ID: 1078169568

View in Genome Browser
Species Human (GRCh38)
Location 11:8919240-8919262
Sequence CTGTCCTTGCAGAGGTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 266}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078169568_1078169574 -8 Left 1078169568 11:8919240-8919262 CCATCACACCTCTGCAAGGACAG 0: 1
1: 0
2: 1
3: 33
4: 266
Right 1078169574 11:8919255-8919277 AAGGACAGGTAGCCTGCTGGGGG 0: 1
1: 1
2: 2
3: 15
4: 196
1078169568_1078169581 10 Left 1078169568 11:8919240-8919262 CCATCACACCTCTGCAAGGACAG 0: 1
1: 0
2: 1
3: 33
4: 266
Right 1078169581 11:8919273-8919295 GGGGGGCCATGGTGGCACTGGGG 0: 1
1: 0
2: 4
3: 38
4: 372
1078169568_1078169573 -9 Left 1078169568 11:8919240-8919262 CCATCACACCTCTGCAAGGACAG 0: 1
1: 0
2: 1
3: 33
4: 266
Right 1078169573 11:8919254-8919276 CAAGGACAGGTAGCCTGCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 223
1078169568_1078169577 2 Left 1078169568 11:8919240-8919262 CCATCACACCTCTGCAAGGACAG 0: 1
1: 0
2: 1
3: 33
4: 266
Right 1078169577 11:8919265-8919287 AGCCTGCTGGGGGGCCATGGTGG 0: 1
1: 0
2: 1
3: 62
4: 782
1078169568_1078169576 -1 Left 1078169568 11:8919240-8919262 CCATCACACCTCTGCAAGGACAG 0: 1
1: 0
2: 1
3: 33
4: 266
Right 1078169576 11:8919262-8919284 GGTAGCCTGCTGGGGGGCCATGG 0: 1
1: 0
2: 1
3: 61
4: 2173
1078169568_1078169580 9 Left 1078169568 11:8919240-8919262 CCATCACACCTCTGCAAGGACAG 0: 1
1: 0
2: 1
3: 33
4: 266
Right 1078169580 11:8919272-8919294 TGGGGGGCCATGGTGGCACTGGG 0: 1
1: 0
2: 4
3: 19
4: 270
1078169568_1078169575 -7 Left 1078169568 11:8919240-8919262 CCATCACACCTCTGCAAGGACAG 0: 1
1: 0
2: 1
3: 33
4: 266
Right 1078169575 11:8919256-8919278 AGGACAGGTAGCCTGCTGGGGGG 0: 1
1: 0
2: 1
3: 17
4: 262
1078169568_1078169572 -10 Left 1078169568 11:8919240-8919262 CCATCACACCTCTGCAAGGACAG 0: 1
1: 0
2: 1
3: 33
4: 266
Right 1078169572 11:8919253-8919275 GCAAGGACAGGTAGCCTGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 188
1078169568_1078169579 8 Left 1078169568 11:8919240-8919262 CCATCACACCTCTGCAAGGACAG 0: 1
1: 0
2: 1
3: 33
4: 266
Right 1078169579 11:8919271-8919293 CTGGGGGGCCATGGTGGCACTGG 0: 1
1: 1
2: 5
3: 35
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078169568 Original CRISPR CTGTCCTTGCAGAGGTGTGA TGG (reversed) Intronic
900106006 1:981396-981418 CTGCCCCAGCTGAGGTGTGATGG - Intronic
900281936 1:1875478-1875500 GTGTCCTTGGCCAGGTGTGATGG - Intronic
900802340 1:4745260-4745282 CGGTGCTGGCAGAGGTGGGAGGG - Intronic
901162779 1:7192689-7192711 CTTACCTTGCAGGGTTGTGAGGG - Intronic
904997011 1:34639190-34639212 GTGTCCTTGGAGGGCTGTGAGGG - Intergenic
905319427 1:37105457-37105479 CTGTCCTTGAGGAGGTTCGAGGG + Intergenic
906808880 1:48806361-48806383 CTGTCCCTGCTGGAGTGTGAGGG - Intronic
909651215 1:77978383-77978405 CCTTCCTTGTAGAGGTGTGACGG + Intronic
910383622 1:86657937-86657959 CAGGCCTTGCAGAGCTGTGGTGG - Intergenic
911150573 1:94593902-94593924 CTGTCCCTTCAGAGTTGTGCTGG - Intergenic
912280728 1:108309662-108309684 GTGTCCTTGCAGGGGGATGATGG + Intergenic
912287498 1:108384695-108384717 GTGTCCTTGCAGGGGGATGATGG - Intronic
913543165 1:119841306-119841328 CTGTCATTGTGGAGGTGTGGAGG + Intergenic
914241533 1:145856364-145856386 CTGCACTTGCTGGGGTGTGAGGG + Exonic
914428828 1:147601130-147601152 CTGTCCTCCAAGAGGTCTGAAGG + Intronic
917117507 1:171617248-171617270 CAGTCCATGCTGAGGTCTGAAGG - Intergenic
918070613 1:181131287-181131309 CTGTCCTGGCAGTGGCCTGAGGG + Intergenic
919857044 1:201713001-201713023 CTGACCTGGCAGAGGTGTGGAGG - Intronic
920068508 1:203286263-203286285 TTCACCTTGCAGAGGTGTGGTGG - Intergenic
920508951 1:206536595-206536617 CTATCTTGGCAGAGGGGTGATGG - Intronic
921003551 1:211069168-211069190 CTGTCCCTGCCAAGGGGTGAGGG + Intronic
922473104 1:225888716-225888738 CTGGCCTTGCAGAGGTCTGTGGG - Intronic
922478644 1:225923879-225923901 CTGTCCTCGTAGAGGGTTGAGGG - Intronic
923192693 1:231635146-231635168 CTGTCCTGGCAGCAGTGTGCAGG - Intronic
924015191 1:239713635-239713657 CTGTCCATGGAGATCTGTGATGG - Intronic
924586046 1:245362158-245362180 CTGTGCTTGATGGGGTGTGAAGG - Intronic
1067180229 10:43979773-43979795 CTCTCCATGCAGTGCTGTGAGGG + Intergenic
1067432357 10:46252741-46252763 TTCTCTTTGCAGAGGTGTGGAGG - Intergenic
1069009152 10:63351751-63351773 CTTTCCTTGCAGACCTGTGAAGG - Intronic
1069625180 10:69863384-69863406 CTGTCCTGGCAGAGATGGGTGGG + Intronic
1069641207 10:69956609-69956631 CTGTCCTTGCCAAGGTTTTATGG + Intronic
1069823706 10:71242644-71242666 CTGTCCCTGCAGAGGGTTGGCGG + Intronic
1070297896 10:75179860-75179882 CTGTAGTTGCAGACTTGTGAAGG + Exonic
1070349280 10:75576274-75576296 GTGGCCTTGCTGAGGTGTGGTGG - Intronic
1071559275 10:86632547-86632569 CTGGCCCTGCAGGGGTGTGTGGG - Intergenic
1072319234 10:94232797-94232819 CTGTGCTTGCAGAGTTGGGAGGG - Intronic
1075675794 10:124294961-124294983 CTGTACTTGCAGAGGCATGATGG - Intergenic
1075844576 10:125535126-125535148 CTGTTCCTGCAGAGCTGTGTTGG - Intergenic
1076231124 10:128820864-128820886 CAGTCCCTGCACAGGTGTGGTGG - Intergenic
1077633722 11:3827710-3827732 CTGGCCCTGCTGCGGTGTGATGG + Exonic
1078085478 11:8230992-8231014 CTATCCATGTAGAGCTGTGATGG + Intronic
1078169568 11:8919240-8919262 CTGTCCTTGCAGAGGTGTGATGG - Intronic
1080339330 11:31241564-31241586 TAGTCCTCGCAAAGGTGTGATGG + Intronic
1084335493 11:68455355-68455377 CTGTCACTGCAGAGGTGAGAGGG - Intergenic
1084570346 11:69956087-69956109 AGGTCCTGGCAGAGGTGTGGTGG + Intergenic
1085218109 11:74849859-74849881 CTGTCCATGCCTAGGTGTGAGGG + Intronic
1085528816 11:77179723-77179745 CTGTCCTTGCAGATGCGTCTGGG + Exonic
1087629645 11:100635511-100635533 CAGTCCTTCCAGAGTTCTGAGGG + Intergenic
1088763112 11:112950571-112950593 CAGTTCTTGCAGAGGTATCAAGG + Intergenic
1089346135 11:117792889-117792911 CTGTCCTTGGATAGGGGTGGTGG + Intronic
1089969559 11:122681869-122681891 CTGACCATGCAGTTGTGTGATGG - Intronic
1090613592 11:128494351-128494373 CTGTCCTTTCAGAGGTCTAGGGG - Intronic
1095167041 12:38985282-38985304 CTGTCCATGCTGATGGGTGAGGG + Intergenic
1095234620 12:39781878-39781900 CTGTACTTGCAGAGGTGTCTAGG + Intronic
1096551473 12:52376333-52376355 ATGTCCCAGCAGAGGTGTGAAGG - Intergenic
1097066926 12:56327431-56327453 ATGTACTTGAAGTGGTGTGATGG + Exonic
1097701028 12:62820271-62820293 CAGGCCTTGCAGAGCTGTGGTGG - Intronic
1097792780 12:63832550-63832572 CAGTCCTTGCAAAAATGTGAAGG + Intergenic
1100460592 12:94795567-94795589 CTGTCCTCGCAGAGGTCACAGGG + Intergenic
1102022384 12:109692837-109692859 CTGTCCTAGCAGAAAGGTGAAGG - Intergenic
1104946159 12:132415724-132415746 CTGTCCTTGCAGGGGCCTGGTGG - Intergenic
1105498800 13:20953433-20953455 CTGTCCTTGCTGAGCTGTGACGG + Intergenic
1106144052 13:27036144-27036166 ATGTACTTGCAGAGCTGGGATGG - Intergenic
1107429377 13:40326514-40326536 CTTTGCTTGCTGGGGTGTGATGG - Intergenic
1108708642 13:53012295-53012317 CTGTTCTTTCAAAGGTCTGAAGG + Intergenic
1109534128 13:63693926-63693948 CTGCTCTTGCAGATGTGTGGAGG - Intergenic
1110383360 13:74879430-74879452 CTGCCCTTGCATAGCTGTAAGGG + Intergenic
1112234516 13:97623603-97623625 CTGCCCTTGTGGAGGTGTGATGG - Intergenic
1113499332 13:110760784-110760806 CTGTACTTCCAGAGGATTGAGGG + Intergenic
1113724666 13:112589077-112589099 TTGCTCTTGCAGAGCTGTGATGG - Intergenic
1113972105 13:114198931-114198953 CGGTCCCCGCTGAGGTGTGATGG + Intergenic
1115448702 14:33521250-33521272 CTTTCCTTGAGGAGGTGTCAAGG + Intronic
1116137408 14:40946257-40946279 CTGTCTTTACACAGATGTGAAGG + Intergenic
1117005659 14:51418803-51418825 CTGGCCTTGCTGAGCTGTGGTGG + Intergenic
1117324575 14:54657355-54657377 CTGTCCTTGAAGAGATGGGAAGG - Intronic
1122278796 14:100609553-100609575 CTGCGCTTGCAAAGGTGTGGAGG + Intergenic
1122443337 14:101749855-101749877 CAGGCCTTGCAGAGCTGTGGTGG + Intergenic
1125231519 15:37462281-37462303 ATGTCCAGGCAGAGGTGTGCTGG - Intergenic
1128521652 15:68379181-68379203 CTGCTCATGCAGAGGTGGGAAGG - Intronic
1129917248 15:79284435-79284457 CTTTCCTTGCAAAAGTGTCAGGG + Intergenic
1131383827 15:91986203-91986225 CTGTCCAGGTAGGGGTGTGATGG + Intronic
1131426242 15:92347510-92347532 CTCTCCTTGGAGGAGTGTGATGG + Intergenic
1131563263 15:93462644-93462666 CTGTGAGTGCAGAGGTGTGTTGG - Intergenic
1132064903 15:98722785-98722807 CTGCCTTTGCAGAGGTCTGTGGG + Intronic
1133017865 16:2952941-2952963 CTGTTCTCGCTGAGCTGTGATGG - Intergenic
1134348006 16:13409369-13409391 CTGTCCTTGCAGAAAGGTGGAGG + Intergenic
1135512091 16:23094364-23094386 CAGGCCTTGCTGAGCTGTGAGGG - Intronic
1138536819 16:57664535-57664557 CAGTCCTTGGAGTGGTGGGATGG - Exonic
1141944913 16:87303334-87303356 CTGGCTTTGCAGAACTGTGAAGG + Intronic
1143465601 17:7134255-7134277 CTGTCCTTGCCGAGGTCCGTGGG + Intergenic
1144455041 17:15412004-15412026 CTGTCTTTGCTGAGCAGTGAAGG + Intergenic
1144462387 17:15468517-15468539 CTGTGGTTGCAGAGAAGTGAGGG - Intronic
1144970810 17:19108330-19108352 CTGCCCTTGCAGAGGTTTGGAGG - Intergenic
1144991112 17:19234492-19234514 CTGCCCTTGCAGAGGTTTGGAGG - Intronic
1145121925 17:20267837-20267859 CTGGCCTGGCTGAGGTCTGAGGG - Intronic
1145247694 17:21280360-21280382 GTGGACTTGCACAGGTGTGAAGG + Intergenic
1147454877 17:40530924-40530946 CTGTCCAAGCAGAGGTCTGAAGG + Intergenic
1148142425 17:45338299-45338321 GAGACCTTGCAGAGGTGTGTGGG + Intergenic
1148873444 17:50672512-50672534 CTGTCCCTGCAATGCTGTGAGGG - Intronic
1152540113 17:80970545-80970567 CTGTCCTCACAGTGGTGTGGCGG - Intergenic
1153374263 18:4357714-4357736 CTGACCTTGCAGCAGTGAGACGG - Intronic
1154283854 18:13033430-13033452 CTGTCTTAGCAAAGATGTGAGGG + Intronic
1155080628 18:22406706-22406728 ATGTCCTTGCAAAGGTTTGCTGG - Intergenic
1155110590 18:22710384-22710406 CTGTCTTTTCAGATGTGTCAGGG + Intergenic
1156494896 18:37519246-37519268 CTGTCCCTAGAGAGGTGTGGGGG + Intronic
1157289209 18:46398143-46398165 GTGGCCATGCAGAGGTGTGAGGG + Intronic
1157494874 18:48149546-48149568 CTGGCCTTGCAGTGGGGTGAAGG - Intronic
1157501070 18:48191127-48191149 CCCACCTTGCAGAGGTGGGAGGG + Intronic
1159732799 18:72052529-72052551 CTGTCCTTGTGGATGTATGAAGG + Intergenic
1160311416 18:77794557-77794579 CTGTCCCTGCTCAGGTGAGATGG - Intergenic
1160716168 19:577794-577816 CTGTCCCAGCAGAGGTGGGTGGG + Exonic
1161737934 19:6002926-6002948 CGCTCCTTGCAGGGGTGTGTGGG + Intronic
1163189997 19:15670619-15670641 CTGTCCTTGCAGAGGTAGTGGGG + Intergenic
1163223337 19:15937264-15937286 CTGTCCTTGCAGAGGGAGTAGGG - Intergenic
1163441316 19:17323879-17323901 CTGTCCCTGCGGAGGCGAGAGGG + Exonic
1163775346 19:19214060-19214082 GTGTCCTGGCAAGGGTGTGAAGG - Intronic
1164864223 19:31590553-31590575 CTGTCCTTGCAGAGCTCCCAGGG - Intergenic
1165923152 19:39311094-39311116 CTGTCCTTGAAAAGGGGTGGGGG - Intronic
1165973067 19:39649684-39649706 CAGGCCTTGCAGAGCTGTGGTGG - Intergenic
1166158022 19:40929932-40929954 CTGTCCTTGGAGGGGTGAGTGGG + Intergenic
1167603886 19:50469792-50469814 GTGTCTGTGCACAGGTGTGAGGG - Intronic
925824751 2:7836807-7836829 CTGTCACTGGAGAGGTGAGAAGG + Intergenic
926131557 2:10305933-10305955 CTGTGCTTGCAGAGCCCTGAAGG - Intronic
926550871 2:14299529-14299551 CTGCCTTAGCAGAGGTATGAGGG - Intergenic
929052096 2:37846294-37846316 GTGTCCTTGAACAGGTGAGAGGG - Intergenic
930571326 2:53090056-53090078 CTGGCCTGGCAGAGCCGTGAGGG - Intergenic
932153704 2:69395983-69396005 CTTTCTTTGCATATGTGTGAAGG - Exonic
935189942 2:100769030-100769052 TTGTCCTCGCAGCTGTGTGAAGG + Intergenic
936051045 2:109223728-109223750 CTTTCCTTGCAGAGCCGTGGAGG + Intronic
936405861 2:112201689-112201711 CTGTCCTTGTGTAGCTGTGAAGG - Intergenic
936600112 2:113887615-113887637 CTGGCCTTGCACAGTTGTCATGG - Intergenic
938212268 2:129478565-129478587 CTCTCCTTACAGAGAGGTGAAGG + Intergenic
938316314 2:130331753-130331775 CTGGCCTCGCAGAGCAGTGATGG - Intergenic
938921184 2:135996540-135996562 ATTTCCCTGCAGAGGTTTGAGGG - Intergenic
939319312 2:140596183-140596205 AGGTCCTTGCAATGGTGTGAGGG + Intronic
941693255 2:168523793-168523815 CAGTCTTTGCAGAGGTCTAAAGG - Intronic
942840771 2:180358818-180358840 CTGGCCTCGCAGGGGAGTGAAGG - Intergenic
945023233 2:205595041-205595063 CTCCCCTTGCAGGGTTGTGATGG - Intronic
946620304 2:221554992-221555014 CTGTTCTTTCTGAGGTGGGAGGG - Intronic
946889156 2:224257013-224257035 CTGACATTGTATAGGTGTGAAGG + Intergenic
947498942 2:230658555-230658577 CTGTCACTGCAGGGCTGTGATGG - Intergenic
947641347 2:231709329-231709351 CCGTCCCGGCGGAGGTGTGACGG + Intronic
948586456 2:239023004-239023026 CTGGCCCTGATGAGGTGTGATGG + Intergenic
948671468 2:239571307-239571329 CAGCCCTTGCTGATGTGTGAAGG - Intergenic
948810763 2:240476552-240476574 CTGTCCTGGCAGATGTGAAAAGG + Intergenic
1168788865 20:562703-562725 CTTGCTTAGCAGAGGTGTGAGGG + Intergenic
1171507334 20:25648305-25648327 AAGTCCTTGCATAGGGGTGATGG - Intergenic
1174171835 20:48622547-48622569 CTGTGCTTGCAGAGTTGGGAGGG - Intergenic
1174184692 20:48698253-48698275 CTGTCCCTGCACAGGTGAGACGG + Intronic
1174224056 20:48982621-48982643 CAGCCCTTGCAGAGCTGTGGTGG + Intronic
1174549895 20:51354803-51354825 CTGTCCCTGCAGGGGGGTGGTGG - Intergenic
1176343693 21:5721390-5721412 CTGTCCTTGGAGGGGTATGCAGG - Intergenic
1176501134 21:7603066-7603088 CTGTCCTTGGAGGGGTATGCAGG + Intergenic
1176538014 21:8119459-8119481 CTGTCCTTGGAGGGGTATGCAGG - Intergenic
1177161153 21:17549576-17549598 TCGTCCTTGCAGGGTTGTGAAGG + Intronic
1178641149 21:34345566-34345588 CTGGGGGTGCAGAGGTGTGAAGG + Intergenic
1181337178 22:22145773-22145795 CTGTCCTTGGCCAGGTGTGGTGG - Intergenic
1181903669 22:26175872-26175894 CTGTCCTTACAGGGCTGGGATGG + Intronic
1181903858 22:26177708-26177730 CGGGCCTTGCATAGGAGTGAGGG + Intronic
1182243879 22:28939644-28939666 CAGTACTTGCAGAGGAGAGACGG - Intronic
1182281627 22:29220725-29220747 CTGTCCTTGCAGTGGGACGAGGG - Intronic
1182576302 22:31275375-31275397 CTGTGCTTGCAGAGGGCTCAGGG - Intronic
1182677484 22:32050967-32050989 CTGTCTGTGCGGAGATGTGATGG + Intronic
1183489484 22:38108977-38108999 CTCTGGCTGCAGAGGTGTGAGGG + Intronic
1184902381 22:47455964-47455986 CTTTCCTTTGAGAGCTGTGAAGG - Intergenic
1185382121 22:50514333-50514355 CTGTCAGTGCAGAGGTGAAAGGG + Intronic
1203242961 22_KI270733v1_random:35814-35836 CTGTCCTTGGAGGGGTATGCAGG - Intergenic
949612868 3:5720836-5720858 CTGTGCTTGCAGAGGTAAAATGG - Intergenic
950457596 3:13101930-13101952 CTGGCCTTGCAGGGGTGGGAGGG + Intergenic
952861517 3:37816654-37816676 CTTTTCTTGCAGAGGGGAGAAGG + Intronic
953806961 3:46078833-46078855 CAGACTTTGCAGAGGTGTCAAGG + Intergenic
954513838 3:51153126-51153148 CAGGCCTTGCAGAGCTGTGGTGG + Intronic
955361637 3:58281221-58281243 CTGGCCTTGCTGAGCTGTGGTGG + Intronic
955567409 3:60262385-60262407 CTGTGCTTGCAGAAAAGTGATGG + Intronic
955995519 3:64676846-64676868 CTGGCCTTGCTGAGATGGGAAGG + Intronic
958594196 3:96201071-96201093 CTGTGCTTGTTGAGGTGTAATGG - Intergenic
959649247 3:108735844-108735866 CTGTCCCTGCAGAGGTGTCCAGG + Intergenic
959692940 3:109219087-109219109 CAGACCTTGCAGAGCTGTGGTGG - Intergenic
960089862 3:113628141-113628163 CAGGTGTTGCAGAGGTGTGAAGG - Exonic
960266556 3:115626860-115626882 CTTTCCTTGCAGTGTTGGGAAGG + Intronic
960913059 3:122668621-122668643 CAGGCCTTGCAGAGCTGTGGTGG + Intergenic
961292627 3:125859848-125859870 CTGTCATTGGAGAGGAGCGATGG + Intergenic
961477494 3:127157815-127157837 CTGTTCCTGGAGAGGTGGGAGGG - Intergenic
962146686 3:132847029-132847051 ATGTCCTTGTAGAGGTATGATGG - Intergenic
962275804 3:134012443-134012465 CTCTGCTTGCAGAGTTCTGATGG - Intronic
963123767 3:141797179-141797201 GTGTCCTTCCAGGGGTGTCAGGG + Intronic
964071383 3:152637797-152637819 GTTTCCATTCAGAGGTGTGATGG + Intergenic
967119578 3:186371055-186371077 GGGTCTTTGCAGATGTGTGATGG + Intergenic
967417820 3:189238651-189238673 CTGTGCTAGGAGAGATGTGAAGG + Intronic
968786550 4:2626257-2626279 CTGTCAGTGCAGGGGGGTGATGG - Intronic
969004654 4:4009617-4009639 CTGTCATTGGAGAGGAGCGATGG - Intergenic
969228086 4:5812085-5812107 CTCTCCTGGCTGTGGTGTGAGGG - Exonic
969228113 4:5812201-5812223 CTCTCCTGGCGGTGGTGTGAGGG - Exonic
969228129 4:5812259-5812281 CTCTCCTGGCTGTGGTGTGAGGG - Exonic
969228157 4:5812374-5812396 CTCTCCTGGCTGTGGTGTGAGGG - Exonic
969228192 4:5812547-5812569 CTCTCCTGGCTGTGGTGTGAAGG - Exonic
969809243 4:9635090-9635112 CTGTCATTGGAGAGGAGCGATGG + Intergenic
971607834 4:28681384-28681406 TTGTACTTGCAGAGGTGAAAAGG - Intergenic
973835780 4:54807565-54807587 CAGGCCTTGCAGAGCTGTGTGGG - Intergenic
974443937 4:61954723-61954745 CTGTCCTTGTGGTGGTGGGATGG - Intronic
976429403 4:84945559-84945581 CTGTCCTCACAGAGGAGTAATGG + Intronic
978443634 4:108760156-108760178 CTGTCCTTGCAGTGCTTTGGAGG - Intronic
979084863 4:116395324-116395346 CTGTCCTGGCATTGGTGGGAGGG + Intergenic
980705253 4:136484805-136484827 CTGTTCATTTAGAGGTGTGAGGG + Intergenic
983546358 4:168968670-168968692 CTGTCCTTGCAAAGGACTGATGG - Intronic
984367278 4:178815620-178815642 CTGTCCTTGAATATGTTTGAGGG - Intergenic
987083717 5:14449207-14449229 ATTTCCTTCCAGAGGTGAGATGG - Intronic
987160806 5:15140195-15140217 TTGATCTTGCAGAGGTGTGCTGG - Intergenic
988381258 5:30499469-30499491 TAGTCCTTGCTGAGGTGTGGTGG + Intergenic
990373127 5:55141339-55141361 CTGTCTTTGCAGATGGATGAGGG - Intronic
991496586 5:67232798-67232820 CTGTCTTTGCAAAAGTATGATGG + Intergenic
992050609 5:72937119-72937141 CTGTAGTTGCCGAGGTGTGTAGG - Intergenic
993561670 5:89417925-89417947 TTGTCCAGGCAGAGGTGTGCTGG + Intergenic
996410722 5:123156103-123156125 CAGTCCTTGCAGAGTTCTGCAGG - Intronic
996756048 5:126936136-126936158 CTGTTCTTCCGGAGGTGTGAAGG - Intronic
997976678 5:138445303-138445325 CTGCCCCTGCAGAGGCCTGACGG + Exonic
998005070 5:138651382-138651404 CTGTCCTTGCAGCACGGTGAAGG + Intronic
998325258 5:141274536-141274558 CTGGCCTTACATAGTTGTGATGG - Intergenic
998434050 5:142092016-142092038 CTTTCCTTGTAGAGGTGTATAGG + Intergenic
999646414 5:153721512-153721534 CTGTCATGGGAGAAGTGTGAAGG - Intronic
1001030903 5:168262092-168262114 CTGTCCTTCCAGAGCCATGAAGG - Exonic
1001747742 5:174104696-174104718 GTGGCCTTCCAGAGGTGTGAAGG + Intronic
1003162387 6:3647124-3647146 CTGTCCTTACAGAGGAGTCCAGG + Intergenic
1006304363 6:33210117-33210139 CAGGCCATGCACAGGTGTGAGGG + Exonic
1006438800 6:34040790-34040812 CTGTCCTCACAGTGGTGTCATGG + Intronic
1007097549 6:39223116-39223138 CGGTCCCTGCACAGGTGTGGTGG - Intronic
1008442528 6:51548730-51548752 CTGACCTTGCAAAGGTATGATGG - Intergenic
1009858023 6:69289458-69289480 CTGTCCTTGTTGAATTGTGAAGG - Intronic
1011804825 6:91060287-91060309 AAGTCCTTGCACAGGTGAGATGG + Intergenic
1012858708 6:104533397-104533419 CTGTCCTTGGGGGGATGTGAAGG - Intergenic
1014925661 6:127267134-127267156 CTGTCCGCGCAGAGGCGGGATGG + Intronic
1015787806 6:136936018-136936040 CTGTCATTGCAGTGGTATAAAGG + Intergenic
1017496008 6:154984186-154984208 CTGTTCTTGCAAATGTGTGGTGG + Intronic
1017708372 6:157145439-157145461 CTGTCCGTGCAGATGTGGGCAGG - Intronic
1018329446 6:162711522-162711544 CTGTGTTTGCACAGGTCTGAGGG - Intronic
1018859111 6:167698352-167698374 CTGCCCTCGCAGTGCTGTGATGG - Intergenic
1019280415 7:196982-197004 CTGCCCCTGCAGCGGTCTGAGGG + Intronic
1019506302 7:1393178-1393200 CTGTCCTTGCAGCTGTTTTAGGG + Intergenic
1020426368 7:8070644-8070666 CTGTCCTTGAAGAGTTTTGTGGG + Intronic
1021289267 7:18823095-18823117 ATGTCCTTGAATAGGTGAGAGGG + Intronic
1023071633 7:36440527-36440549 TTGTGCTTGCAGAGGTATGTAGG + Intronic
1023258068 7:38331307-38331329 GTGTCCTTGCAGATGTGAAAAGG - Intergenic
1023259243 7:38341676-38341698 GTGTCCTTGCAGATGTGAAAAGG - Intergenic
1023325062 7:39045341-39045363 CATTCATTCCAGAGGTGTGAGGG + Intronic
1023370915 7:39511523-39511545 CTGGCATTGAATAGGTGTGAGGG - Intergenic
1024379899 7:48684817-48684839 CTATCCTTGGAGAGGTTTTAGGG + Intergenic
1025093724 7:56082243-56082265 CTGTTCCTGCAGAGGTCTGCGGG - Exonic
1029013491 7:97288210-97288232 CTCACCTGGCAAAGGTGTGAGGG - Intergenic
1029424597 7:100488054-100488076 ATGTCCTTGCAGAAGGGTCAAGG + Intronic
1029574173 7:101392154-101392176 ATTTCACTGCAGAGGTGTGACGG + Intronic
1031991798 7:128203363-128203385 CTGTCCTTGAACAGAGGTGATGG + Intergenic
1033207609 7:139436345-139436367 GTGTGACTGCAGAGGTGTGAAGG - Intergenic
1033719894 7:144048338-144048360 CTGGCCTTGAAGAGGTGTCATGG - Intergenic
1034540732 7:151756357-151756379 CTGTCCTTGCAATGCTGGGAGGG + Intronic
1035282774 7:157787857-157787879 CTGGGGGTGCAGAGGTGTGAGGG - Intronic
1035316244 7:157999149-157999171 CGGTCAGTGCAGGGGTGTGAGGG - Intronic
1035447548 7:158952997-158953019 CTGGCATTGCACAGGTGGGAAGG - Intronic
1035598431 8:880093-880115 CTTTCCTTTGAGAGGGGTGAGGG + Intergenic
1035878272 8:3215457-3215479 CTTTCCTGGCAGAGGTGTCCTGG - Intronic
1036786620 8:11692272-11692294 CTGTGCTTGAAAAGGTGTGATGG - Intronic
1038663905 8:29520827-29520849 CTCTCCTTGCAGGGGGGTGAGGG + Intergenic
1038941306 8:32308917-32308939 CTGTCTTCACTGAGGTGTGATGG - Intronic
1039521752 8:38177156-38177178 CTGTCCTTGCGGGGAGGTGAGGG + Intronic
1039624317 8:39032297-39032319 CAGGCCTTGCAGAGCTGTGGTGG + Intronic
1041096253 8:54353515-54353537 CTCTCCTTGGAGTGGTGTCATGG + Intergenic
1041480730 8:58317083-58317105 ATGGCCTTGCAGAGATGTCAGGG - Intergenic
1041564667 8:59262959-59262981 CTGTCCTTGCAGAGGTAGAAAGG - Intergenic
1041697166 8:60748233-60748255 ATGTCTTTGCTGAGATGTGAAGG + Intronic
1044338876 8:91023969-91023991 CTCTCCTTGCAGAGGAGCTAAGG + Intronic
1046607931 8:116391221-116391243 CAGGCCTTGCAGAGCTGTGGTGG - Intergenic
1047027148 8:120836387-120836409 CTGTCCTTTCAAAGCTGGGAAGG + Intergenic
1047223882 8:122940452-122940474 GTGTCCTGCCAGAGGTGGGATGG - Intronic
1047640956 8:126821149-126821171 CTGTCCTTGCATAGGTCAGAGGG + Intergenic
1047902762 8:129442075-129442097 CTATCCTTGGCCAGGTGTGATGG + Intergenic
1047934615 8:129764612-129764634 CTGGCTATGCAGAGGTGGGAAGG + Intronic
1049407838 8:142459560-142459582 CTGTACTTGCTGGGATGTGAGGG - Intronic
1050320723 9:4449338-4449360 CAGGCCTTGCAGAGCTGTGGTGG - Intergenic
1050387026 9:5101400-5101422 CAGGCCTTGCAGAGCTGTGGTGG - Intronic
1052991096 9:34519858-34519880 CTGTCCAGGCAGGGGGGTGAGGG - Intronic
1054805952 9:69395931-69395953 CTTTCCTTGCAGAGGCCTCAGGG - Intergenic
1055692838 9:78852064-78852086 CTGTCCTAGTAGGGGTGTTAAGG + Intergenic
1055893388 9:81147026-81147048 CAGACCTGGCAGAGGTATGAAGG + Intergenic
1056616747 9:88174488-88174510 CTGGCTTTGCAGAGATCTGAAGG - Intergenic
1056957797 9:91096377-91096399 CTGGCCCTGGAGAGGTGAGAAGG + Intergenic
1057003414 9:91533867-91533889 TTGTCATTGCAGAGGGGCGAGGG + Intergenic
1058651283 9:107177463-107177485 CTGTCCTCATAGAGGTGTAAAGG + Intergenic
1059383517 9:113946798-113946820 CTGTCCTTGCAGAGCTGCAAGGG + Intronic
1060567023 9:124601844-124601866 CTATCCTAGCTGAGGTGGGAGGG + Intronic
1061929073 9:133822978-133823000 CCCACCTTGCAGAGTTGTGAGGG + Intronic
1062265261 9:135683957-135683979 CTGTCATTGCAGAGGAGGGGAGG - Intergenic
1062679699 9:137772207-137772229 TTGTGCTTGGAGAGGTGTGCTGG - Intronic
1203459287 Un_GL000220v1:18897-18919 CTGTCCTTGGAGGGGTATGCAGG - Intergenic
1185615111 X:1416630-1416652 GTGTGCTTGCATATGTGTGAGGG - Intronic
1185683234 X:1906210-1906232 TTATCCTAGCAGAGGGGTGAGGG + Intergenic
1189847061 X:45147886-45147908 CTAGGCATGCAGAGGTGTGAAGG - Intergenic
1191933269 X:66397334-66397356 CTGGCCTTGCAGATTTCTGATGG - Intergenic
1193073866 X:77334451-77334473 CAGGCCTTGCAGAGCTGTGATGG - Intergenic
1193355971 X:80520930-80520952 GCGTCCTTGCTGAGCTGTGATGG + Intergenic
1197664559 X:129210129-129210151 CTGTTCTGGTAGAGGTGTCAGGG + Intergenic
1200058559 X:153473986-153474008 CTATCCTTGCAGATGGGGGAAGG + Intronic
1202040233 Y:20674987-20675009 CAGTCCTTGCTGAGCTGTGGTGG - Intergenic