ID: 1078168521

View in Genome Browser
Species Human (GRCh38)
Location 11:8911126-8911148
Sequence CGCCAATGGCCCAGCTGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 91}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078168509_1078168521 12 Left 1078168509 11:8911091-8911113 CCACTTCTCCCGCCTCTCCCGCC 0: 1
1: 3
2: 9
3: 165
4: 1378
Right 1078168521 11:8911126-8911148 CGCCAATGGCCCAGCTGCGCCGG 0: 1
1: 0
2: 1
3: 4
4: 91
1078168515_1078168521 -9 Left 1078168515 11:8911112-8911134 CCTCTCCCGCCTTCCGCCAATGG 0: 1
1: 0
2: 0
3: 12
4: 113
Right 1078168521 11:8911126-8911148 CGCCAATGGCCCAGCTGCGCCGG 0: 1
1: 0
2: 1
3: 4
4: 91
1078168501_1078168521 26 Left 1078168501 11:8911077-8911099 CCGCCCCGCCTCCCCCACTTCTC 0: 1
1: 1
2: 23
3: 174
4: 1903
Right 1078168521 11:8911126-8911148 CGCCAATGGCCCAGCTGCGCCGG 0: 1
1: 0
2: 1
3: 4
4: 91
1078168511_1078168521 3 Left 1078168511 11:8911100-8911122 CCGCCTCTCCCGCCTCTCCCGCC 0: 2
1: 3
2: 53
3: 290
4: 2206
Right 1078168521 11:8911126-8911148 CGCCAATGGCCCAGCTGCGCCGG 0: 1
1: 0
2: 1
3: 4
4: 91
1078168510_1078168521 4 Left 1078168510 11:8911099-8911121 CCCGCCTCTCCCGCCTCTCCCGC 0: 2
1: 0
2: 38
3: 215
4: 1281
Right 1078168521 11:8911126-8911148 CGCCAATGGCCCAGCTGCGCCGG 0: 1
1: 0
2: 1
3: 4
4: 91
1078168502_1078168521 23 Left 1078168502 11:8911080-8911102 CCCCGCCTCCCCCACTTCTCCCG 0: 1
1: 0
2: 5
3: 77
4: 742
Right 1078168521 11:8911126-8911148 CGCCAATGGCCCAGCTGCGCCGG 0: 1
1: 0
2: 1
3: 4
4: 91
1078168500_1078168521 30 Left 1078168500 11:8911073-8911095 CCAGCCGCCCCGCCTCCCCCACT 0: 1
1: 0
2: 15
3: 134
4: 1290
Right 1078168521 11:8911126-8911148 CGCCAATGGCCCAGCTGCGCCGG 0: 1
1: 0
2: 1
3: 4
4: 91
1078168512_1078168521 0 Left 1078168512 11:8911103-8911125 CCTCTCCCGCCTCTCCCGCCTTC 0: 1
1: 0
2: 5
3: 104
4: 1472
Right 1078168521 11:8911126-8911148 CGCCAATGGCCCAGCTGCGCCGG 0: 1
1: 0
2: 1
3: 4
4: 91
1078168503_1078168521 22 Left 1078168503 11:8911081-8911103 CCCGCCTCCCCCACTTCTCCCGC 0: 1
1: 0
2: 9
3: 88
4: 1004
Right 1078168521 11:8911126-8911148 CGCCAATGGCCCAGCTGCGCCGG 0: 1
1: 0
2: 1
3: 4
4: 91
1078168506_1078168521 15 Left 1078168506 11:8911088-8911110 CCCCCACTTCTCCCGCCTCTCCC 0: 1
1: 0
2: 12
3: 202
4: 1730
Right 1078168521 11:8911126-8911148 CGCCAATGGCCCAGCTGCGCCGG 0: 1
1: 0
2: 1
3: 4
4: 91
1078168505_1078168521 18 Left 1078168505 11:8911085-8911107 CCTCCCCCACTTCTCCCGCCTCT 0: 1
1: 0
2: 9
3: 131
4: 1385
Right 1078168521 11:8911126-8911148 CGCCAATGGCCCAGCTGCGCCGG 0: 1
1: 0
2: 1
3: 4
4: 91
1078168504_1078168521 21 Left 1078168504 11:8911082-8911104 CCGCCTCCCCCACTTCTCCCGCC 0: 1
1: 0
2: 17
3: 284
4: 2238
Right 1078168521 11:8911126-8911148 CGCCAATGGCCCAGCTGCGCCGG 0: 1
1: 0
2: 1
3: 4
4: 91
1078168507_1078168521 14 Left 1078168507 11:8911089-8911111 CCCCACTTCTCCCGCCTCTCCCG 0: 1
1: 0
2: 3
3: 35
4: 523
Right 1078168521 11:8911126-8911148 CGCCAATGGCCCAGCTGCGCCGG 0: 1
1: 0
2: 1
3: 4
4: 91
1078168513_1078168521 -5 Left 1078168513 11:8911108-8911130 CCCGCCTCTCCCGCCTTCCGCCA 0: 1
1: 0
2: 2
3: 47
4: 509
Right 1078168521 11:8911126-8911148 CGCCAATGGCCCAGCTGCGCCGG 0: 1
1: 0
2: 1
3: 4
4: 91
1078168514_1078168521 -6 Left 1078168514 11:8911109-8911131 CCGCCTCTCCCGCCTTCCGCCAA 0: 1
1: 0
2: 3
3: 37
4: 354
Right 1078168521 11:8911126-8911148 CGCCAATGGCCCAGCTGCGCCGG 0: 1
1: 0
2: 1
3: 4
4: 91
1078168508_1078168521 13 Left 1078168508 11:8911090-8911112 CCCACTTCTCCCGCCTCTCCCGC 0: 1
1: 0
2: 3
3: 48
4: 560
Right 1078168521 11:8911126-8911148 CGCCAATGGCCCAGCTGCGCCGG 0: 1
1: 0
2: 1
3: 4
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078168521 Original CRISPR CGCCAATGGCCCAGCTGCGC CGG Exonic
903180522 1:21602835-21602857 TGCCAATGGCGCTGCTGCGGCGG + Exonic
903750127 1:25616545-25616567 CGCCAATGGTCCAGCGGCGCGGG - Intergenic
910687780 1:89935508-89935530 CGACACTGGCCCAGCTGGGCTGG - Exonic
912716893 1:111989587-111989609 CGCCGAGCGCCCAGCAGCGCGGG + Intergenic
913664042 1:121031171-121031193 CGGCACTGGCCCAGCAGAGCAGG - Intergenic
914015434 1:143814450-143814472 CGGCACTGGCCCAGCAGAGCAGG - Intergenic
914162351 1:145146558-145146580 CGGCACTGGCCCAGCAGAGCAGG + Intergenic
914654052 1:149722991-149723013 CGGCACTGGCCCAGCAGAGCAGG - Intergenic
919812496 1:201417862-201417884 CTCCCAAGGCCCAGCTGGGCAGG - Intronic
1063176124 10:3552378-3552400 CTGCAATGGCCCAGCAGAGCAGG - Intergenic
1063230643 10:4062977-4062999 GGCCAATGGCCCAGCAGGACTGG + Intergenic
1066681993 10:37943345-37943367 AGCCATTGGCACAGCTGCCCTGG + Intergenic
1071593522 10:86899798-86899820 CTCCAAAAGCCCAGCTACGCCGG + Exonic
1072253569 10:93600633-93600655 CGCAAAGGGCGCAGCTGCCCCGG + Intronic
1077235497 11:1480198-1480220 GGCCAGTGGCCCAGCTACCCAGG - Intronic
1078168521 11:8911126-8911148 CGCCAATGGCCCAGCTGCGCCGG + Exonic
1083691140 11:64409631-64409653 TGCCCTTGGCCCGGCTGCGCAGG - Intergenic
1087039352 11:93783967-93783989 CGCCTGTGGTCCAGCTACGCGGG - Intronic
1089352286 11:117828490-117828512 GGCCAACGGCCCAGCTGGACTGG - Intronic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1100845733 12:98655736-98655758 CGCCTGTGGCCCAGCTACTCAGG - Intronic
1101605667 12:106246775-106246797 CGTCAAAGGCCCACCTGGGCAGG + Intronic
1104067894 12:125320191-125320213 CAACAATGGCCCAGCTGGGGAGG + Intronic
1117176663 14:53152916-53152938 TGCCCCTGGCCCTGCTGCGCGGG - Exonic
1119475292 14:74923293-74923315 AGCCAATGGCCGCGCTGCACCGG - Intronic
1122922311 14:104885119-104885141 TGCCTCTGGCCCAGCTGGGCAGG + Intronic
1125568300 15:40694686-40694708 CGCTAATAGTCCAGCTGCGATGG + Intergenic
1129157622 15:73728608-73728630 CACCAATGGCCCTGCTGTGAAGG - Intergenic
1140270765 16:73464727-73464749 TGCCAATGTCACAGCTGTGCTGG + Intergenic
1142146893 16:88496497-88496519 CACCAAAGGCCCAGCTTCCCAGG - Intronic
1143294301 17:5859341-5859363 AGCCAATGGCAGAGCTGCCCTGG + Intronic
1145314318 17:21720236-21720258 GGCCCATGGCCCTGCTGCTCTGG - Intergenic
1145712768 17:26992212-26992234 GGCCCATGGCCCTGCTGCTCTGG - Intergenic
1147311719 17:39599555-39599577 CACCAAGGGCACAGCTGGGCGGG - Intergenic
1148325210 17:46779385-46779407 AGCCCCTGGCCCAGCTGCGAAGG - Intronic
1148591152 17:48817419-48817441 CTCCAGAGGTCCAGCTGCGCGGG + Intergenic
1149552696 17:57551953-57551975 AGCCAATAGCCCAGCTTCCCTGG + Intronic
1149602047 17:57899344-57899366 CGCCCAGAGCCCAGCTGCCCAGG + Intronic
1149718331 17:58816918-58816940 CGCCATAGGCCCAGCTACTCAGG - Intronic
1152419983 17:80187546-80187568 CTGCAATGGTCCAGCTGGGCTGG - Intronic
1152490647 17:80630953-80630975 CGCCCAAGGCCCAGATGCCCAGG - Intronic
1158930952 18:62325064-62325086 CGCCCCTGGCCCAGGTGCTCGGG - Intergenic
1160024657 18:75208200-75208222 CGACCCTGGCCCAGCTGCCCGGG + Intronic
1160168276 18:76532024-76532046 TGCCCATGACCCAGCTGCCCAGG - Intergenic
1160693405 19:470727-470749 CTCCAAGGTCCCAGCTGGGCTGG - Intronic
1160735444 19:660288-660310 AGAGAATGACCCAGCTGCGCGGG + Intronic
1161103261 19:2431821-2431843 CGCCCGTGCCCCAGCTGCTCTGG + Exonic
1161595829 19:5150591-5150613 AGCCCATGGACCAGCTGTGCTGG - Intronic
1163666502 19:18606302-18606324 CGCCCTCGGCCCAGCTGCCCAGG + Intronic
1165393818 19:35553121-35553143 CGGCAATGGCCCAGGAGGGCTGG - Exonic
1166055406 19:40285225-40285247 CGCCCATCGCCACGCTGCGCTGG + Exonic
1166194191 19:41195417-41195439 CCCCACTGGCCTAGGTGCGCTGG - Intronic
1167784704 19:51627568-51627590 GGCCCAGGGCCCAGCTGAGCTGG + Exonic
927302797 2:21535772-21535794 GGCCCAGGGCCCAGCTGCTCTGG + Intergenic
933741706 2:85539064-85539086 CGCCAATGCACCACTTGCGCGGG - Intergenic
936258151 2:110934929-110934951 CGCCATTGCCCCAGCTGCCTTGG - Intronic
948427064 2:237895048-237895070 CACCAAGGGCCCAGCAGGGCAGG + Intronic
949072884 2:242036721-242036743 TGACAATGGCCCAGCGGCGACGG - Intergenic
1175193218 20:57225036-57225058 CGCCAGCTGCCCAGCTGTGCAGG - Intronic
1175961445 20:62638801-62638823 GGCCAAGGGCCCAGCTCAGCAGG + Intergenic
1179909888 21:44442097-44442119 GGCCAAGGGCCCAGCTGCACAGG - Exonic
1181743825 22:24942118-24942140 CGCCTATGTCCCAGCTACTCGGG - Intronic
1181801519 22:25350766-25350788 AGCCAGTGGCGCAGCTGTGCGGG - Intergenic
1182900024 22:33890043-33890065 AGCCAGTGGGCCAGCTGGGCTGG - Intronic
1183027437 22:35076464-35076486 TCCCCATGGCCCACCTGCGCTGG - Intronic
1183224210 22:36538163-36538185 GGCCAATGGGCCAGTTGCGGTGG - Intergenic
949981948 3:9507705-9507727 GGCCAAGGGCCCACCTGGGCGGG - Intronic
955386882 3:58487502-58487524 CGCCATTTGCCGAGCTGAGCTGG + Intergenic
961234908 3:125357617-125357639 CCCGATTGGGCCAGCTGCGCGGG - Intronic
968676118 4:1881200-1881222 CGCCTGTGTCCCAGCTACGCAGG - Intronic
972670994 4:41214138-41214160 TGCCACTGGCCCTGCGGCGCGGG + Intronic
979237128 4:118413756-118413778 CGCCTGTAGCCCAGCTGCTCGGG - Intergenic
982074761 4:151727399-151727421 GGCCAATGGCCCAACTGCTACGG + Intronic
985923288 5:2996335-2996357 CTCCAATGGCAGAGCTGCGAGGG + Intergenic
1001295768 5:170497824-170497846 CGCCAGTGTCCCAGCTGCGTGGG + Intronic
1001534618 5:172489876-172489898 TGCCTATGCCCCAGCTGAGCTGG - Intergenic
1007693208 6:43716142-43716164 CGCCATTGGCCCAGCTCCCAGGG + Intergenic
1007763832 6:44149766-44149788 GGCCAAGGGCCCAGCTGGGGAGG + Intronic
1008605359 6:53134213-53134235 TGCGCATGGCCCAGCTGCTCAGG + Exonic
1015076037 6:129158761-129158783 CTCCAAAAGCCCAGCTACGCCGG - Intronic
1019345928 7:530932-530954 CGCCACTGGGCCAGCAGAGCTGG + Intergenic
1021184092 7:17542685-17542707 AGCCATTGGCCTAGCTGCTCAGG + Intergenic
1023623056 7:42092011-42092033 CGCCACTGGCCCTGCTTCCCAGG - Intronic
1026049300 7:66931594-66931616 CACCAATGGCCCAGCTACTTGGG - Intronic
1034453841 7:151153670-151153692 CGCCTATGGCCCAGCTACTTGGG - Intronic
1034979177 7:155465527-155465549 CGCCAACGGCCCAGCTGCCTGGG - Intergenic
1035730845 8:1852812-1852834 CCCCAATGGCCCTGCTGTGACGG + Intronic
1036910536 8:12754573-12754595 CGCCAGCGGCCCAGCGGCCCCGG + Intronic
1042484359 8:69334424-69334446 CGACAATGGCCCAGCGGCCACGG - Intergenic
1050255902 9:3791536-3791558 CGCCAATTGCCTAGCTTCTCTGG + Intergenic
1053169485 9:35868590-35868612 CGAGAATGGCCCAGCTTCCCTGG - Intergenic
1054947065 9:70806563-70806585 CGCCTATAGCCCAGCTACTCGGG + Intronic
1055159898 9:73113686-73113708 CGCCATTGTCCCAGCTACTCAGG - Intergenic
1060756729 9:126219337-126219359 CCCCATTGTCCCAGCTGCTCAGG + Intergenic
1062716968 9:138015597-138015619 CGGCATTGGCCCCGCTCCGCAGG - Intronic
1189857845 X:45241149-45241171 CGCCATTCACCCAGCTGCTCAGG - Intergenic
1196304547 X:114086524-114086546 CGCCTGTGGCCCAGCTACTCGGG - Intergenic