ID: 1078178231

View in Genome Browser
Species Human (GRCh38)
Location 11:8987014-8987036
Sequence TTTCTTTTGTTTGTTTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 15865
Summary {0: 1, 1: 3, 2: 81, 3: 1245, 4: 14535}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078178231_1078178233 3 Left 1078178231 11:8987014-8987036 CCACACAAAACAAACAAAAGAAA 0: 1
1: 3
2: 81
3: 1245
4: 14535
Right 1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG 0: 1
1: 0
2: 1
3: 4
4: 59
1078178231_1078178234 9 Left 1078178231 11:8987014-8987036 CCACACAAAACAAACAAAAGAAA 0: 1
1: 3
2: 81
3: 1245
4: 14535
Right 1078178234 11:8987046-8987068 AATTACCCTTATGATGGCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078178231 Original CRISPR TTTCTTTTGTTTGTTTTGTG TGG (reversed) Intronic
Too many off-targets to display for this crispr