ID: 1078175000

View in Genome Browser
Species Human (GRCh38)
Location 11:8963962-8963984
Sequence CTGTGGGCACTGTCGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 289}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078174984_1078175000 26 Left 1078174984 11:8963913-8963935 CCGGGGCTGGGAAGGGAAATGTT 0: 1
1: 0
2: 4
3: 28
4: 527
Right 1078175000 11:8963962-8963984 CTGTGGGCACTGTCGGGGCTGGG 0: 1
1: 0
2: 1
3: 39
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078175000 Original CRISPR CTGTGGGCACTGTCGGGGCT GGG Intronic
900391851 1:2437042-2437064 CTGGCGGCCCTGTCTGGGCTGGG - Intronic
900644061 1:3701012-3701034 CCCTGGGCACTGTCTGGGCTTGG + Intronic
900947856 1:5841288-5841310 CTGTGGGGACCGTGGGGGCAGGG - Intergenic
900963252 1:5939449-5939471 ATGTGGGCACTGCAGGGCCTGGG + Intronic
901017773 1:6241781-6241803 CGGCGGGCAGTGTCGGGGTTGGG + Intergenic
901055066 1:6445509-6445531 CTGTGGCCCCTGGCGGTGCTGGG - Intronic
901212924 1:7536612-7536634 CTGGGGGCAGGGACGGGGCTGGG + Intronic
901770607 1:11528695-11528717 CTGTGGTCTCTGACGGGGCTCGG + Intronic
903141881 1:21344202-21344224 CTCTGGGCACAGCAGGGGCTGGG + Intronic
903261459 1:22133822-22133844 CTGTAGGCACGGGCCGGGCTCGG - Intronic
904287218 1:29460447-29460469 CTGTGGGCAGTGTCTGCTCTGGG + Intergenic
906676077 1:47694466-47694488 CTGTGGGGGCTGCAGGGGCTGGG + Intergenic
907633348 1:56106869-56106891 ATGTGGCCACTGTGGGGGATGGG - Intergenic
910991309 1:93059388-93059410 CACTGGGCCCTGTCGGGGGTTGG - Intergenic
913336906 1:117717093-117717115 CTGTGTGCAGTGTAGGGACTTGG + Intergenic
917396595 1:174600878-174600900 CTGTGGGCACTGCCTGTGTTGGG + Intronic
917853299 1:179082799-179082821 CAGTGGGCCGAGTCGGGGCTGGG + Intronic
918038757 1:180899415-180899437 CTGTCTGCAGTGTCGGGGGTGGG - Intergenic
918703477 1:187634019-187634041 CTCTGGGGACTGTCGTGGGTTGG + Intergenic
918831599 1:189405517-189405539 CTGTGTGCATTGTAGGGACTTGG - Intergenic
922792435 1:228317695-228317717 CTGTGGGCCCTGTGGGTGCTGGG + Exonic
923604855 1:235433967-235433989 CTGTGGGCACTTTGAGGCCTTGG - Intronic
924894198 1:248317892-248317914 CTGTGGGCTATGTGGGAGCTTGG + Intergenic
1065486975 10:26245196-26245218 CAGTGGTGCCTGTCGGGGCTGGG + Intronic
1067088020 10:43253075-43253097 CTGTGGGCCCTCCCTGGGCTGGG - Intronic
1067090445 10:43263684-43263706 CCCTGGGCACTGCCCGGGCTGGG - Intronic
1067201133 10:44172890-44172912 TTGTGGGGACTGCGGGGGCTTGG + Intergenic
1067513949 10:46920700-46920722 CTGAGGCCACTGTGGGGGCTGGG + Intronic
1067648305 10:48131132-48131154 CTGAGGCCACTGTGGGGGCTGGG - Intergenic
1067686563 10:48469313-48469335 CTGTGGGGCCTGTTGGGGATGGG + Intronic
1068035840 10:51758852-51758874 CTCTGGGCCCTGTCGGGGGGTGG - Intronic
1069305448 10:66963607-66963629 TTGTGGGAACTGTCAGGGTTAGG - Intronic
1069622450 10:69846264-69846286 CTGGTGGCACTGGAGGGGCTGGG + Intronic
1070429100 10:76318342-76318364 CTGTGGGCACTGGCAGAACTGGG + Intronic
1072367335 10:94726345-94726367 CTGTGGGGGATGTTGGGGCTAGG - Intronic
1072871637 10:99126277-99126299 CTGCGGCCACTGTGGGGGATTGG - Intronic
1074042918 10:109810098-109810120 CTGTGTGCAGTCTAGGGGCTTGG - Intergenic
1074816021 10:117140957-117140979 CTGTGGGCAATGGCGGCGCTGGG + Intergenic
1076522709 10:131090929-131090951 CTGTGGGCAGGGGCGGGGCTGGG + Intergenic
1076522721 10:131090977-131090999 CTGTGGGCAGGGGCAGGGCTGGG + Intergenic
1076522734 10:131091025-131091047 CTGTGGGCAGGGGTGGGGCTGGG + Intergenic
1078175000 11:8963962-8963984 CTGTGGGCACTGTCGGGGCTGGG + Intronic
1080153035 11:29076247-29076269 CTGTGGCAACTGTAGGGGATGGG + Intergenic
1080489973 11:32751638-32751660 ATGTGGCCACTGCAGGGGCTGGG + Intronic
1081249702 11:40814392-40814414 CTGTGTGCAGTGTAGGGACTTGG - Intronic
1081570708 11:44289111-44289133 CTGTGGGCCCTGCCGTGTCTGGG - Intronic
1081802581 11:45869975-45869997 CTGGGGGCACTGTGGTGACTTGG + Intronic
1083688623 11:64392697-64392719 CGGGGGGCCCTGTTGGGGCTGGG + Intergenic
1084196045 11:67524006-67524028 CTGTGGGCAGTGACAGGGCTCGG + Intergenic
1084226111 11:67715699-67715721 CTGTGGGCACTGGAGGGGGCGGG - Intergenic
1084263946 11:67995578-67995600 CTGTGGGCACTGGGGGGGGGGGG - Intronic
1084754235 11:71224633-71224655 CAGTGGCCACTGTCTGGGTTTGG - Intronic
1084809469 11:71603545-71603567 CTGTGGGCACTGGGGGGGGCGGG + Intergenic
1085319200 11:75563861-75563883 CTGTGGGCACAGCCCTGGCTAGG + Intronic
1085593986 11:77791330-77791352 CTGTGTGCAGTCTAGGGGCTTGG - Intronic
1086899873 11:92354961-92354983 CTGTTGGCACTGTCATTGCTTGG + Exonic
1087468846 11:98545982-98546004 CTGTGGCTGCTGTCGGGGATGGG - Intergenic
1088387490 11:109275655-109275677 CTGTGGTCACTGTCAGGGATGGG + Intergenic
1089351713 11:117825092-117825114 CGGTGGGCCCTGCCTGGGCTGGG - Intronic
1090727408 11:129540180-129540202 CTGTGTGCAGTGTAGGGACTTGG - Intergenic
1091221142 11:133930795-133930817 CCGTGGGCTCTGTCGGGGAAGGG - Intronic
1091238975 11:134039878-134039900 CTTTGTGCCCTGTCTGGGCTGGG - Intergenic
1091380786 12:57198-57220 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1092214787 12:6673347-6673369 ATGTGGGCACTTGTGGGGCTTGG + Exonic
1094362101 12:29641060-29641082 CTGTGGCTGCTGTGGGGGCTGGG - Intronic
1094762555 12:33551245-33551267 CTGTGTGCACTCTAGGGACTTGG + Intergenic
1097302546 12:58034272-58034294 CTGTGGCCATTGTTGGGGATGGG + Intergenic
1098650323 12:72958550-72958572 CTGTGGGCAGTGTCTGGTGTGGG - Intergenic
1099777423 12:87151342-87151364 CTGTGGCTACTGTGGGGGATGGG + Intergenic
1100918552 12:99455737-99455759 CTGTGGCTACTGTTGGGGGTGGG - Intronic
1101597902 12:106183484-106183506 GTGTGGGCACAGTGGTGGCTGGG + Intergenic
1102455703 12:113069653-113069675 CTGGGGGCACCGGCTGGGCTGGG - Intronic
1103105879 12:118224475-118224497 CTGTCGGCACTGTCAGGGAATGG - Intronic
1103916892 12:124380426-124380448 CTGTGGGCACTGGCAGGGGCAGG - Intronic
1103938398 12:124488824-124488846 CCGTGGGCACTATCGGGCCGAGG - Intronic
1105668962 13:22590925-22590947 CTCTGGGGCCTGTCGGGGGTCGG + Intergenic
1106247284 13:27960993-27961015 CTGTGGGCGCGGCCGGGGCGCGG + Intergenic
1107361150 13:39618940-39618962 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1107702053 13:43058476-43058498 CTGTGGCCACTGTGGGGTATGGG + Intronic
1107803295 13:44130866-44130888 CTGAGGCCACTGTCAGGTCTGGG - Intergenic
1109334083 13:60970949-60970971 CTGTGTGCAGTCTCGGGACTTGG + Intergenic
1111225594 13:85266740-85266762 CTGTGGACACTGTGGAGGATGGG - Intergenic
1112461312 13:99606131-99606153 CTGTTGGCACTCTCTGGGCAGGG - Intergenic
1113780061 13:112971428-112971450 CTCAGGGCAGTGGCGGGGCTAGG + Intronic
1113814154 13:113159901-113159923 CTGTGGAGACGGACGGGGCTGGG + Intronic
1118345323 14:64936254-64936276 CTATGGGCACAGACTGGGCTAGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119450169 14:74702482-74702504 CTGTGTGCAGTGTAGGGACTTGG - Intronic
1121449077 14:93996415-93996437 CTGGGGCCAGGGTCGGGGCTGGG - Intergenic
1122771784 14:104100949-104100971 CTCTGTGCACTGTTGGGGCGGGG - Intronic
1122871557 14:104641187-104641209 CAGTGGGGACGGTGGGGGCTGGG - Intergenic
1124340972 15:28888942-28888964 CTGTGTGCCCGGTGGGGGCTGGG + Intronic
1124345698 15:28920081-28920103 CTGTGTGCCCTCTCGGGGCCAGG + Intronic
1124399469 15:29335714-29335736 CTGTGGGGACTGTCTTAGCTGGG - Intronic
1124639964 15:31391367-31391389 GTGTGGGGTCTGTGGGGGCTGGG + Intronic
1125498992 15:40225752-40225774 CTCTGGGGACTGTCGAGTCTTGG - Intergenic
1127574080 15:60273156-60273178 CAGTGGCCACTGTGGGGGATGGG + Intergenic
1127901989 15:63347794-63347816 CTGTGGGCTCTATCAGAGCTGGG + Intronic
1128251285 15:66165884-66165906 CTGTGGGCACGGTCTGTCCTGGG - Intronic
1129412744 15:75358971-75358993 CTGTGGGCAGTGTTGTGGCAAGG + Intronic
1129973626 15:79802734-79802756 CACTGGGGACTGTCGGGGTTAGG - Intergenic
1130301029 15:82680098-82680120 CTGGAGGCGTTGTCGGGGCTGGG - Intronic
1131395908 15:92085781-92085803 CTGTGGTTACTGTCGGGGGAAGG - Intronic
1131408323 15:92184788-92184810 CTGTGGTCTCTGTTGGGTCTAGG + Intergenic
1132543164 16:520928-520950 CTCTGGGCACTGTCGGCTGTGGG - Exonic
1133372254 16:5254044-5254066 CTGTGGTCACTGTGAGGGCCAGG + Intergenic
1135810712 16:25584379-25584401 CTGTGGGGACTGTTGGGGGGTGG - Intergenic
1136516832 16:30773494-30773516 CTCTGGCCAGTGTCGAGGCTGGG + Intronic
1137769292 16:51003355-51003377 CTGGGGGCAAAGGCGGGGCTCGG - Intergenic
1138451407 16:57095183-57095205 GTGTGGGCTCTGTGGGAGCTGGG + Intronic
1138595778 16:58028210-58028232 CTGTGGGCACTCCCTGAGCTGGG - Intronic
1140683687 16:77411976-77411998 CTTTGGGCACTGGCTGGGCTCGG - Intronic
1140731171 16:77858113-77858135 CTGTGAGCTCTGTGGGGGCAGGG - Intronic
1141144101 16:81516691-81516713 CTGTGGGCTCCCTGGGGGCTGGG + Intronic
1141820619 16:86442953-86442975 CTCTGGGCACTGGCTGGGCTCGG - Intergenic
1141975187 16:87510998-87511020 CTCTGTGCAGTCTCGGGGCTTGG - Intergenic
1141988049 16:87592861-87592883 CTGAGGGCACTGTGGGGGAAGGG + Intergenic
1142196731 16:88742503-88742525 CTCTGGGCTCTGGCCGGGCTGGG - Intronic
1142910868 17:3089711-3089733 CTGTGGCCACTGTGAGGGATGGG + Intergenic
1143020226 17:3913775-3913797 CTGTGGGCACTGCCAGGGGATGG - Intronic
1144033140 17:11340346-11340368 CTGTGGGGACAGCTGGGGCTGGG + Intronic
1145780497 17:27559887-27559909 CTGTGTGCAGTGTAGGGGTTGGG + Intronic
1147242455 17:39099430-39099452 CTGAGCCCACTGTCGGGGCAGGG - Intronic
1147671138 17:42177594-42177616 CTGGGGGCCCAGTGGGGGCTGGG + Intronic
1148547876 17:48530828-48530850 CTGTGGGCGCTGTAGGCGCTGGG + Exonic
1148778916 17:50110860-50110882 GTCTGGGCACAGTGGGGGCTGGG - Exonic
1149566667 17:57645188-57645210 CTGTGGGCAGGGTTGGGGCCAGG + Intronic
1150371117 17:64638936-64638958 CTGTGGGCACTTTTGGGGTCTGG - Intronic
1151455818 17:74225275-74225297 TTGGGGGCACTGTCGAGGGTCGG + Intronic
1151675007 17:75592733-75592755 CTGAAGGCACTGCAGGGGCTCGG + Intergenic
1152239786 17:79155272-79155294 CTGGGGGTACTGTCAAGGCTTGG - Intronic
1152277481 17:79366738-79366760 CTGTGGACACTGGCAGGACTGGG + Intronic
1152552747 17:81038042-81038064 CTGGGGGCACTGCGTGGGCTGGG + Intronic
1152587360 17:81195033-81195055 CTGTGGGCACAGTCAGGGCCGGG + Intronic
1152773803 17:82187579-82187601 CGGGGGGCACTGGTGGGGCTCGG + Intronic
1152825425 17:82461869-82461891 CTGTGGGGACTGTGGGGCTTAGG + Intronic
1153516328 18:5905552-5905574 CTGTGGGCATTTTCCTGGCTAGG + Intergenic
1153688333 18:7567675-7567697 CTGTTGGCACTTTGGGGGCTTGG + Exonic
1154090010 18:11349447-11349469 CTGTGGCTGCTGTCGGGGGTGGG - Intergenic
1158478533 18:57802075-57802097 CTGTGGTCCCTGCCGGGGGTTGG - Intronic
1158652625 18:59301239-59301261 GTGTGGGCTCTGCCTGGGCTAGG + Intronic
1160682080 19:416546-416568 CTGGGGGCCCTCGCGGGGCTGGG - Intergenic
1161154728 19:2726759-2726781 CTGTGGGCACTGTGGACACTGGG - Intronic
1162596476 19:11633459-11633481 CTGTGTGCAATGTAGGGACTTGG + Intergenic
1162932753 19:13965547-13965569 CTGTGGGCGGTGGCGGGGGTCGG + Intronic
1164321074 19:24147683-24147705 CTCTGGGGACTGTTGTGGCTTGG - Intergenic
1166053350 19:40274241-40274263 CTGGGGACACAGTGGGGGCTAGG - Intronic
1166699929 19:44876422-44876444 CTGTGGCCACTGTCGTGGGTAGG - Intronic
1167094838 19:47369635-47369657 CGGTGGGCACAGTGGGGGCTGGG + Intronic
1167462876 19:49635613-49635635 CTGGGGGCACTGGGAGGGCTCGG + Exonic
927211571 2:20642178-20642200 CTGTGGGCACAGTCCGGGCCTGG - Intronic
927790178 2:26003444-26003466 CAGTGGGAACTGTCGGGGAGGGG - Intergenic
928255993 2:29723127-29723149 CTGTGGGGCCTTTAGGGGCTAGG - Intronic
928885404 2:36142599-36142621 CTGGGGCCTGTGTCGGGGCTTGG - Intergenic
930422022 2:51165797-51165819 CTGTGACCAGTGTGGGGGCTGGG + Intergenic
932467844 2:71934956-71934978 CTGTGGGCCCAGCCTGGGCTTGG + Intergenic
932698317 2:73975637-73975659 CTGTGGGCACTCCTGGGGCAAGG - Intergenic
933102043 2:78272581-78272603 CTCTGGGGACTGTCAGGGGTGGG + Intergenic
933397587 2:81752743-81752765 CTGTGGCTGCTGTCAGGGCTGGG - Intergenic
933466675 2:82659889-82659911 CCATGGGCACTGTGGGGGCGGGG + Intergenic
934111416 2:88747122-88747144 CTGTGGCCACTGTGTGGGGTTGG + Intronic
935677884 2:105611316-105611338 CTGTGGTCACTGCCGGGCTTTGG + Intergenic
936449993 2:112626768-112626790 CAGTGGGCAGTGAGGGGGCTAGG - Intergenic
937949293 2:127371375-127371397 CTTTGTGCGCTCTCGGGGCTTGG + Intronic
938139564 2:128784659-128784681 CTGAGGGCTCTGTGGGGGCAGGG - Intergenic
941357807 2:164514539-164514561 CTGTGGGCACTCTCGGTCCCTGG + Intronic
941843732 2:170113495-170113517 TTTTGTGCACTGTCAGGGCTTGG + Intergenic
942269932 2:174264246-174264268 CCGTTGCCACTGTCAGGGCTGGG + Intergenic
944073122 2:195695272-195695294 CTGTGGCCGCTGTGGGGGATGGG + Intronic
947015870 2:225618985-225619007 TTGTGGGCACTCTCTGTGCTAGG + Intronic
948887274 2:240890563-240890585 CTGTGGGCATAGGCGGGGCTGGG - Intronic
1171383174 20:24748460-24748482 GTGTGGGCTCTGTCCTGGCTGGG - Intergenic
1171413596 20:24962440-24962462 CTGTGTGCACTGGCTGGCCTTGG - Intergenic
1171458696 20:25286501-25286523 CTGTGGCCTGTGGCGGGGCTGGG + Intronic
1172380179 20:34483072-34483094 CTGTGTGCACTCTAGGGACTTGG - Intronic
1175123583 20:56735526-56735548 CTGTGTGCACAGTAGGTGCTCGG + Intergenic
1175505441 20:59481240-59481262 CTGTGAGCCCTGGCGGGGTTGGG - Intergenic
1176152419 20:63598787-63598809 CTCTGGCCACTGTCGGAGCCTGG + Intronic
1179766220 21:43574962-43574984 CTGTGGGTTCTGTCAGGCCTGGG - Intronic
1179994429 21:44967454-44967476 CTGTGGTCAATGTCGGGGGAGGG - Intronic
1180181664 21:46120968-46120990 CTGTGGACACTGCAGGGCCTCGG - Intronic
1181025322 22:20124367-20124389 CTGTGGGCTGGGTCGGGGCGGGG + Intronic
1181917303 22:26291638-26291660 CTGTGTGCTCTGGCTGGGCTTGG - Intronic
1181925859 22:26358026-26358048 CTGTGGGCTCTGTCCAGGCTGGG - Intronic
1182093619 22:27612207-27612229 CTGTGGGCACTGGAGGGAGTTGG + Intergenic
1182142879 22:27977798-27977820 CTGGGGGCACTGTCGGTGGGGGG - Intergenic
1183547344 22:38461533-38461555 TTGTGGCCACCGTCAGGGCTGGG + Intergenic
1184388158 22:44187928-44187950 CTGTGGGCCCTGGAGGGGCCAGG - Intronic
1184475335 22:44717552-44717574 CTGTGGTCAATGCCAGGGCTGGG - Intronic
1184645909 22:45895464-45895486 CTGTGGCCTCTGCAGGGGCTAGG - Intergenic
1184694757 22:46133149-46133171 CTGTGGGGGCTGCTGGGGCTGGG + Intergenic
950822669 3:15777913-15777935 GTGTGGGTATTGACGGGGCTAGG - Intronic
952862123 3:37821695-37821717 CTGTGGGCAGTCTCAGAGCTGGG + Exonic
952984887 3:38770424-38770446 CTGTGGCCACTGTGGTGGATGGG + Intronic
953383820 3:42493463-42493485 CTGTGGGCACAGTTGGGCCTAGG + Intronic
954407448 3:50353358-50353380 CTGTGTGCACTGCTGGGCCTCGG + Exonic
954410735 3:50369848-50369870 CTGTCGGCAGTGCCGGGTCTAGG - Intronic
954553347 3:51499902-51499924 CTGTGGCCACTGGCGGGGTCGGG - Exonic
954618493 3:51982866-51982888 TTCTAGGCACTGTCCGGGCTCGG + Intronic
955450771 3:59064695-59064717 CTATGGCCACTGTGGGGGATGGG + Intergenic
957548735 3:81676235-81676257 CTGTGAACACTGTGGGGGCTAGG - Intronic
958152124 3:89704255-89704277 CTGTGTGCAGTGTAGGGTCTTGG - Intergenic
958647106 3:96887763-96887785 CTGTGGCTACTGTTGGGGATGGG + Intronic
960153124 3:114271373-114271395 CTGTGGGCACTGTGGGGGATAGG + Intergenic
961601223 3:128063676-128063698 CTGTGGGCAGTGTGGGGTCATGG - Intronic
962673751 3:137736307-137736329 CTGAGGCCACTGTGGGGGATGGG + Intergenic
963028056 3:140939660-140939682 CTCTGGGGCCTGTCGGGGGTTGG + Intergenic
963771464 3:149390659-149390681 CTGTGGGAACTTTAGGGACTTGG + Intergenic
965118429 3:164520833-164520855 ATGTTGCCACTGTCGGGGGTGGG + Intergenic
968459780 4:718774-718796 TTGTGGCCACGGTAGGGGCTGGG + Intronic
968926622 4:3551737-3551759 CTGTGGGCTCTGTGGGAGGTGGG + Intergenic
969014369 4:4093849-4093871 CTGTGGTCACTGTGAGGGCCAGG - Intergenic
969022465 4:4147488-4147510 CTGTGGGCACTGGGGGGGGGGGG - Intergenic
969313181 4:6366279-6366301 CTTTGGGCCCTGGCGGGCCTGGG - Intronic
969437653 4:7198036-7198058 CTGGAGGCACTGTGGGGGATGGG + Intronic
969731417 4:8959912-8959934 CTGTGGGCACTGGGAGGGCAGGG + Intergenic
973027661 4:45293166-45293188 CTGTGGGCAGTGTTGGTGCAAGG + Intergenic
976022502 4:80646134-80646156 CTGGAGGCACTGTTGTGGCTTGG - Intronic
976562789 4:86521472-86521494 TTGTGGCCACTGTCGGGGATGGG + Intronic
976791278 4:88880954-88880976 CTGTGGCTGCTGTCGGGGATAGG - Intronic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
978290820 4:107137688-107137710 CTATGGTCACAGTGGGGGCTTGG + Intronic
978939043 4:114415382-114415404 CTGTGGGCACTCTAGGGACTTGG + Intergenic
979578944 4:122332786-122332808 CTCTGGGGACTGTGGGGGGTGGG - Intronic
980476657 4:133327101-133327123 CACTGGGGCCTGTCGGGGCTGGG + Intergenic
980526469 4:133995637-133995659 CTTTGTGCACTCTCAGGGCTTGG - Intergenic
981442544 4:144799445-144799467 CTGTGGCCACTGTGGGGGATGGG + Intergenic
982019626 4:151190494-151190516 CTGTGTGCACTCTAGGGACTTGG + Intronic
984655101 4:182309018-182309040 CTGTGGAGACAGTAGGGGCTAGG - Intronic
985149746 4:186934499-186934521 CTGTGAGCACTGTCAGGGCAGGG + Intergenic
986226813 5:5823546-5823568 CTTTGGACACTGTCGGCCCTGGG - Intergenic
986397203 5:7342989-7343011 CTGTGTGCAGTGTAGAGGCTTGG + Intergenic
986680126 5:10224761-10224783 CTGTGTGCAGTCTAGGGGCTTGG - Intergenic
986799873 5:11247444-11247466 TTGTGGGGACTGTGGGGACTGGG + Intronic
987434922 5:17883244-17883266 CTGTGGTCACTGTTGGGGGTAGG + Intergenic
987688122 5:21231233-21231255 CACTGGGGCCTGTCGGGGCTTGG + Intergenic
988886384 5:35563066-35563088 CTGTGTGCACTGTAGGGACTTGG + Intergenic
989650019 5:43677467-43677489 GTGTGTGCAGTGTCGGGGGTGGG + Intronic
989651633 5:43696855-43696877 CTGTGTGCAGTGTAGGGACTTGG - Intronic
991119455 5:62994341-62994363 CTGTGGGCAGTCTAGGGACTTGG - Intergenic
992067437 5:73120639-73120661 CTGTGGGCACTGGCTGGGCGCGG - Exonic
994347201 5:98700844-98700866 CTGTGGGCTGTATGGGGGCTGGG + Intergenic
994878115 5:105451089-105451111 CTGTGTGCAGTGTAGGGACTTGG + Intergenic
995027732 5:107443695-107443717 CACTGGGGACTGTCGGGGGTTGG + Intronic
996010753 5:118479162-118479184 CTGTGGCTGCTGTAGGGGCTGGG - Intergenic
996141348 5:119913372-119913394 CTGTGGCCACTGTGGGGGATGGG + Intergenic
996609016 5:125357632-125357654 CTGTGGCCACTGTGGGGGATGGG + Intergenic
999930984 5:156432637-156432659 CTGTGGCCACTGTGGGGGATAGG + Intronic
1000264484 5:159621523-159621545 CTGTGATCACTGTGGGGGATGGG - Intergenic
1001301197 5:170535071-170535093 CAGTGGGCACAGCAGGGGCTGGG + Intronic
1002280136 5:178124949-178124971 CTGTGGGCATTGCCGGGGTAGGG + Exonic
1002570740 5:180137980-180138002 CTGTGGGCTCGGTGGGGGGTGGG + Exonic
1004125075 6:12865206-12865228 CTGTGGGCACTGGGAGGACTAGG + Intronic
1004299697 6:14446064-14446086 ATGTTGGCACTATTGGGGCTAGG - Intergenic
1005259473 6:24042695-24042717 CTGCAGCCACTGTGGGGGCTGGG + Intergenic
1006948334 6:37800560-37800582 ATGTGGACACTGAGGGGGCTGGG - Intergenic
1007520757 6:42450783-42450805 CTGCGGGCTCTGTGGGGGCTGGG - Intronic
1007892652 6:45310249-45310271 CTGTGGCTACTGTGGGGGATGGG - Intronic
1008185896 6:48389585-48389607 CTGTGGCCACTGTGGGGGATGGG + Intergenic
1010625697 6:78134448-78134470 CTTTGTGCACTCTCAGGGCTTGG + Intergenic
1011019052 6:82789925-82789947 CAGTGGTCACTGTGGGGCCTTGG + Intergenic
1011168627 6:84479468-84479490 CTGTGGATGCTGTGGGGGCTGGG - Intergenic
1011588947 6:88952239-88952261 CTGTAGCCACTGTAGGGGATGGG - Intronic
1011652648 6:89521185-89521207 CTGTGAGCACTGTGAGGGCAAGG - Intronic
1012869824 6:104659489-104659511 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1013943801 6:115697862-115697884 CAGTGGGGCCTGTCGGGGGTCGG + Intergenic
1017400182 6:154052162-154052184 CACTGGGCCCTGTCGGGGGTTGG + Intronic
1017831032 6:158128740-158128762 CTGTGGGCATTGTGTGGGATAGG - Intronic
1018032761 6:159855693-159855715 TTGTGGGCACTATAGAGGCTAGG - Intergenic
1019048616 6:169166935-169166957 CTGTGAGCCCTGGCTGGGCTGGG - Intergenic
1019793076 7:3029946-3029968 CAGTGGGCCCTGTCGGGGGTTGG + Intronic
1020029607 7:4923743-4923765 CTGTGTGCATCGTAGGGGCTCGG - Intronic
1020101985 7:5399095-5399117 AGGGGGGCACTGTGGGGGCTTGG - Intronic
1023758729 7:43444467-43444489 CTGTGGGACCTGAAGGGGCTGGG + Exonic
1023859976 7:44212749-44212771 CTGGGGCCACTGTTGGGGGTGGG + Exonic
1027422073 7:78026643-78026665 CTGTGGGCAATGGTGGGGTTCGG + Intronic
1027468105 7:78540253-78540275 CTGTAGCCACTGTTGGGGATGGG + Intronic
1028330696 7:89587613-89587635 CTATGGCCACTGTCTCGGCTAGG - Intergenic
1029367835 7:100127675-100127697 CTGGGGGCGCTGGCGGGGCAGGG + Exonic
1029665761 7:101994038-101994060 CTGTGGCCACTACCGGGGTTAGG - Intronic
1029666494 7:101998466-101998488 CTGGGGGCACCGCCCGGGCTGGG - Intronic
1029855400 7:103510474-103510496 CTGTGGGGCCTGTCGGGGAGTGG + Intronic
1030742686 7:113128503-113128525 CTGTGTGCAGTGTCTGGGCCTGG + Intergenic
1032290257 7:130583332-130583354 CTCTGGGGACTGTGGGGGGTGGG + Intronic
1035458237 7:159023428-159023450 CTGTGGGCACAGCCGGGGGCGGG - Intergenic
1041023974 8:53665697-53665719 CTGTGCGCCCTGCTGGGGCTGGG - Intergenic
1041414961 8:57597812-57597834 CTGGGGGCACTGTGGGAGCCAGG - Intergenic
1047171447 8:122497111-122497133 CTGTGGGGAAGGTTGGGGCTGGG - Intergenic
1047775493 8:128067086-128067108 GTGTGGGCACTGTGTGGTCTGGG - Intergenic
1048847685 8:138615966-138615988 CTGTGGGACCTGGCTGGGCTGGG - Intronic
1049204462 8:141357244-141357266 ATGTGTGCACTGTCGCGGCCGGG - Exonic
1049411195 8:142474716-142474738 CCGCGGGGACTGTCGGGGCAGGG + Intronic
1051273195 9:15374858-15374880 CTATGGCCACTGTTGGGGGTAGG - Intergenic
1052782587 9:32796179-32796201 CTGTGTGCAGTCTAGGGGCTTGG - Intergenic
1053484670 9:38442773-38442795 ATTTGGGCACTGTCAGGGGTAGG - Intergenic
1053801541 9:41767119-41767141 CTGTGGGCTCTGTGGGAGGTGGG + Intergenic
1054143658 9:61547707-61547729 CTGTGGGCTCTGTGGGAGGTGGG - Intergenic
1054189972 9:61979273-61979295 CTGTGGGCTCTGTGGGAGGTGGG + Intergenic
1054463434 9:65479042-65479064 CTGTGGGCTCTGTGGGAGGTGGG - Intergenic
1054648542 9:67609318-67609340 CTGTGGGCTCTGTGGGAGGTGGG - Intergenic
1055579332 9:77691233-77691255 CTGTGTGCAGTGTAGGGACTTGG - Intergenic
1057216476 9:93231489-93231511 GTGTGGGCACTGTGGGCACTCGG + Intronic
1057732467 9:97622183-97622205 CTGTGGGCAGTCTAGGGACTTGG + Intronic
1059410324 9:114127745-114127767 CTGTGGTCACTGTGCTGGCTGGG + Intergenic
1060110982 9:120905986-120906008 CTTTGGGAACTGCCGGGGGTAGG + Intronic
1060186543 9:121567334-121567356 ATCTGGGCACTGTCTGGTCTTGG + Intronic
1060311185 9:122464112-122464134 CTGTGGCTGCTGTGGGGGCTGGG + Intergenic
1061061054 9:128250755-128250777 CTGGGGGCACGGCGGGGGCTCGG - Exonic
1061180248 9:129021288-129021310 CTGTGGGCAGGGCCGGGTCTGGG - Intronic
1061449890 9:130662222-130662244 CTGAGGTCGCTTTCGGGGCTTGG + Intergenic
1062002517 9:134223867-134223889 CTGTGTGCATGGTCGGGGGTGGG - Intergenic
1062048345 9:134434679-134434701 CTGTGGGCCCTGGAAGGGCTGGG + Intronic
1186922414 X:14296600-14296622 CTGTGGCCACTGTCTGTGCAGGG - Intergenic
1189639332 X:43050909-43050931 CTGTGGCCACTGTAGGGGACAGG + Intergenic
1190214505 X:48470577-48470599 CTGTGTTCCCTGTCGGGGGTGGG - Intergenic
1191026518 X:55919693-55919715 CTGTGGCTGCTGTAGGGGCTGGG - Intergenic
1191134812 X:57052305-57052327 CTGTGGGGACTGTTGTGGCATGG - Intergenic
1191210121 X:57875936-57875958 CTGTGGCCTCTCTGGGGGCTGGG - Intergenic
1193511816 X:82411379-82411401 CAGTGGGCACAGACGTGGCTTGG - Intergenic
1193556509 X:82960617-82960639 CAGTGGCCACTGTGGGGGATGGG - Intergenic
1193621398 X:83756473-83756495 CTCTGGGGACTGTTGGGGGTTGG + Intergenic
1193771536 X:85593382-85593404 CTGTGGCCGCTGTGGGGGATGGG - Intergenic
1193775978 X:85642093-85642115 CTGGGGGCATTGAGGGGGCTGGG - Intergenic
1193883794 X:86960290-86960312 CTAGGGGCACTGTTGGTGCTGGG + Intergenic
1193954651 X:87844679-87844701 CTGTGGCCACTGTGAGGGATGGG + Intergenic
1193991794 X:88317336-88317358 CACTGGGGCCTGTCGGGGCTGGG - Intergenic
1197942113 X:131801428-131801450 CTGAAGGCACTGTGGAGGCTGGG + Intergenic
1199586832 X:149423645-149423667 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1199623692 X:149721382-149721404 CTTTGTGCACTCTCAGGGCTTGG + Intergenic
1201965313 Y:19726540-19726562 CTGGGGGGCCTGTCAGGGCTGGG + Intronic