ID: 1078182469

View in Genome Browser
Species Human (GRCh38)
Location 11:9023910-9023932
Sequence CACATGAGGCTGCTACAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078182469_1078182473 8 Left 1078182469 11:9023910-9023932 CCCGTCTGTAGCAGCCTCATGTG 0: 1
1: 0
2: 2
3: 5
4: 128
Right 1078182473 11:9023941-9023963 AAATGTGATTTCTATCCTTCTGG 0: 1
1: 0
2: 3
3: 24
4: 325
1078182469_1078182474 9 Left 1078182469 11:9023910-9023932 CCCGTCTGTAGCAGCCTCATGTG 0: 1
1: 0
2: 2
3: 5
4: 128
Right 1078182474 11:9023942-9023964 AATGTGATTTCTATCCTTCTGGG 0: 1
1: 0
2: 1
3: 32
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078182469 Original CRISPR CACATGAGGCTGCTACAGAC GGG (reversed) Intronic
904627214 1:31813950-31813972 CCCAGGAGGCTGCCCCAGACTGG - Exonic
904825350 1:33270753-33270775 CACAGGAGGCCGCTACAGGAGGG - Intronic
905608982 1:39331998-39332020 CTCATAAGGCAGCTTCAGACAGG + Intronic
906530485 1:46520957-46520979 CCCATGAGGCTGCTGCAGGAGGG - Intergenic
907151350 1:52291255-52291277 CACTTGTGGCTGCTACTGTCAGG + Intronic
907572046 1:55492441-55492463 CTCCTGAGGATGCTACAAACAGG + Intergenic
911142731 1:94523624-94523646 CACAGGGGTCTGCTACAGAATGG + Intergenic
913118983 1:115722164-115722186 GACATGAGGCTGTTCCAGAACGG + Intronic
915282006 1:154829226-154829248 CACATCAGGCTGGGACAGCCAGG + Intronic
917477947 1:175384975-175384997 CATAAGAGCCTGCTACAGAATGG - Intronic
919667646 1:200307636-200307658 AAAATGGGGCTGCTACAGGCTGG + Intergenic
920956710 1:210626292-210626314 CCCATGAGGCAGCAGCAGACCGG - Intronic
921179175 1:212618273-212618295 CACATGAAGCTGGTGAAGACAGG - Intronic
1063157809 10:3396293-3396315 AACCTGAGCCTGCTGCAGACAGG + Intergenic
1063173604 10:3532193-3532215 CACATGGAGCTGCTACCGATTGG - Intergenic
1067432627 10:46253863-46253885 CACCTGAGGCTGCTCCAACCCGG - Intergenic
1067440634 10:46307601-46307623 CACCTGAGGCTGCTCCAACCCGG + Intronic
1069187607 10:65445038-65445060 CACAGCAAGCTGCTAAAGACTGG - Intergenic
1069238202 10:66104757-66104779 CACATATGGCTGCTGAAGACTGG + Intronic
1069378302 10:67816988-67817010 CAGATGTGGGTGCTGCAGACAGG - Intronic
1071020102 10:81043685-81043707 CACATGAGGAAGTTACAGTCTGG - Intergenic
1075026801 10:118991137-118991159 CACCTGTGTCTGCTGCAGACAGG - Intergenic
1076510745 10:131012220-131012242 CACACGCGGCTTCCACAGACTGG - Intergenic
1078087240 11:8241473-8241495 CACATGAAGATGTTACAGGCTGG - Intronic
1078182469 11:9023910-9023932 CACATGAGGCTGCTACAGACGGG - Intronic
1080208949 11:29762772-29762794 CACCAGAGGCTACTACACACTGG - Intergenic
1085482841 11:76837020-76837042 CACGGGAGGCTGCTCCAGGCAGG - Intergenic
1085591968 11:77771470-77771492 TACAAGATGCTGCTACAGAAGGG + Intronic
1085740508 11:79074581-79074603 CATATGAGTCTGCGAGAGACAGG - Intronic
1087896344 11:103590527-103590549 CACATGAGGATGCTGTAGAAAGG - Intergenic
1089121550 11:116139159-116139181 CACATGAGGCAACTGCAGTCTGG - Intergenic
1091390069 12:120796-120818 GACATTAGGCTGATACACACAGG - Intronic
1092962081 12:13606055-13606077 CACATGAGGCTGTGGCAGAGAGG - Intronic
1103404285 12:120664273-120664295 CACAGGGGGCTGCTATAGAGGGG + Intronic
1103567501 12:121823826-121823848 CACCGCGGGCTGCTACAGACTGG - Intronic
1106708124 13:32303058-32303080 GACATGAGGCTGCAGAAGACAGG - Intergenic
1107759882 13:43666706-43666728 CAGATGAGACTAATACAGACTGG + Intronic
1110120103 13:71869340-71869362 CACATTCGGAAGCTACAGACAGG + Intergenic
1111578654 13:90193009-90193031 CACCTGAGACTGCTTGAGACTGG - Intergenic
1113875121 13:113589461-113589483 CACCTGAGGCTATCACAGACCGG - Intronic
1114396974 14:22372730-22372752 CAGAAGTGGTTGCTACAGACAGG - Intergenic
1116697413 14:48194364-48194386 GAATTGAGGTTGCTACAGACCGG + Intergenic
1118459446 14:65975347-65975369 CACATCAGGCTAATAGAGACAGG - Intronic
1119049815 14:71356136-71356158 CACATGGGGCTCCTTCAGAACGG - Intronic
1127942693 15:63715805-63715827 TACATGAGACTGCTATTGACTGG - Intronic
1131261414 15:90889974-90889996 CCCAGGAGGCTGCTGCAGGCAGG - Intronic
1136029532 16:27492648-27492670 TACATGGGGCTGCTACAGTTTGG - Exonic
1136240747 16:28942317-28942339 CCCATGAGGCTGTCACAGGCAGG - Intergenic
1140205825 16:72932543-72932565 CAGATGAGGCCACTACAGATTGG + Intronic
1140696048 16:77535407-77535429 TACATGAGGCTGCTACAAACAGG + Intergenic
1145283955 17:21489878-21489900 CACATGAGGCATCTCCAGAGAGG - Intergenic
1145393491 17:22475619-22475641 CACATGAGGCATCTCCAGAGAGG + Intergenic
1148060070 17:44830112-44830134 CACATGAGGCCGCGACCGGCGGG - Intronic
1151474599 17:74338527-74338549 CACATGAGGCTGCCAGGGTCAGG + Intronic
1151544220 17:74782478-74782500 AACAAGAGCCTTCTACAGACCGG - Intronic
1151911078 17:77083727-77083749 CACAGGAGGCTCCTGCACACAGG + Intergenic
1153121446 18:1732327-1732349 CACATGTGGCTGGTAGAGAAGGG - Intergenic
1153776088 18:8455343-8455365 CAGATGAGGTTGCTACTGAGAGG + Intergenic
1162738202 19:12758143-12758165 CACACGAGGCTTATGCAGACCGG - Exonic
1163863453 19:19754425-19754447 CTCATGAGGCTTCTACTGCCAGG + Intergenic
1165525007 19:36347046-36347068 CACATGAGGCTGATAAGGATGGG - Intronic
1166014512 19:39970145-39970167 CACATGAGGCTTCTACTGTTTGG + Intergenic
1166205414 19:41265673-41265695 CTCTTGAGGCTGCTGCTGACTGG + Intronic
1168380034 19:55912497-55912519 CACCTTCGGCTGCTTCAGACAGG + Exonic
925355396 2:3237701-3237723 CACATGAGTCTGCAGCAGCCTGG + Intronic
927895695 2:26780343-26780365 CACATGATTCTGCAGCAGACAGG + Exonic
927930621 2:27041240-27041262 AACAGGAGGCTGCTAAAGTCTGG - Exonic
928213761 2:29343811-29343833 CACAAAGGGCTGCTTCAGACTGG + Intronic
929537417 2:42792454-42792476 CACATGAGCTTGTTGCAGACCGG + Exonic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
932596262 2:73095501-73095523 CACATGAGGGGGCTAGAGAATGG + Intronic
933194302 2:79371275-79371297 ATCATGAGGCTTCTCCAGACAGG + Intronic
933766896 2:85715649-85715671 CACTTGAGGCTGCTGGAGAGAGG - Intergenic
939587977 2:144028499-144028521 CAAATGAGGCTGCTTCCTACTGG + Intronic
940422967 2:153500041-153500063 CACAGGTGGCTGCTCCAGATGGG + Intergenic
942737390 2:179130651-179130673 CACATGAGGATTCTAAAGACAGG - Intronic
1168772465 20:424132-424154 CACATAACGCTGTGACAGACTGG - Intronic
1168886615 20:1264120-1264142 CACATGAGGATGGGACAGCCAGG + Intronic
1169764189 20:9130999-9131021 CACATGATGCTGTTACATGCTGG - Intronic
1170106951 20:12762042-12762064 CACTGGGGGCTGCTACAGAGAGG - Intergenic
1178954827 21:37012608-37012630 CAGATGAGGCTGGTATAGAAAGG - Intronic
1179373400 21:40827855-40827877 CACATCAAGCTGCAACAGATTGG + Intronic
1181621224 22:24092584-24092606 CACGTGAGACTGGTAGAGACTGG - Intronic
1184325245 22:43778191-43778213 CTCATGTGGCTGCTAAATACTGG - Intronic
1184873378 22:47256787-47256809 CACAGGATGCCGCTACACACAGG - Intergenic
956264339 3:67380301-67380323 CACTTGAAGCTGCTACAGGTTGG - Intronic
959109007 3:102099062-102099084 CACATGAGGCCACTACAGCCAGG - Intergenic
962008405 3:131370467-131370489 CAGATGAAGCTGCTGCAGGCTGG - Intergenic
962010438 3:131385785-131385807 CAGATGAAGCTGCTACAGGCTGG - Intronic
962432715 3:135334955-135334977 TAGAGGAGGCTGCTTCAGACAGG - Intergenic
962687815 3:137864349-137864371 TACATGAAGCTGCTAAAGAAAGG + Intergenic
964200423 3:154112708-154112730 CACATGAGGATACTTAAGACTGG - Intergenic
964687800 3:159416849-159416871 TACCTGAGGCTGCATCAGACAGG + Intronic
967354010 3:188547509-188547531 CACATGATCCTGTTAGAGACAGG - Intronic
967946273 3:194806606-194806628 CAGATGAGGATGCTGAAGACAGG - Intergenic
968606180 4:1536779-1536801 CACAGGTGGCTGCCACAGCCGGG + Intergenic
969129783 4:4982912-4982934 CACATGAGGTTGCTTAGGACGGG + Intergenic
970092992 4:12430696-12430718 CATATGAGGTAGCTACAGAACGG + Intergenic
975498167 4:75057397-75057419 CACAAGGGGCTGCTCCAGACAGG - Intergenic
986970648 5:13332327-13332349 CACATACGTCTACTACAGACAGG + Intergenic
991120971 5:63012966-63012988 CAGATGAGGCTGCTATATAAAGG - Intergenic
992001659 5:72442143-72442165 CTCATAAGGCTCTTACAGACAGG + Intergenic
993447968 5:88037896-88037918 CAAATTATGCTGCTACAAACAGG + Intergenic
995641254 5:114259771-114259793 AACAAGAGGCTGGTAGAGACGGG - Intergenic
995856760 5:116600822-116600844 CCCATGTGGCTGGTACAGAGTGG + Intergenic
999426697 5:151493778-151493800 CTCTTGAGGCTGCAACAGACAGG - Intergenic
1002132511 5:177090330-177090352 CACAGGAGGCTGCCTCAGATGGG + Intronic
1013594645 6:111649591-111649613 CACATGAGGCACCTGCAGAGAGG - Intergenic
1016300216 6:142622253-142622275 CTCATGAGGCCTCTACAGGCTGG + Intergenic
1017235941 6:152117776-152117798 CACTGGAGGCTACCACAGACAGG - Intronic
1017960635 6:159217786-159217808 CACATGCCGCTGCAACAGAGGGG - Intronic
1020736141 7:11950863-11950885 TACATGAGGCTGCTACACACTGG - Intergenic
1023959491 7:44914440-44914462 CACACTAGGCTGCCCCAGACTGG + Intergenic
1023966895 7:44967466-44967488 CAGATGTGGCTCATACAGACAGG + Intronic
1029367737 7:100127378-100127400 CGCATGAGGCTGCTCCTGGCAGG - Exonic
1030463534 7:109871389-109871411 CATATGAGGTTTATACAGACGGG - Intergenic
1032220793 7:129992554-129992576 CAAATGTGGCTGGCACAGACTGG + Intergenic
1033305559 7:140223002-140223024 CTTATGAGGCTGCAACAGAGGGG + Intergenic
1037520125 8:19672873-19672895 CACTTGAAGCTGCTTCAGTCTGG + Intronic
1041693289 8:60711358-60711380 CTGATGAGGCTGCTACAGTTTGG - Intronic
1045423730 8:102042413-102042435 CACATGGGGCTCCTACAGTTTGG + Intronic
1048321761 8:133405623-133405645 CACATGAGGAGGCTAGGGACTGG + Intergenic
1052215958 9:25965506-25965528 CACATGTGGCTGCCAGAGAAGGG + Intergenic
1052793589 9:32901919-32901941 TAGATGGGGCTGATACAGACAGG + Intergenic
1056276123 9:84996116-84996138 CATATGAGGCTGCTGTACACAGG + Intronic
1056707243 9:88961646-88961668 CACCTGAGCCTGGTAAAGACAGG + Intergenic
1057648911 9:96902378-96902400 CACGTGAGTGTGCTCCAGACTGG + Intronic
1057945617 9:99325578-99325600 CTCCTGAGGCTGATGCAGACTGG - Intergenic
1058826943 9:108783537-108783559 CAGATGTGGCTGCTCCACACAGG - Intergenic
1059151205 9:111951195-111951217 ATCATGAGGCTGCCACTGACTGG - Intergenic
1059968435 9:119639321-119639343 CACACGCGGGGGCTACAGACAGG - Intergenic
1060685950 9:125612843-125612865 AACATGAGGCTGTTACACAATGG + Intronic
1188179245 X:27033789-27033811 CACATGATTCTGCTAAAAACTGG - Intergenic
1188527556 X:31102577-31102599 CACTTGATGCTTCTAGAGACTGG + Intronic
1190324370 X:49197794-49197816 CACATGCGGCAGCTACAGTGGGG - Exonic
1191062415 X:56313505-56313527 CACATGTGGCTGATATAGGCTGG - Intergenic