ID: 1078186847

View in Genome Browser
Species Human (GRCh38)
Location 11:9059059-9059081
Sequence TCACATCGATGGGTTCTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078186844_1078186847 5 Left 1078186844 11:9059031-9059053 CCATTTCTAGCAGTGAGCTCTGC 0: 1
1: 0
2: 2
3: 16
4: 190
Right 1078186847 11:9059059-9059081 TCACATCGATGGGTTCTTTAAGG 0: 1
1: 0
2: 1
3: 7
4: 72
1078186840_1078186847 30 Left 1078186840 11:9059006-9059028 CCCCATTTGCATTCTGTTTTCCA 0: 1
1: 1
2: 11
3: 51
4: 505
Right 1078186847 11:9059059-9059081 TCACATCGATGGGTTCTTTAAGG 0: 1
1: 0
2: 1
3: 7
4: 72
1078186843_1078186847 10 Left 1078186843 11:9059026-9059048 CCATTCCATTTCTAGCAGTGAGC 0: 1
1: 1
2: 0
3: 16
4: 153
Right 1078186847 11:9059059-9059081 TCACATCGATGGGTTCTTTAAGG 0: 1
1: 0
2: 1
3: 7
4: 72
1078186842_1078186847 28 Left 1078186842 11:9059008-9059030 CCATTTGCATTCTGTTTTCCATT 0: 1
1: 1
2: 7
3: 83
4: 933
Right 1078186847 11:9059059-9059081 TCACATCGATGGGTTCTTTAAGG 0: 1
1: 0
2: 1
3: 7
4: 72
1078186841_1078186847 29 Left 1078186841 11:9059007-9059029 CCCATTTGCATTCTGTTTTCCAT 0: 1
1: 0
2: 6
3: 58
4: 697
Right 1078186847 11:9059059-9059081 TCACATCGATGGGTTCTTTAAGG 0: 1
1: 0
2: 1
3: 7
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078186847 Original CRISPR TCACATCGATGGGTTCTTTA AGG Intronic