ID: 1078172225

View in Genome Browser
Species Human (GRCh38)
Location 11:8936926-8936948
Sequence CGGGGTTGACCGCATTAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078172219_1078172225 16 Left 1078172219 11:8936887-8936909 CCACCATGACCGGCTAATTTTTT No data
Right 1078172225 11:8936926-8936948 CGGGGTTGACCGCATTAGCTAGG No data
1078172217_1078172225 20 Left 1078172217 11:8936883-8936905 CCCGCCACCATGACCGGCTAATT No data
Right 1078172225 11:8936926-8936948 CGGGGTTGACCGCATTAGCTAGG No data
1078172220_1078172225 13 Left 1078172220 11:8936890-8936912 CCATGACCGGCTAATTTTTTGTA No data
Right 1078172225 11:8936926-8936948 CGGGGTTGACCGCATTAGCTAGG No data
1078172218_1078172225 19 Left 1078172218 11:8936884-8936906 CCGCCACCATGACCGGCTAATTT No data
Right 1078172225 11:8936926-8936948 CGGGGTTGACCGCATTAGCTAGG No data
1078172221_1078172225 7 Left 1078172221 11:8936896-8936918 CCGGCTAATTTTTTGTATTTTTA No data
Right 1078172225 11:8936926-8936948 CGGGGTTGACCGCATTAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078172225 Original CRISPR CGGGGTTGACCGCATTAGCT AGG Intergenic