ID: 1078178233

View in Genome Browser
Species Human (GRCh38)
Location 11:8987040-8987062
Sequence CTGGCTAATTACCCTTATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 59}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078178231_1078178233 3 Left 1078178231 11:8987014-8987036 CCACACAAAACAAACAAAAGAAA 0: 1
1: 3
2: 81
3: 1245
4: 14535
Right 1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG 0: 1
1: 0
2: 1
3: 4
4: 59
1078178229_1078178233 27 Left 1078178229 11:8986990-8987012 CCTGGGCAACACAGTGAGGCTCC 0: 12
1: 793
2: 13092
3: 53024
4: 134466
Right 1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG 0: 1
1: 0
2: 1
3: 4
4: 59
1078178230_1078178233 6 Left 1078178230 11:8987011-8987033 CCGCCACACAAAACAAACAAAAG 0: 1
1: 0
2: 17
3: 216
4: 2885
Right 1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG 0: 1
1: 0
2: 1
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078178233 Original CRISPR CTGGCTAATTACCCTTATGA TGG Intronic
908651380 1:66336970-66336992 CAGGCTGATTGCCCTAATGAGGG + Intronic
911006334 1:93228554-93228576 CTGTCTACCTTCCCTTATGAAGG + Intronic
913554811 1:119954794-119954816 CTTGCTAATGACCCATATAAGGG + Intronic
919690778 1:200526886-200526908 CTGGCTAACTACCCATCTGCCGG + Intergenic
921815678 1:219560709-219560731 CTGGCTAATTTCTCTTGTTATGG - Intergenic
1065883006 10:30053262-30053284 CTGGCTAATCACTTTTAAGAAGG - Intronic
1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG + Intronic
1078493193 11:11788418-11788440 CTGGCTAATTGCTGTCATGAAGG - Intergenic
1079779552 11:24583588-24583610 GTGTCTACTTTCCCTTATGAGGG - Intronic
1080959105 11:37137061-37137083 CTGACAAATTACCTTTTTGATGG - Intergenic
1085364921 11:75931639-75931661 CTTTCTATTTTCCCTTATGATGG + Intronic
1094246221 12:28297416-28297438 CTTGCTAGTTACCCTTACAAAGG + Intronic
1098018075 12:66127385-66127407 CTGGCTTATTTCCCTTAGCATGG - Intronic
1102595669 12:113990860-113990882 CTGGCTAAATACACATATGGGGG + Intergenic
1104708137 12:130963862-130963884 CTGCCAAATTACCCTTCAGAAGG + Intronic
1106372689 13:29151892-29151914 GTGGTTAATTACCTTTTTGATGG + Intronic
1109464352 13:62709873-62709895 TTGGCTAATTGCCCTTGTTAGGG + Intergenic
1115165718 14:30446821-30446843 CCAGCTAATAACCCTTTTGATGG + Intergenic
1120442773 14:84560543-84560565 CAAGTTAATTGCCCTTATGAGGG - Intergenic
1138831362 16:60379006-60379028 CTGGGTACTTACCTTAATGAAGG + Intergenic
1144684217 17:17215579-17215601 CTGGCTAAGCAGCCCTATGAGGG + Intronic
1145293105 17:21565487-21565509 CTGGGAAAGTTCCCTTATGAGGG + Intronic
1147442084 17:40453559-40453581 CTGGCTAATTTCCCTTCTGAAGG + Intronic
1152655376 17:81517010-81517032 CTGGCTAATTACCCTGACCCAGG - Intronic
1157155584 18:45262394-45262416 CTGGCTAACTCCCCTTTTGCTGG - Intronic
1158431146 18:57388751-57388773 CTGGTTTTTTACTCTTATGAAGG - Intergenic
1161391127 19:4020996-4021018 CTGGGAAACTACCCTTATAAAGG - Intronic
1164961384 19:32433841-32433863 GTGATTAATTACCCTTATTATGG - Intronic
1166385595 19:42378845-42378867 TTGGATAATTGCCCTTATGATGG + Intergenic
929154264 2:38775206-38775228 CTGGCCAGTTACCCTTTTTAAGG - Intronic
940624469 2:156155341-156155363 TTGACTAATTATCCTTATGTTGG + Intergenic
941664816 2:168234168-168234190 CTGGCTAAATACTGTTATGATGG - Intronic
944159904 2:196648023-196648045 CTGGCTTATTTCCCTATTGATGG + Intronic
944393672 2:199245982-199246004 TTGTCTAATTGCCCTTATGCAGG + Intergenic
1170964841 20:21058593-21058615 CTGGAGAATTCCTCTTATGATGG + Intergenic
1171077388 20:22142497-22142519 CTGAATAATAACCCTTGTGATGG + Intergenic
1173341452 20:42156182-42156204 CTGGCTATTTACCTTTAGGCTGG + Intronic
1175551572 20:59821346-59821368 CCTGCTATTTACCCTTATGCCGG + Intronic
1181236082 22:21448379-21448401 CTGGCTAATTACCAAGATGAGGG - Exonic
949724652 3:7029577-7029599 CTGGCTTATTACCCTTTGCAAGG - Intronic
955310578 3:57882589-57882611 ATGGCTAATTTCCCTTATAATGG - Intronic
957322505 3:78650469-78650491 CTTGCTAAGTCCCCTTGTGACGG + Intronic
960760722 3:121071784-121071806 CTGGGGAATTAACCTTAAGAAGG - Intronic
967185946 3:186944768-186944790 CTCTCCAATTACCCTTTTGAAGG - Intronic
970895046 4:21092627-21092649 TTGGCTCTCTACCCTTATGAAGG - Intronic
975048867 4:69834099-69834121 CTGGATAATTACCAATATGTAGG - Intronic
976224109 4:82781626-82781648 CTGGGCCACTACCCTTATGAAGG + Intronic
983445784 4:167850013-167850035 GTGGCTCATTACCCTAATTAAGG - Intergenic
984893767 4:184517104-184517126 CTGGTTACTTTCCCTTAGGAGGG + Intergenic
997351676 5:133235527-133235549 CTGGCTAATTAGCTGGATGAAGG + Intronic
1008599910 6:53082244-53082266 CTGGCAAAATAATCTTATGAGGG + Intronic
1014296816 6:119628506-119628528 CAGGCTAATTACTCTTAGAAAGG - Intergenic
1015095315 6:129408642-129408664 CTGGCTGATCACCCTGAGGAAGG + Intronic
1032327564 7:130945575-130945597 CTGGCTACTTATCCTAATCATGG + Intergenic
1032755517 7:134887016-134887038 CTGTCTTATTGCCCTTATAATGG - Intronic
1033190296 7:139271956-139271978 CTGGTTAATTTCCATTGTGATGG - Intronic
1052007827 9:23371473-23371495 CAGGCTAATAACACTGATGACGG + Intergenic
1055872062 9:80892754-80892776 CTAGTTTATAACCCTTATGAAGG + Intergenic
1056956968 9:91090408-91090430 CTGGCTGATCATCCTTGTGATGG - Intergenic
1058836310 9:108861269-108861291 CTAGCCAATGACCCTGATGAAGG + Intergenic
1188148889 X:26648448-26648470 CAGGCCAATAACCCTGATGAAGG - Intergenic
1195831664 X:109066124-109066146 CTGGCTTATTTCACTTATCATGG + Intergenic
1196397546 X:115281188-115281210 CTAACTAATTACAGTTATGAAGG + Intergenic
1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG + Intronic
1198607521 X:138357927-138357949 CTGGCCATGTACCCTTATAATGG - Intergenic