ID: 1078177577

View in Genome Browser
Species Human (GRCh38)
Location 11:8981677-8981699
Sequence CACCCCATTCTCTTACCTAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078177577_1078177582 12 Left 1078177577 11:8981677-8981699 CCGCTAGGTAAGAGAATGGGGTG 0: 1
1: 0
2: 3
3: 10
4: 134
Right 1078177582 11:8981712-8981734 GTGCTGAAGGCTGGTAACCCCGG 0: 1
1: 0
2: 1
3: 16
4: 331
1078177577_1078177583 13 Left 1078177577 11:8981677-8981699 CCGCTAGGTAAGAGAATGGGGTG 0: 1
1: 0
2: 3
3: 10
4: 134
Right 1078177583 11:8981713-8981735 TGCTGAAGGCTGGTAACCCCGGG 0: 1
1: 1
2: 0
3: 15
4: 163
1078177577_1078177580 -1 Left 1078177577 11:8981677-8981699 CCGCTAGGTAAGAGAATGGGGTG 0: 1
1: 0
2: 3
3: 10
4: 134
Right 1078177580 11:8981699-8981721 GTTGCTAGAGGGAGTGCTGAAGG 0: 1
1: 0
2: 0
3: 12
4: 160
1078177577_1078177581 3 Left 1078177577 11:8981677-8981699 CCGCTAGGTAAGAGAATGGGGTG 0: 1
1: 0
2: 3
3: 10
4: 134
Right 1078177581 11:8981703-8981725 CTAGAGGGAGTGCTGAAGGCTGG 0: 1
1: 0
2: 2
3: 25
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078177577 Original CRISPR CACCCCATTCTCTTACCTAG CGG (reversed) Exonic
901468019 1:9435671-9435693 CACCCCATTTTCTAATTTAGTGG + Intergenic
904132456 1:28285073-28285095 CACGCCATTCTCCTGCCTACAGG - Intergenic
904631423 1:31845734-31845756 GACCCCATTTACTTCCCTAGGGG - Intergenic
910854142 1:91678171-91678193 CCCTCCAGTCACTTACCTAGAGG - Intergenic
911030340 1:93480684-93480706 CATGCCATTCTCCTGCCTAGAGG + Intronic
912445063 1:109729448-109729470 CAGACCAGTTTCTTACCTAGTGG + Intronic
912625395 1:111201721-111201743 CACCCCACTCTCTTCCAGAGGGG - Intronic
912797112 1:112699994-112700016 CACCCCATTCTCCCTCTTAGTGG + Intronic
912891757 1:113540580-113540602 CACCCAATTGTTTTATCTAGTGG - Intronic
912957829 1:114168104-114168126 CACCTCTTTACCTTACCTAGAGG - Intergenic
915340595 1:155174749-155174771 CACCCCCTTCTCCGAACTAGCGG - Intronic
916463379 1:165048827-165048849 GGCCCCATTCTCTTGCATAGTGG + Intergenic
919399692 1:197097077-197097099 CAGCCCTTTCTCTTCCCAAGGGG - Intronic
919847871 1:201652700-201652722 CACCCCCTTCCCATCCCTAGGGG - Intronic
919878809 1:201889061-201889083 CTCCCCATCCCCTTACCCAGGGG - Exonic
920860641 1:209703337-209703359 CACTCCATTTTCATCCCTAGAGG - Intronic
923206991 1:231768711-231768733 CTCCCCATTCTCACCCCTAGTGG - Intronic
923463852 1:234231397-234231419 CACGCCCTTCTCTTCCCCAGGGG + Exonic
924270744 1:242329967-242329989 CTCTCCATTCTCTTACCTAGTGG + Intronic
1063189691 10:3681785-3681807 CACCCCAATCTCTTAATTATAGG - Intergenic
1066714200 10:38268893-38268915 CTCTCCATTCTCTTACCTAGTGG - Intergenic
1067497417 10:46773439-46773461 CACCCCCTCCTCATACCTGGCGG + Intergenic
1072005568 10:91243276-91243298 CACCACATCCCTTTACCTAGTGG - Intronic
1076778605 10:132711536-132711558 AACCCCATTCTGCTCCCTAGAGG + Intronic
1077249691 11:1555525-1555547 CACCCCCTCCTCATACCTGGGGG + Exonic
1078022057 11:7664595-7664617 GACCCCATTCTCTCACCTACTGG - Intergenic
1078177577 11:8981677-8981699 CACCCCATTCTCTTACCTAGCGG - Exonic
1079360593 11:19767154-19767176 CACCCCAGTTTCTATCCTAGGGG - Intronic
1081540604 11:44031921-44031943 CACCACATTCACTTACTCAGGGG + Intergenic
1083105021 11:60349004-60349026 CACCCCATTCTCTTCACTCTGGG - Intronic
1085511556 11:77090814-77090836 CAGCCCATCCTCTGACCCAGAGG - Intronic
1087343483 11:96938453-96938475 CACCCCATGCTCTCACTTATAGG - Intergenic
1093831658 12:23768223-23768245 CACCCAATTTTCTGACCTAGGGG + Intronic
1096116692 12:49059509-49059531 CACCCCCTTCTCCAACCTAAAGG + Intronic
1099424341 12:82503997-82504019 CAACCTATTCTCTTTCCAAGGGG + Intergenic
1099913875 12:88867306-88867328 CACTCTATTCTATTCCCTAGTGG - Intergenic
1100629607 12:96374571-96374593 CATCCCATTCTCTGACCTCTTGG + Intronic
1102503960 12:113372246-113372268 CACGGCATTCTCTTGCCCAGTGG + Intronic
1104137516 12:125954446-125954468 CACCCCATGCCTTAACCTAGAGG - Intergenic
1104763744 12:131313509-131313531 CTCCCCATTCTCTCTCCCAGAGG + Intergenic
1105390629 13:19974188-19974210 TACACAATTCTCTTCCCTAGAGG + Intronic
1108535782 13:51375838-51375860 CCCCAAATTCTCTTCCCTAGAGG - Intronic
1110723775 13:78796013-78796035 CACTCCATGCTCTTCACTAGAGG + Intergenic
1113651052 13:112034506-112034528 AATCCCAGGCTCTTACCTAGGGG + Intergenic
1115794009 14:36912300-36912322 CATCCCATTCTCATATCTGGTGG - Intronic
1123221974 14:106865775-106865797 CACTCCATTCCCTTCCCTGGGGG + Intergenic
1123474085 15:20576497-20576519 CACCCCTGTATCATACCTAGCGG + Intergenic
1123643925 15:22423856-22423878 CACCCCTGTATCATACCTAGCGG - Intergenic
1123734386 15:23171509-23171531 CACCCCTGTATCATACCTAGCGG + Intergenic
1124284892 15:28392817-28392839 CACCCCTGTATCATACCTAGCGG + Intergenic
1124297805 15:28518797-28518819 CACCCCTGTATCATACCTAGCGG - Intergenic
1124591653 15:31059162-31059184 CACCTCCTTCTATTACCAAGTGG + Intronic
1125606501 15:40942343-40942365 GACCCCATTCTCTTCCCTTGAGG - Intergenic
1125791927 15:42373607-42373629 CACCACATTCTCTGCCCTAAAGG + Intronic
1128146381 15:65334512-65334534 CACCCCATTCTCATCCCTGCAGG - Intronic
1128221270 15:65970348-65970370 CACCCTCTTCTCTAGCCTAGTGG - Intronic
1129027275 15:72588815-72588837 CAGTACATTCTCTTACCAAGGGG + Exonic
1131604789 15:93890193-93890215 CAACACATTCTCTTACAGAGAGG + Intergenic
1132474419 16:126522-126544 CTCCCCATTCTCTGAGGTAGTGG + Intronic
1134060700 16:11197910-11197932 CACCCCATCCCTTTCCCTAGGGG - Intergenic
1138515373 16:57533135-57533157 CACCTCATTCTCCTTCCCAGCGG + Intronic
1139187385 16:64822903-64822925 CAGGCCATGCTCTTATCTAGAGG + Intergenic
1142835011 17:2578950-2578972 CATCTTTTTCTCTTACCTAGTGG - Intergenic
1144575866 17:16428976-16428998 CACCCCCTTCTCTCACCTTCTGG - Exonic
1146601861 17:34224293-34224315 CACCCCATTCTCTCACTTGTGGG + Intergenic
1146764983 17:35512253-35512275 CACACCATTCTCCTACCTCAGGG + Intronic
1148063683 17:44853501-44853523 CGCCCCATTCTCTTACCATGAGG + Exonic
1148189273 17:45667364-45667386 CACCCCATTATCTTAGCTTCAGG + Intergenic
1149494625 17:57109473-57109495 GGCCCCATTCTTATACCTAGCGG - Intronic
1158332296 18:56375928-56375950 CACCCACATCTCTAACCTAGGGG - Intergenic
1159490675 18:69129579-69129601 CACCCCATCCTTTTCCCTGGTGG - Intergenic
1161369925 19:3905358-3905380 CCCCCCATTTTCCTACCTGGTGG - Intronic
1161411837 19:4121975-4121997 CACCCCATCCTCTCCCCTAAGGG + Intronic
1164451998 19:28374359-28374381 CACCCCAATCTCTTACCCTTTGG + Intergenic
925906240 2:8541115-8541137 CCCTCCATTCTCTTTCATAGAGG - Intergenic
929610987 2:43270501-43270523 CACCCCTTTCTCTTAACTCCTGG + Intronic
929752464 2:44729974-44729996 CACCCCTTCCTCTTCCCTAGTGG - Intronic
929852755 2:45607899-45607921 CTTCCCATTCTCCTCCCTAGAGG - Intronic
932894998 2:75630988-75631010 CAACCCATTCTCTCCCCTGGAGG - Intergenic
933220939 2:79687193-79687215 CACCATATTCTCTCACCAAGGGG - Intronic
937023356 2:118678413-118678435 CACCCCTCTCTCCTACCCAGTGG + Intergenic
937516079 2:122656784-122656806 CACCTTACTCTCTGACCTAGTGG - Intergenic
939271370 2:139944236-139944258 CACCCACTTCTCTTGCCTTGGGG - Intergenic
948013983 2:234672799-234672821 GACCCCATACCCTTCCCTAGGGG - Intergenic
1170242169 20:14179041-14179063 CAAACCATTCTCTCACCCAGAGG - Intronic
1170878980 20:20278000-20278022 CACCACATTCTATTTGCTAGAGG + Intronic
1172749806 20:37243009-37243031 CACATCATCCTCTTACCTATAGG - Intergenic
1173084118 20:39898900-39898922 CACCACCTTCTCTTAACTATTGG + Intergenic
1173865118 20:46308239-46308261 CACCCCGCGCTCTTACCTCGGGG + Exonic
1175298290 20:57924472-57924494 CATCCCAGTCTCTGACCTATAGG + Intergenic
1177472389 21:21575828-21575850 CACCTAATACTCTTACCTTGGGG + Intergenic
1177709323 21:24751449-24751471 CATCACAATCTCTTACCAAGTGG + Intergenic
1179409241 21:41149596-41149618 CATCCCATGCTCTGACCTTGTGG - Intergenic
1182012617 22:27012900-27012922 CACCCCACTCTCTGCCCTGGAGG - Intergenic
1182500395 22:30742510-30742532 CACCCCATTCTCCTACCAAGAGG + Intronic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
949558525 3:5181434-5181456 CTCACCATTCTCCTACCAAGGGG + Intergenic
949846758 3:8379363-8379385 GCACCCATTCTCTTTCCTAGAGG - Intergenic
952242100 3:31541950-31541972 CTTCCCTTTCTCTTTCCTAGAGG - Intronic
953129136 3:40121154-40121176 CAGCACATCCTCTTCCCTAGCGG - Intronic
965309348 3:167109933-167109955 CACACCATGCTCTTACTAAGAGG + Intergenic
970726566 4:19052315-19052337 CACCCCATTCTTTTACCTCCTGG - Intergenic
975233470 4:71962639-71962661 CACCCCATTCTTCCACCTGGAGG + Intergenic
978292248 4:107155386-107155408 CACCCCTCTCTCTTACTTATTGG - Intronic
979939369 4:126740675-126740697 CATCTCATTCTCTTACTTAAAGG + Intergenic
981608396 4:146565067-146565089 GAACACATTCTCTTACCAAGAGG + Intergenic
986264113 5:6178176-6178198 CACCCCTTCCACCTACCTAGAGG + Intergenic
988182414 5:27814475-27814497 AGCACCATTCTCTCACCTAGAGG - Intergenic
991973742 5:72165621-72165643 CATCCCATCCTCTTATTTAGTGG - Intronic
992532245 5:77663701-77663723 CAGCCCTTTCTCTTCCCTGGTGG + Intergenic
992708051 5:79417635-79417657 AATCCCATTCTCTTATCTACAGG + Intronic
998156214 5:139788502-139788524 CCCCCCAGTCTCTACCCTAGTGG - Intergenic
1001475446 5:172047405-172047427 CACCTGGTTCTCTTACCTGGGGG - Intronic
1002932224 6:1642613-1642635 AACCCCGTTCTCCAACCTAGAGG - Intronic
1003111894 6:3258157-3258179 CATCCCATTGTCATACCTATGGG - Intronic
1006595239 6:35188411-35188433 CACCTCATTCTCTTACCCACAGG + Intergenic
1014538232 6:122642589-122642611 GACCACATTCTCCTACCTAGAGG - Intronic
1017038134 6:150285444-150285466 CACCCCTCTCCCTTATCTAGAGG - Intergenic
1017488070 6:154921136-154921158 TTCCCCATTCTCTTCCCCAGTGG - Intronic
1018327857 6:162693165-162693187 CACCTTCATCTCTTACCTAGAGG - Intronic
1019764594 7:2841250-2841272 CACCCCATTCTCCTGCCAGGAGG + Intronic
1020677925 7:11202522-11202544 TAGCTCATTCTCTTCCCTAGAGG + Intergenic
1023301244 7:38774229-38774251 CACAGTATTCTCTTTCCTAGTGG + Exonic
1024305963 7:47929752-47929774 CACCCCAGTTTCTGACCCAGTGG - Intronic
1024322217 7:48082758-48082780 GACCACATTCTCCTACCTAGGGG + Intergenic
1028455580 7:91034826-91034848 TACTCTAATCTCTTACCTAGTGG + Intronic
1029597884 7:101547233-101547255 CCCACCATTCACTTACCTGGTGG - Exonic
1029679314 7:102097140-102097162 CACCCCATTTTCACACCTCGAGG + Intronic
1032687752 7:134252807-134252829 CACCCCATTCCCTTACCTCCTGG + Intronic
1033168914 7:139066280-139066302 CGCCCCTTCCTCTTCCCTAGTGG + Intronic
1034021748 7:147651832-147651854 CTCCTCATTCTCTTATCTAAAGG + Intronic
1043444170 8:80303170-80303192 CATCCAATTCTCTTCCCTGGAGG + Intergenic
1043819776 8:84847933-84847955 CTCCTCATGCTCTTACATAGAGG - Intronic
1044616400 8:94147154-94147176 CACCCCTTTCTCATACCATGGGG - Intronic
1056023274 9:82464038-82464060 CAGCCCTTTCTCTTCCCCAGAGG - Intergenic
1057355741 9:94329556-94329578 CACCACATTTTCTTTCCTGGAGG + Intergenic
1057652017 9:96928070-96928092 CACCACATTTTCTTTCCTGGAGG - Intronic
1059398151 9:114051823-114051845 CACCCCATTCCCTTCACAAGAGG + Exonic
1060074691 9:120580643-120580665 CACTCCAGTCTCTCACCTATTGG + Intergenic
1061194969 9:129102593-129102615 CTCCCCATTCACTTGCCCAGTGG - Intronic
1061595233 9:131624610-131624632 CACCCCCTTTCCTTCCCTAGGGG - Intronic
1062398244 9:136361227-136361249 CGCCCCATTCTCTTCCCTGCCGG + Intronic
1186259299 X:7759213-7759235 CACTCCATTCTCTCACTCAGGGG - Intergenic
1186918211 X:14246488-14246510 AACCCCATTCTCCAACCAAGTGG - Intergenic
1188910264 X:35839088-35839110 CACCCCATGCTGTGGCCTAGTGG - Intergenic
1195117889 X:101717997-101718019 CACCCCTTTCTACTCCCTAGAGG - Intergenic
1199374321 X:147088854-147088876 GACCCCTTTCTTTTACCTTGAGG - Intergenic
1200031160 X:153296985-153297007 TACCCCTTTCTCTTCCCTGGAGG - Intergenic