ID: 1078180273

View in Genome Browser
Species Human (GRCh38)
Location 11:9004665-9004687
Sequence CGTTTCCGAGCCGGGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078180253_1078180273 20 Left 1078180253 11:9004622-9004644 CCTCCCCCGGGCACCCTCTGCCT No data
Right 1078180273 11:9004665-9004687 CGTTTCCGAGCCGGGGGAGCAGG No data
1078180264_1078180273 -8 Left 1078180264 11:9004650-9004672 CCGGCACCCGGCCCGCGTTTCCG No data
Right 1078180273 11:9004665-9004687 CGTTTCCGAGCCGGGGGAGCAGG No data
1078180254_1078180273 17 Left 1078180254 11:9004625-9004647 CCCCCGGGCACCCTCTGCCTGCA No data
Right 1078180273 11:9004665-9004687 CGTTTCCGAGCCGGGGGAGCAGG No data
1078180259_1078180273 7 Left 1078180259 11:9004635-9004657 CCCTCTGCCTGCAGCCCGGCACC No data
Right 1078180273 11:9004665-9004687 CGTTTCCGAGCCGGGGGAGCAGG No data
1078180257_1078180273 14 Left 1078180257 11:9004628-9004650 CCGGGCACCCTCTGCCTGCAGCC No data
Right 1078180273 11:9004665-9004687 CGTTTCCGAGCCGGGGGAGCAGG No data
1078180262_1078180273 0 Left 1078180262 11:9004642-9004664 CCTGCAGCCCGGCACCCGGCCCG No data
Right 1078180273 11:9004665-9004687 CGTTTCCGAGCCGGGGGAGCAGG No data
1078180263_1078180273 -7 Left 1078180263 11:9004649-9004671 CCCGGCACCCGGCCCGCGTTTCC No data
Right 1078180273 11:9004665-9004687 CGTTTCCGAGCCGGGGGAGCAGG No data
1078180260_1078180273 6 Left 1078180260 11:9004636-9004658 CCTCTGCCTGCAGCCCGGCACCC No data
Right 1078180273 11:9004665-9004687 CGTTTCCGAGCCGGGGGAGCAGG No data
1078180252_1078180273 23 Left 1078180252 11:9004619-9004641 CCTCCTCCCCCGGGCACCCTCTG No data
Right 1078180273 11:9004665-9004687 CGTTTCCGAGCCGGGGGAGCAGG No data
1078180255_1078180273 16 Left 1078180255 11:9004626-9004648 CCCCGGGCACCCTCTGCCTGCAG No data
Right 1078180273 11:9004665-9004687 CGTTTCCGAGCCGGGGGAGCAGG No data
1078180256_1078180273 15 Left 1078180256 11:9004627-9004649 CCCGGGCACCCTCTGCCTGCAGC No data
Right 1078180273 11:9004665-9004687 CGTTTCCGAGCCGGGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078180273 Original CRISPR CGTTTCCGAGCCGGGGGAGC AGG Intergenic
No off target data available for this crispr