ID: 1078164642

View in Genome Browser
Species Human (GRCh38)
Location 11:8871341-8871363
Sequence CCATCCGACCAAGAGTTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078164633_1078164642 7 Left 1078164633 11:8871311-8871333 CCCCCAAACTGGACGGCCCTCAC 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1078164642 11:8871341-8871363 CCATCCGACCAAGAGTTGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 51
1078164637_1078164642 -9 Left 1078164637 11:8871327-8871349 CCCTCACCTCCTCACCATCCGAC 0: 1
1: 0
2: 0
3: 26
4: 308
Right 1078164642 11:8871341-8871363 CCATCCGACCAAGAGTTGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 51
1078164634_1078164642 6 Left 1078164634 11:8871312-8871334 CCCCAAACTGGACGGCCCTCACC 0: 1
1: 0
2: 0
3: 4
4: 116
Right 1078164642 11:8871341-8871363 CCATCCGACCAAGAGTTGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 51
1078164636_1078164642 4 Left 1078164636 11:8871314-8871336 CCAAACTGGACGGCCCTCACCTC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1078164642 11:8871341-8871363 CCATCCGACCAAGAGTTGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 51
1078164638_1078164642 -10 Left 1078164638 11:8871328-8871350 CCTCACCTCCTCACCATCCGACC 0: 1
1: 0
2: 3
3: 34
4: 411
Right 1078164642 11:8871341-8871363 CCATCCGACCAAGAGTTGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 51
1078164635_1078164642 5 Left 1078164635 11:8871313-8871335 CCCAAACTGGACGGCCCTCACCT 0: 1
1: 0
2: 1
3: 9
4: 84
Right 1078164642 11:8871341-8871363 CCATCCGACCAAGAGTTGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078164642 Original CRISPR CCATCCGACCAAGAGTTGTC TGG Intronic
901756462 1:11444343-11444365 CCACCCGTCCAAGAGCTGTGGGG - Intergenic
915167658 1:153957665-153957687 CCGTCCGACCATAAGTTGTGTGG - Intronic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
1065136138 10:22672257-22672279 CCCCCCGACCCAGAGCTGTCAGG - Intronic
1070540361 10:77411264-77411286 CCCACCCACCAAGATTTGTCAGG - Intronic
1071789817 10:88941908-88941930 CCATCTGACAAAGAATGGTCAGG + Intronic
1078164642 11:8871341-8871363 CCATCCGACCAAGAGTTGTCTGG + Intronic
1081042492 11:38228613-38228635 CCTTCAGACCATGAGTTGTCTGG + Intergenic
1084465273 11:69319696-69319718 CCATCAGACCACCTGTTGTCTGG + Intronic
1090664487 11:128905568-128905590 CGATCCGGCCAAGAGATGGCGGG + Exonic
1092637761 12:10469678-10469700 GCCTCCCAACAAGAGTTGTCAGG - Intergenic
1098938200 12:76504508-76504530 CCATCAGAAGAAGAGTGGTCTGG - Intronic
1102509042 12:113402030-113402052 CCCTCTGACCAAGGGATGTCTGG - Intronic
1105811514 13:24000425-24000447 CCTCCCCACCAAGAGCTGTCTGG - Intronic
1106611555 13:31287617-31287639 CCATCCAATCAAAAGTTGCCAGG + Intronic
1112201150 13:97276346-97276368 TCATCCCCCCAAAAGTTGTCAGG + Exonic
1114769885 14:25417007-25417029 CCAGCAGACCCAGAGTAGTCAGG - Intergenic
1115416888 14:33145806-33145828 CTATCGGACCAAGAAATGTCAGG + Intronic
1121712534 14:96050142-96050164 GCATCCAACCAAGAATTATCAGG - Intronic
1134507467 16:14819839-14819861 CCACCCAACAAAGAATTGTCTGG + Intronic
1134695166 16:16218594-16218616 CCACCCAACAAAGAATTGTCTGG + Intronic
1134976665 16:18576054-18576076 CCACCCAACAAAGAATTGTCTGG - Intergenic
1138824652 16:60304294-60304316 GCAGCCGTCCAAGTGTTGTCTGG - Intergenic
1143738745 17:8935713-8935735 CCATCCTGCCAGGAGCTGTCCGG - Intronic
1150176913 17:63066697-63066719 CTATAGTACCAAGAGTTGTCAGG + Intronic
1155094017 18:22538532-22538554 CCATCAAAACTAGAGTTGTCTGG - Intergenic
1157007723 18:43605801-43605823 CCATCAGACTAAGAGTGGACAGG - Intergenic
1157105208 18:44767922-44767944 TCATCCTACCAATAGTTCTCAGG - Intronic
1159625723 18:70691757-70691779 CCAGCCTACAAACAGTTGTCTGG + Intergenic
1161525888 19:4754961-4754983 CCTACCAACCAAGAGTTATCTGG - Intergenic
929200961 2:39235252-39235274 TCATCCAATCAAGAGTTGACTGG + Intergenic
936484096 2:112911794-112911816 ACATCAGAGCAAGAGATGTCTGG - Intergenic
941770657 2:169341953-169341975 CCATACTACAAAGAATTGTCTGG - Intronic
944313011 2:198256219-198256241 CAAGCCCACCAAGAGGTGTCAGG - Intronic
946034718 2:216732513-216732535 CCACCCGCCCAACAGCTGTCAGG - Intergenic
948562123 2:238861175-238861197 CCATGAGACCAAGATGTGTCTGG - Intronic
1174972511 20:55292226-55292248 CAATCCCAGCAAGAGCTGTCTGG - Intergenic
1177210892 21:18069597-18069619 CCATGCGTCCAAGAGTGGTTTGG + Intronic
949348598 3:3100536-3100558 CTATAAGACAAAGAGTTGTCAGG - Intronic
953413246 3:42701836-42701858 CCGTCAGCCCAAGAGTTGCCTGG - Intronic
964131693 3:153295987-153296009 TCAGCTGACCAAGAGTTGTCTGG - Intergenic
969593753 4:8136628-8136650 CCTGCAGACCACGAGTTGTCTGG - Intronic
987195443 5:15521179-15521201 TCTTCCCTCCAAGAGTTGTCGGG + Intronic
988551480 5:32204586-32204608 CCATACCCCCAAGAGTGGTCTGG - Intergenic
990283875 5:54280086-54280108 CCATCCAGCCAAGACTTCTCAGG + Intronic
993395381 5:87380574-87380596 CCATGAGAACAAGAGTTGTTAGG + Exonic
995732075 5:115256247-115256269 CCATACAACCAAGAATTATCTGG + Intronic
996754098 5:126917923-126917945 CCATCTGACAAAGAGTTCTCTGG + Intronic
1009596768 6:65746032-65746054 CCAGCAAACCAAGAGTTCTCAGG - Intergenic
1022597098 7:31723255-31723277 CCAACCAACCAAGAGGTGTCAGG - Intergenic
1040880255 8:52197265-52197287 CCAACACACCCAGAGTTGTCTGG - Intronic
1042299912 8:67266867-67266889 TCACCTTACCAAGAGTTGTCTGG + Exonic
1061721564 9:132555022-132555044 CCATCCAGCCAAGATTTGTTTGG + Intronic
1187299342 X:18032669-18032691 GCATCCTACCCAGAGTTGGCTGG - Intergenic
1192508972 X:71710870-71710892 CCATCTGACAAACAGTTGTAAGG - Intergenic
1192517725 X:71770683-71770705 CCATCTGACAAACAGTTGTAAGG + Intergenic