ID: 1078186847

View in Genome Browser
Species Human (GRCh38)
Location 11:9059059-9059081
Sequence TCACATCGATGGGTTCTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078186842_1078186847 28 Left 1078186842 11:9059008-9059030 CCATTTGCATTCTGTTTTCCATT 0: 1
1: 1
2: 7
3: 83
4: 933
Right 1078186847 11:9059059-9059081 TCACATCGATGGGTTCTTTAAGG 0: 1
1: 0
2: 1
3: 7
4: 72
1078186840_1078186847 30 Left 1078186840 11:9059006-9059028 CCCCATTTGCATTCTGTTTTCCA 0: 1
1: 1
2: 11
3: 51
4: 505
Right 1078186847 11:9059059-9059081 TCACATCGATGGGTTCTTTAAGG 0: 1
1: 0
2: 1
3: 7
4: 72
1078186844_1078186847 5 Left 1078186844 11:9059031-9059053 CCATTTCTAGCAGTGAGCTCTGC 0: 1
1: 0
2: 2
3: 16
4: 190
Right 1078186847 11:9059059-9059081 TCACATCGATGGGTTCTTTAAGG 0: 1
1: 0
2: 1
3: 7
4: 72
1078186841_1078186847 29 Left 1078186841 11:9059007-9059029 CCCATTTGCATTCTGTTTTCCAT 0: 1
1: 0
2: 6
3: 58
4: 697
Right 1078186847 11:9059059-9059081 TCACATCGATGGGTTCTTTAAGG 0: 1
1: 0
2: 1
3: 7
4: 72
1078186843_1078186847 10 Left 1078186843 11:9059026-9059048 CCATTCCATTTCTAGCAGTGAGC 0: 1
1: 1
2: 0
3: 16
4: 153
Right 1078186847 11:9059059-9059081 TCACATCGATGGGTTCTTTAAGG 0: 1
1: 0
2: 1
3: 7
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078186847 Original CRISPR TCACATCGATGGGTTCTTTA AGG Intronic
902126374 1:14215576-14215598 GCACAACGATTGGTTCTTTTTGG + Intergenic
904331697 1:29762033-29762055 TCTCATAGATGGGTTCTCTGTGG + Intergenic
916564810 1:165965273-165965295 TCACATCCTTGGGATCCTTAGGG + Intergenic
923248335 1:232155775-232155797 CCACATAGATGGCTTCTTTGGGG - Intergenic
924251933 1:242141496-242141518 TCAGATAGATGGGTGCTTTGGGG + Intronic
1063751262 10:8950610-8950632 TTACATGGATAGGTTCTTTAGGG + Intergenic
1065615810 10:27521790-27521812 TTACATGGATAAGTTCTTTAGGG - Intronic
1067915380 10:50392347-50392369 TCAAAGCCATGGTTTCTTTATGG + Intronic
1068725836 10:60301849-60301871 TTATAATGATGGGTTCTTTAGGG - Intronic
1068779239 10:60901918-60901940 TCACATGGCTGGGTTCTTTGTGG - Intronic
1069253221 10:66298261-66298283 TAACTTAGATGGGTTCATTAAGG + Intronic
1071096556 10:81981938-81981960 TCACATCCATAATTTCTTTATGG + Intronic
1078186847 11:9059059-9059081 TCACATCGATGGGTTCTTTAAGG + Intronic
1078637794 11:13068201-13068223 TCAGATCGATATGATCTTTATGG + Intergenic
1081563949 11:44244719-44244741 TTACATCAATGAGTTCTTTCAGG + Exonic
1081953010 11:47062060-47062082 TCACAGAGAAGGCTTCTTTAAGG - Intronic
1091058308 11:132439138-132439160 TCACATCTATGGGTACATTTTGG - Intronic
1094308719 12:29052820-29052842 TCAGATCGTTGGGTTATATATGG - Intergenic
1094326433 12:29244691-29244713 TCATATGCTTGGGTTCTTTAGGG - Intronic
1097136496 12:56861357-56861379 GAACATCTATGGGTTTTTTATGG - Intergenic
1099391922 12:82092041-82092063 TCACATGAATAAGTTCTTTAGGG + Intergenic
1108167034 13:47704046-47704068 CCACAGCGATGAGTTCTCTAAGG - Intergenic
1109639536 13:65171495-65171517 ACACATCCATGGCTTATTTAAGG + Intergenic
1111571600 13:90094677-90094699 TCAAATCCATGGTTTCTTCATGG - Intergenic
1119091924 14:71790849-71790871 TTACATGGATAAGTTCTTTAGGG + Intergenic
1120191725 14:81445985-81446007 TCATATCTATGGGATCTTTTTGG + Intergenic
1125033537 15:35096971-35096993 TCACATCAATGGGTGCTTTGCGG + Intergenic
1125771493 15:42169852-42169874 TCACATGGGTGGGATCTATATGG + Exonic
1128872453 15:71171972-71171994 TCACTTTGATGGCTTCTTTGAGG - Intronic
1139946002 16:70642627-70642649 TCACAAGGATGGGGTCCTTATGG - Intronic
1142775740 17:2137429-2137451 TCACATCAAGGAGTTTTTTAAGG - Intronic
1153436327 18:5071907-5071929 ACACATATATGGGTTCTTTTAGG - Intergenic
1159781320 18:72663964-72663986 TCACATTAGTGGTTTCTTTAAGG - Intergenic
1160736683 19:665846-665868 TCACATCTGTGGGTTATTAATGG + Intergenic
929606165 2:43235713-43235735 TCACCCCCATAGGTTCTTTATGG - Intronic
933296896 2:80501510-80501532 TCTCTTCCATGGATTCTTTAAGG - Intronic
933655363 2:84882064-84882086 TCAAAGCCAGGGGTTCTTTACGG - Intronic
941430984 2:165413901-165413923 TTACATAGATAAGTTCTTTAGGG + Intergenic
945602417 2:211884559-211884581 TAACATCTAGGGGTTCCTTATGG - Intronic
946458697 2:219850819-219850841 TCACATCTGTTAGTTCTTTAAGG - Intergenic
946682741 2:222234069-222234091 TCACATTTATGGGTTCATTTTGG - Intronic
947249173 2:228081955-228081977 TCACATTGTTGGGTTTTTTTTGG - Intronic
948811676 2:240481587-240481609 TCACCTCGATGGGTTGCTCAGGG + Intronic
1171387413 20:24779684-24779706 TCCCATCTATGGTTTCTTTCTGG - Intergenic
1180718109 22:17886066-17886088 TCACAGCGCCGGGTTCTTTGGGG - Intronic
951580654 3:24159310-24159332 TCACATGGATGTGCGCTTTAGGG + Intronic
951751866 3:26044788-26044810 TTACATGGATAGGTTCTTTAGGG + Intergenic
952271243 3:31834004-31834026 TCACATCCATGCCTTCTTTCAGG + Intronic
956275715 3:67498971-67498993 TCACATACATGGGTTCTGCAAGG + Intronic
966800443 3:183758683-183758705 TCACAGGGATGGGTCCTTAAGGG + Intronic
971922825 4:32965423-32965445 ACATATCCATGGATTCTTTATGG + Intergenic
977557562 4:98500487-98500509 TCACTACGCTGGGTTCTCTAGGG - Intronic
978109222 4:104942553-104942575 TCACATCCATGGCTTCCTAAAGG + Intergenic
979531064 4:121769636-121769658 GCACATGCATGGGTGCTTTAAGG - Intergenic
981663549 4:147195579-147195601 TTACATCAAAGGATTCTTTAAGG - Intergenic
982628500 4:157800754-157800776 TTACATGGATGAGTTCTTTAGGG + Intergenic
983084790 4:163429505-163429527 TGACATTGATGGTTGCTTTAAGG + Intergenic
989229601 5:39071706-39071728 ACACATTGATGGATCCTTTAGGG + Intronic
991646817 5:68808495-68808517 TTACATGGATAAGTTCTTTAGGG - Intergenic
994686109 5:102954199-102954221 TTACATGGATAAGTTCTTTAGGG + Intronic
996670456 5:126112177-126112199 TGACATCGATGGGTTTATCAGGG + Intergenic
1003997127 6:11553155-11553177 TCACATACATGGGTTCTGCAGGG - Intronic
1011586397 6:88930922-88930944 TTACTTGGATGGTTTCTTTATGG - Intronic
1012352965 6:98276296-98276318 TTACATGTATGGTTTCTTTATGG - Intergenic
1013522742 6:110947750-110947772 TCAGATAGGTGGGTTCTTTAAGG - Intergenic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1036960211 8:13237508-13237530 TTGCATGGATGGCTTCTTTATGG + Intronic
1038228897 8:25682638-25682660 TCAGATTGATGGGCTCTCTAGGG + Intergenic
1038894432 8:31766052-31766074 TCATATCGGTGTGTTCTCTAGGG - Intronic
1043880575 8:85537960-85537982 TGACATCCATGAGTGCTTTATGG - Intergenic
1047709489 8:127537520-127537542 TCAGATCTCTGGGTTTTTTAGGG - Intergenic
1049981928 9:911881-911903 TCACGTGGATGGGTTGTTTGTGG + Intronic
1051483179 9:17580208-17580230 TCAAATTTATGGGATCTTTAAGG + Intronic
1053577309 9:39365458-39365480 TCACATCCATCCATTCTTTAGGG + Intergenic
1053841808 9:42193383-42193405 TCACATCCATCCATTCTTTAGGG + Intergenic
1054587476 9:66982785-66982807 TCACATCCATCCATTCTTTAGGG - Intergenic
1057730187 9:97601858-97601880 TCACATACGTGGGTTCTGTAGGG + Exonic
1058052858 9:100423951-100423973 TCACATGGATGAGTTCTTTATGG + Intergenic
1059045247 9:110859921-110859943 ACACATCAATGCTTTCTTTATGG - Intergenic
1061739071 9:132686246-132686268 TCTCCTAGATGGGTTCTTTCAGG + Intronic
1193251534 X:79296795-79296817 TTACATGAATGAGTTCTTTAGGG - Intergenic