species Human (GRCh38)
Location 11:8835738-8835760
Sequence GACAACTTAAGATCAAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 241}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078160466_1078160469 -2 Left 1078160466 11:8835717-8835739 CCAGTTGGATCACCTGCCTAGGA 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1078160469 11:8835738-8835760 GACAACTTAAGATCAAAGAATGG 0: 1
1: 0
2: 0
3: 19
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078160469 Original CRISPR GACAACTTAAGATCAAAGAA TGG Intronic
901116897 1:6853155-6853177 GAAAAGTGAAGACCAAAGAAAGG + Intronic
901562452 1:10083463-10083485 GACAACTTACCATAAAAGAATGG - Intronic
902354257 1:15885268-15885290 AACTAATTAAAATCAAAGAATGG - Intronic
902900549 1:19512621-19512643 AACCACCTAAGATCAGAGAAAGG + Intergenic
904316253 1:29666790-29666812 GACAACTTTAGTACAAAGAATGG + Intergenic
906047785 1:42846136-42846158 TATAACTTAAAATCAAAGGAGGG - Intergenic
906190621 1:43897387-43897409 GGAAACTAAAGCTCAAAGAAAGG + Intronic
907133618 1:52118958-52118980 GAAAACTAAAGTTCAGAGAAGGG - Intergenic
907637104 1:56146300-56146322 GAAAACTGAAGCTCAAAGAGAGG + Intergenic
907979487 1:59467547-59467569 GGAAATGTAAGATCAAAGAAAGG - Intronic
909003798 1:70251764-70251786 TACAACTTGAGATCAAATAAAGG - Exonic
909045890 1:70709335-70709357 GACAACTTAAAACAAAAGGAAGG + Intergenic
909214651 1:72870819-72870841 GACTACAAAAAATCAAAGAAAGG - Intergenic
909648988 1:77952402-77952424 GACAAATTAAAATCTATGAATGG + Intronic
909808061 1:79896017-79896039 GACATGTTAAGAACCAAGAAAGG - Intergenic
909937011 1:81563465-81563487 GAAAACTGAAGTTCAAAGAATGG + Intronic
910025987 1:82653393-82653415 GACAGCTAAAGATTAGAGAAAGG + Intergenic
911853547 1:102849608-102849630 TAAAACTTAAGAAAAAAGAAAGG - Intergenic
912931858 1:113971001-113971023 GACAACTTCATACCAAGGAAGGG + Intronic
914079545 1:144394291-144394313 GACAACTTAAAGTAAAAGCAAGG - Intergenic
914174443 1:145262834-145262856 GACAACTTAAAGTAAAAGCAAGG - Intergenic
915736115 1:158086530-158086552 GTCAACTTAAGAGCAGAGGAGGG + Intronic
915852061 1:159334728-159334750 GACAACTTAAAGTAAAAGGAAGG - Intergenic
918132675 1:181643457-181643479 GACAATTCAAGAGCAAAGAGCGG - Intronic
918360573 1:183752715-183752737 GACATCTTAAGGCCAAAGAGAGG - Intronic
918883954 1:190166563-190166585 AACAACTTAAGATCAAAATCTGG - Intronic
918953688 1:191175785-191175807 GACAACTTAAAGTGAAAGAAAGG - Intergenic
919502861 1:198359817-198359839 GAGAACTTAATGGCAAAGAATGG - Intergenic
921375699 1:214471228-214471250 GAAAACTAAAGACTAAAGAAAGG + Intronic
921422213 1:214961495-214961517 CACAACTCAAGAGCTAAGAAAGG - Intergenic
922866450 1:228865047-228865069 GACAACTTAAAAACAAACCAGGG + Intergenic
924643405 1:245855092-245855114 GACAATTTAAGAGGACAGAAAGG - Intronic
924910885 1:248511994-248512016 GTCAACTGAAGATCAGACAAAGG + Intergenic
924913216 1:248536046-248536068 GTCAACTGAAGATCAGACAAAGG - Intergenic
1063841233 10:10074790-10074812 GGCAACTTGAGATCTGAGAACGG - Intergenic
1064700494 10:18014588-18014610 TACAACTTAAAATTGAAGAAGGG - Intronic
1068093607 10:52463093-52463115 AGCAACTTAAAATCAAAGCAGGG + Intergenic
1069060740 10:63891943-63891965 GCCAACCTAAGAGCAAGGAATGG - Intergenic
1069405794 10:68096756-68096778 GACAATTCACGATCATAGAAAGG + Intergenic
1070489081 10:76958947-76958969 AAAAACTTAAGATTCAAGAAGGG - Intronic
1072281713 10:93871575-93871597 AAGAACTTCAGAACAAAGAACGG - Intergenic
1072911313 10:99504277-99504299 GACAAAATAAGAAAAAAGAAAGG + Intergenic
1073734984 10:106335631-106335653 GACAAATTAAGACCAAAATATGG + Intergenic
1074385493 10:113013691-113013713 AAGAACTTTAGAGCAAAGAAAGG + Intronic
1074876981 10:117621421-117621443 GAAAACTTCAGAGCAAAGAGAGG - Intergenic
1074904364 10:117848059-117848081 CACAACTTAAAGTGAAAGAAAGG + Intergenic
1075519760 10:123136458-123136480 GACAACGAAAGTTCAAAGAGAGG - Intronic
1075566532 10:123508974-123508996 GAAAACTGAAGCTCAGAGAAGGG + Intergenic
1078103229 11:8342274-8342296 AAGAACTTTAGAACAAAGAATGG + Intergenic
1078116678 11:8459738-8459760 GACAACTAAAGTTCACAGGACGG + Intronic
1078160469 11:8835738-8835760 GACAACTTAAGATCAAAGAATGG + Intronic
1079177745 11:18158442-18158464 CACAGCTTAAGATCTGAGAATGG + Intronic
1079835898 11:25332252-25332274 AACAAATTTAGATTAAAGAATGG - Intergenic
1079939152 11:26656327-26656349 GACAAATAGAGATCAAAGAGTGG - Intronic
1081155989 11:39691559-39691581 GACAACTTAAAATATAAGGAAGG + Intergenic
1081279623 11:41192741-41192763 GACAACTTAAATCCAAAGTAAGG + Intronic
1082930426 11:58597565-58597587 GACAACTTAAAGCAAAAGAAAGG - Intronic
1083010543 11:59393884-59393906 GACAGCTTAAAACCAAAGAAAGG + Intergenic
1083255808 11:61494763-61494785 GACAACTGGAGGTCACAGAAGGG - Intergenic
1084127751 11:67111849-67111871 GAAAACTTCATATCGAAGAAAGG - Intergenic
1089637388 11:119824103-119824125 GCCAACTTAGGCTCAAAGAAGGG - Intergenic
1091363336 11:134996076-134996098 GACAACTTAAAACCAAAAGAGGG - Intergenic
1091653683 12:2328392-2328414 GACAAATTAAAATAAAAGAAGGG - Intronic
1091784879 12:3237312-3237334 GATGACTTACGATCAAAGACAGG + Intronic
1096898296 12:54847313-54847335 GACAAGCAAAGAGCAAAGAAAGG + Intronic
1097543310 12:60967785-60967807 GAAAAATTAAGAAGAAAGAAAGG + Intergenic
1097573776 12:61365050-61365072 TTCAACTTAAGATCAACCAAGGG - Intergenic
1100749447 12:97680943-97680965 GACTTGTTAAGATTAAAGAAGGG - Intergenic
1101023432 12:100575800-100575822 CAAAACTGAAGCTCAAAGAAGGG + Intronic
1102368259 12:112358621-112358643 GACAGATTATGATCAAAGAAAGG + Intronic
1103298228 12:119906487-119906509 AACAAATTTAGAACAAAGAATGG - Intergenic
1104159760 12:126166997-126167019 GACATCTTAAAATCCAAAAAAGG - Intergenic
1105571265 13:21604828-21604850 GAAAAGTGAAGACCAAAGAATGG - Intergenic
1106028444 13:25976732-25976754 GACAAATTCAGAGCAAATAAAGG + Intronic
1106674863 13:31947817-31947839 GTCAACTCAAGATCTTAGAAAGG - Intergenic
1107153710 13:37141908-37141930 GAGAAATGAAGAGCAAAGAAGGG - Intergenic
1108319421 13:49273670-49273692 GTAAACTGAAGGTCAAAGAAAGG + Intronic
1108399811 13:50028649-50028671 GACAATTGAAGATGAAGGAAAGG + Intergenic
1109644018 13:65228823-65228845 GACAAATTAAGATCAATGCCAGG - Intergenic
1110029128 13:70583701-70583723 CACCACTTAGAATCAAAGAAAGG + Intergenic
1112161313 13:96871159-96871181 GAGAACTCAAGATAAAAAAATGG - Intergenic
1112672570 13:101657513-101657535 AACAAATGAAAATCAAAGAATGG - Intronic
1114326232 14:21591442-21591464 GACAACATAAAATCAAAATATGG + Intergenic
1114694730 14:24615826-24615848 AACAACTGAAGATAAAATAATGG + Intergenic
1118429368 14:65700903-65700925 AACCACTGCAGATCAAAGAATGG - Intronic
1118816475 14:69317809-69317831 GAAGTCTCAAGATCAAAGAATGG + Intronic
1120740611 14:88105601-88105623 GACACCTGGAGATCCAAGAATGG - Intergenic
1120856179 14:89214445-89214467 GACAACTTAACAGCAAACAAAGG + Intronic
1121510925 14:94512889-94512911 GTCTACTTAAGACCAAGGAAAGG + Intronic
1121523779 14:94604247-94604269 GAAAACTTAGGATAAAAGAAGGG + Intronic
1125703270 15:41707650-41707672 CACAAGTTAAAAACAAAGAAGGG + Intronic
1126449877 15:48794822-48794844 AAAAACTTAAGAACAAAGAGAGG + Intronic
1128118939 15:65131852-65131874 GACAACTTGGGATCAAATATGGG + Intronic
1130146298 15:81276345-81276367 AACAACTTTAAATCTAAGAATGG + Intronic
1131611165 15:93965766-93965788 GACAACTGAAGAACCATGAAAGG - Intergenic
1131618077 15:94037422-94037444 GACAATTAAAGATCATAAAAGGG + Intergenic
1136857942 16:33676341-33676363 GACAACCTAAAATGAAAGACTGG + Intergenic
1138118123 16:54376649-54376671 GAAAACTGAAGTGCAAAGAAGGG + Intergenic
1138415553 16:56869615-56869637 GAAAACTGAAGCTCAGAGAAGGG + Intronic
1140148351 16:72334646-72334668 AACAACTGAAACTCAAAGAAGGG - Intergenic
1140935558 16:79666388-79666410 GTCAACTTCAGTGCAAAGAAAGG - Intergenic
1141129989 16:81429689-81429711 GAGAACTAAGGCTCAAAGAAGGG - Intergenic
1143800096 17:9372179-9372201 GACAACTTGTGGTCACAGAAAGG - Intronic
1144602609 17:16631334-16631356 CACAAATTAAGCTCTAAGAATGG + Intronic
1146778647 17:35646239-35646261 GGCAACTTAAGATTACAAAAAGG + Intronic
1148853303 17:50565275-50565297 GAAAACTGAAGCTCACAGAAAGG - Intronic
1149198130 17:54148429-54148451 GACAACTATACATCCAAGAAAGG - Intergenic
1149394394 17:56224683-56224705 GAGAAGTTGAGATCAATGAATGG + Intronic
1149797338 17:59532926-59532948 GACAAATAAACATGAAAGAATGG + Intergenic
1151552704 17:74831220-74831242 GACAAATTATAACCAAAGAACGG - Intronic
1153008450 18:516398-516420 GAAAAATTTAGAACAAAGAATGG - Intergenic
1154236438 18:12610397-12610419 TATAACTTAAGATCAATGGATGG - Intronic
1155118510 18:22794511-22794533 GACAACATATTATCAGAGAAGGG + Intergenic
1155223939 18:23712027-23712049 GAGAAATAAAGATCATAGAAGGG + Intronic
1156279593 18:35622989-35623011 GACAAGATTAGAACAAAGAATGG - Intronic
1156562478 18:38142453-38142475 GAGAAAATAAGATAAAAGAAGGG - Intergenic
1156636305 18:39033948-39033970 AGCAACTGAAGATCAAATAATGG - Intergenic
1161563846 19:4988582-4988604 AGCAAATTAAGCTCAAAGAAGGG - Intronic
1166963566 19:46514398-46514420 GAAAACATAAAACCAAAGAATGG - Intronic
927119078 2:19937380-19937402 GACAACATAAAATTAAATAATGG + Intronic
930370758 2:50498380-50498402 GAAAACTTAAGGACAAAAAAAGG - Intronic
931544043 2:63361076-63361098 GACAAGATAAGATGGAAGAAAGG + Intronic
932450830 2:71809732-71809754 AACAACTTCAGAACAGAGAAGGG + Intergenic
932934194 2:76082557-76082579 GACAGCTTCACATTAAAGAAAGG - Intergenic
935687005 2:105693014-105693036 GACAACTTAACATGAAAAATGGG - Intergenic
936327662 2:111519570-111519592 GAAAACTTGAGATCACACAAGGG - Intergenic
938008609 2:127810454-127810476 GACAACTTAAAATCAGAAACAGG + Intronic
938854594 2:135297051-135297073 CACAACTTGAGATCTGAGAATGG - Intronic
943239860 2:185368749-185368771 GACAACTTAAGGCAAAAGGAAGG - Intergenic
943347349 2:186755084-186755106 CACAACTTGAGATCAATGTAGGG - Intronic
943587179 2:189755130-189755152 GACAACATAACAAAAAAGAATGG + Intronic
944987191 2:205190780-205190802 GAAAACTTAAGTGCAAATAAAGG + Intronic
945660758 2:212682479-212682501 GACAACTTATCATCAAACACTGG + Intergenic
945811517 2:214555213-214555235 GACAACTTGAAGTCAGAGAAGGG - Intronic
946125148 2:217556148-217556170 GACAATTAAAGATGAATGAATGG + Intronic
946561644 2:220920690-220920712 GACAACTTATCTTCAAAAAAGGG - Intergenic
947292534 2:228592925-228592947 GACAACGTAATAGGAAAGAAAGG + Intergenic
1170456019 20:16533620-16533642 TACAACTTAAGAGCATAGAATGG - Intronic
1171234780 20:23515494-23515516 GATTTCTTAAGGTCAAAGAAAGG - Intergenic
1171772168 20:29331137-29331159 CACAGCTTGAGATCAGAGAATGG + Intergenic
1172028762 20:31967622-31967644 GACCCCTCAAGATCAAAGGAGGG + Intergenic
1173377285 20:42497674-42497696 GACAACTTAAAACAAAAGGAAGG - Intronic
1175523151 20:59615798-59615820 GCCAACTTCAGGTCAAAGAGAGG + Intronic
1176524750 21:7857678-7857700 GAGAAATTTAGAACAAAGAATGG + Intergenic
1177073217 21:16537986-16538008 GACAATTTAAGAATAAATAATGG + Intergenic
1178658770 21:34487691-34487713 GAGAAATTTAGAACAAAGAATGG + Intergenic
1179521014 21:41944563-41944585 GAAAACTTAAGGTCAAGGGATGG + Intronic
1181836951 22:25618445-25618467 GACACTTTGAAATCAAAGAATGG - Intronic
1181854991 22:25775103-25775125 GAAAACTAAAGTTCAATGAACGG - Intronic
1184369564 22:44074073-44074095 GAAAACATAAGATAACAGAATGG + Intronic
1185261393 22:49866415-49866437 GACAGCTTAAGATAAATGAAAGG - Intronic
950381750 3:12621495-12621517 GACAACTTAAGATCACAACATGG + Intronic
956100443 3:65762426-65762448 GACAAGTGAAGTACAAAGAATGG + Intronic
956528069 3:70186801-70186823 GACAAATAAATATAAAAGAATGG - Intergenic
956961530 3:74408004-74408026 GAAAACATCAGGTCAAAGAAAGG - Intronic
958620125 3:96548101-96548123 GACAATTTAAGAAAAAAAAATGG + Intergenic
964455305 3:156858705-156858727 GAAAACTAAACATTAAAGAAAGG - Intronic
964934203 3:162061113-162061135 GACAACTTAAGATCTATAATGGG + Intergenic
965160041 3:165121516-165121538 GATAAGAAAAGATCAAAGAAGGG - Intergenic
969417276 4:7068809-7068831 GAAAACTGAAGATAACAGAAAGG - Intergenic
970361742 4:15316124-15316146 GATAACTGAAAATCAGAGAAGGG + Intergenic
973132649 4:46667277-46667299 TATAACTTAACATGAAAGAAAGG - Intergenic
973935391 4:55841441-55841463 AACAACTTTTGATCAAAGCAGGG + Intergenic
974311449 4:60215616-60215638 GACAATTTTAGAGAAAAGAAGGG + Intergenic
975714405 4:77191582-77191604 GAACACTCAAGATGAAAGAAGGG + Intronic
977304886 4:95310841-95310863 GACAACTATAGATCAACGCACGG + Intronic
978443085 4:108755114-108755136 AACAACTTTATATCATAGAATGG + Intronic
979021582 4:115506379-115506401 GTCAAGTCAAGAACAAAGAATGG + Intergenic
979794305 4:124827405-124827427 GTCAATTTAATATTAAAGAAAGG + Intergenic
981487854 4:145306540-145306562 GACAACTTAAGGAAAAAGGAAGG + Intergenic
982425564 4:155254519-155254541 GACAACTTAAAGCAAAAGAAAGG - Intergenic
983086768 4:163455300-163455322 GTGCACTTAAGATCAAAGAGAGG + Intergenic
984314682 4:178112915-178112937 GACAACTTAATATTAACAAAAGG + Intergenic
986031925 5:3902675-3902697 GAGAATTAAAGATCACAGAATGG - Intergenic
986923244 5:12714172-12714194 GAAAACTGAATATCAAAGTATGG + Intergenic
988273169 5:29044323-29044345 GACAAACTAAGATTAAACAAAGG - Intergenic
988496933 5:31753347-31753369 GGCAACTTTAGATGAATGAATGG - Intronic
988704430 5:33710445-33710467 GACAATTTGAGATCAGAAAATGG - Intronic
988873257 5:35414270-35414292 GAAAACTTATGATCTGAGAATGG + Intergenic
989978341 5:50611953-50611975 GACAACTTAAAGTAAAAGGAAGG + Intergenic
990777759 5:59322446-59322468 CACAAATAAAGAGCAAAGAAAGG + Intronic
995010238 5:107249074-107249096 GACAACTGAAGATGAGACAAGGG - Intergenic
997094001 5:130890084-130890106 GACAAATCAAAATCAAAGCATGG - Intergenic
999543485 5:152600359-152600381 TGCAACATAAGTTCAAAGAAGGG + Intergenic
1000805570 5:165786485-165786507 GAAAAAATAAGAGCAAAGAAGGG + Intergenic
1006550260 6:34816931-34816953 GACCACTTAAGATTAGAGGAAGG + Intronic
1006667256 6:35704425-35704447 GACACCTCAAGAGGAAAGAATGG + Intronic
1008239925 6:49098027-49098049 TGCAGCTTAAGATCTAAGAACGG + Intergenic
1011453112 6:87516738-87516760 GAAACCTTTAGATGAAAGAAAGG + Intronic
1014545516 6:122730794-122730816 CACAATTTTACATCAAAGAAAGG - Intergenic
1014594027 6:123310573-123310595 GACAACTTAAAGAAAAAGAAAGG + Intronic
1016929586 6:149390991-149391013 GATAATATAAGATCCAAGAATGG - Intronic
1017291693 6:152745018-152745040 AACAACTGAAGAACAAAGAGAGG + Intergenic
1017300840 6:152855921-152855943 GACTACTTAAGATGCAGGAAGGG - Intergenic
1017537569 6:155364528-155364550 GACAACTTGATATTAAACAATGG + Intergenic
1017586058 6:155924526-155924548 GACAACTTAAAAGAACAGAAAGG + Intergenic
1017653587 6:156605350-156605372 CACAGCTTGAGATCTAAGAACGG + Intergenic
1018026772 6:159813039-159813061 AACAACTGAAGAACAGAGAAGGG + Intronic
1018457133 6:163962575-163962597 GACAACTTAAGAGGAAAGCCGGG - Intergenic
1018530802 6:164761265-164761287 GAATACTTAACATGAAAGAATGG - Intergenic
1018584515 6:165341360-165341382 GACAACTTAAAGTAAAAGGAAGG - Intronic
1020649935 7:10861769-10861791 GACAACAAAAGTTCAAAGATTGG + Intergenic
1022212590 7:28225957-28225979 GACAACCTAAGTGCAAAGCAGGG - Intergenic
1024688863 7:51778005-51778027 AACAACTTTAGATGAAAAAATGG + Intergenic
1025593895 7:62900521-62900543 CACAGCTTGAGATCAGAGAATGG + Intergenic
1026223962 7:68424599-68424621 AAGAAATTTAGATCAAAGAAAGG + Intergenic
1027692372 7:81364217-81364239 GACAGATTATGATCAAGGAAAGG + Intergenic
1028084736 7:86622489-86622511 GTAAACTCAAGATCAGAGAATGG + Intergenic
1028681274 7:93536139-93536161 CACAACTTAAAATCAATGACTGG - Intronic
1031380076 7:121074738-121074760 GACAACTTAAAGCAAAAGAAAGG - Intronic
1033023958 7:137754723-137754745 GCCAACTTTTGAGCAAAGAAAGG + Intronic
1033373559 7:140735315-140735337 GACAACCCAAGAGCAAAGATAGG + Intronic
1033496478 7:141902095-141902117 GACTATTGAAGATCAAAAAAAGG - Intergenic
1036214023 8:6864185-6864207 GTCAACTTAACATAATAGAAAGG + Intergenic
1036913170 8:12776342-12776364 GAAAAATCAAGATGAAAGAATGG + Intergenic
1038617468 8:29108188-29108210 GACAACTGAAGAAGAAAGAAAGG + Exonic
1039743687 8:40404890-40404912 AAGAACTTTAGAACAAAGAAAGG + Intergenic
1042182573 8:66106225-66106247 GACAACTTAAGGCAAAAGGAAGG - Intergenic
1042859514 8:73298135-73298157 GACAACTTGAGATGAAAAACTGG - Intronic
1043177644 8:77042509-77042531 CACAGCTTGAGATCTAAGAATGG + Intergenic
1043538928 8:81237462-81237484 AACAATTTAATATCAGAGAATGG - Intergenic
1044013431 8:87022369-87022391 GATAACTTAACAACAAAGAGGGG - Intronic
1045188685 8:99862746-99862768 GAGAACTGAAGATCAGAGAGAGG - Intronic
1046472945 8:114702821-114702843 AACAACTTAAAACAAAAGAAAGG + Intergenic
1048557866 8:135498427-135498449 GTCCACTTCAGATCAAAGAAAGG - Intronic
1050215026 9:3313031-3313053 CAGAATTTAAGATCTAAGAACGG + Intronic
1052200998 9:25780012-25780034 GGCAACATAAGATCTAAGAATGG - Intergenic
1054756113 9:68959759-68959781 GACAACTAAAGAAAACAGAATGG - Intronic
1055952279 9:81741077-81741099 GTCAACTTAAGGACAAAGAAAGG + Intergenic
1056378059 9:86033685-86033707 ATCAACTCAAGATAAAAGAAAGG + Intronic
1057734339 9:97640422-97640444 AACAACTCAAGTTAAAAGAATGG + Intronic
1058344386 9:103943271-103943293 GGCAAATTAAGCTCAAACAAGGG - Intergenic
1058805652 9:108588767-108588789 GAAATCTTAATATGAAAGAATGG + Intergenic
1059269179 9:113061383-113061405 GGAAACCTAAGGTCAAAGAAAGG - Intergenic
1059270314 9:113066832-113066854 GGAAACCTAAGGTCAAAGAAAGG - Intergenic
1059271450 9:113072282-113072304 GGAAACCTAAGGTCAAAGAAAGG - Intergenic
1059272581 9:113077726-113077748 GGAAACCTAAGGTCAAAGAAAGG - Intergenic
1059273716 9:113083168-113083190 GGAAACCTAAGGTCAAAGAAAGG - Intergenic
1059274851 9:113088614-113088636 GGAAACCTAAGGTCAAAGAAAGG - Intergenic
1059953053 9:119487842-119487864 GAAAGCTAAAGATCAAGGAACGG + Intergenic
1060559010 9:124527593-124527615 AGCAACTGAAGTTCAAAGAAGGG + Intronic
1185913401 X:4007544-4007566 GAAAACTTAATATCCAATAAAGG + Intergenic
1186045610 X:5533616-5533638 TAAAACTTTAAATCAAAGAATGG - Intergenic
1187112416 X:16315212-16315234 AAGAACTTTAGAACAAAGAATGG - Intergenic
1187501125 X:19839627-19839649 GATTACTTAAGTTTAAAGAAAGG - Intronic
1187573147 X:20525998-20526020 GACATATTAAGATCAAAGTGGGG + Intergenic
1190903143 X:54698142-54698164 TACAGCTTGAGATCTAAGAATGG + Intergenic
1190942110 X:55052283-55052305 CACAGCTTAAGATCTGAGAATGG - Intergenic
1195079079 X:101354280-101354302 GACAACTGCAGATAAAAGGAAGG - Intronic
1195479011 X:105321274-105321296 GACAACTGAAGCTCAGAGAGGGG + Intronic
1196797485 X:119514051-119514073 GACACCTGAAGATTAAATAAGGG + Intergenic
1197236070 X:124065199-124065221 GACAAATTAAAATCAAGCAATGG + Intronic
1198249170 X:134862844-134862866 GACAAATTAGGACCAAAGGATGG - Intergenic
1198487190 X:137099387-137099409 GACAACTTCAGTTCAGAAAAAGG - Intergenic
1199261155 X:145776931-145776953 GAAAAATTAAGATCTAAAAATGG + Intergenic
1199389839 X:147266568-147266590 GACAACTAAATACAAAAGAAAGG - Intergenic
1199551695 X:149068304-149068326 GACACCTTGATCTCAAAGAAGGG - Intergenic
1199877213 X:151943253-151943275 GAAAACATAAGATCTAAGAATGG - Intergenic
1200353374 X:155522318-155522340 AACAAGTTAACATCAAGGAAGGG - Intronic
1200711943 Y:6492612-6492634 AACACCTTGAGATCAAAGAGGGG + Intergenic
1201021991 Y:9669360-9669382 AACACCTTGAGATCAAAGAGGGG - Intergenic