ID: 1078178229

View in Genome Browser
Species Human (GRCh38)
Location 11:8986990-8987012
Sequence GGAGCCTCACTGTGTTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201387
Summary {0: 12, 1: 793, 2: 13092, 3: 53024, 4: 134466}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078178229_1078178232 8 Left 1078178229 11:8986990-8987012 CCTGGGCAACACAGTGAGGCTCC 0: 12
1: 793
2: 13092
3: 53024
4: 134466
Right 1078178232 11:8987021-8987043 AAACAAACAAAAGAAACTACTGG 0: 1
1: 2
2: 52
3: 549
4: 4027
1078178229_1078178233 27 Left 1078178229 11:8986990-8987012 CCTGGGCAACACAGTGAGGCTCC 0: 12
1: 793
2: 13092
3: 53024
4: 134466
Right 1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG 0: 1
1: 0
2: 1
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078178229 Original CRISPR GGAGCCTCACTGTGTTGCCC AGG (reversed) Intronic
Too many off-targets to display for this crispr