ID: 1078178230

View in Genome Browser
Species Human (GRCh38)
Location 11:8987011-8987033
Sequence CTTTTGTTTGTTTTGTGTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3119
Summary {0: 1, 1: 0, 2: 17, 3: 216, 4: 2885}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078178230_1078178234 12 Left 1078178230 11:8987011-8987033 CCGCCACACAAAACAAACAAAAG 0: 1
1: 0
2: 17
3: 216
4: 2885
Right 1078178234 11:8987046-8987068 AATTACCCTTATGATGGCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 68
1078178230_1078178233 6 Left 1078178230 11:8987011-8987033 CCGCCACACAAAACAAACAAAAG 0: 1
1: 0
2: 17
3: 216
4: 2885
Right 1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG 0: 1
1: 0
2: 1
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078178230 Original CRISPR CTTTTGTTTGTTTTGTGTGG CGG (reversed) Intronic
Too many off-targets to display for this crispr