ID: 1078187179

View in Genome Browser
Species Human (GRCh38)
Location 11:9061986-9062008
Sequence GTGGAGTTAAGGAGGAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078187179_1078187187 28 Left 1078187179 11:9061986-9062008 CCAGAGCTCCTCCTTAACTCCAC 0: 1
1: 0
2: 1
3: 16
4: 192
Right 1078187187 11:9062037-9062059 CTGGCTATAGCAGAGAAGTCTGG 0: 1
1: 0
2: 0
3: 9
4: 142
1078187179_1078187183 9 Left 1078187179 11:9061986-9062008 CCAGAGCTCCTCCTTAACTCCAC 0: 1
1: 0
2: 1
3: 16
4: 192
Right 1078187183 11:9062018-9062040 TGACTACCCTTCTCCTATTCTGG 0: 1
1: 0
2: 1
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078187179 Original CRISPR GTGGAGTTAAGGAGGAGCTC TGG (reversed) Intronic
900118140 1:1037224-1037246 CTGGATTTAAAGAGGTGCTCAGG + Intronic
900471424 1:2856859-2856881 GGGGAGCTAAGCAGGAGGTCAGG - Intergenic
902207869 1:14882966-14882988 GAGTGGTTAAGGAGCAGCTCTGG - Intronic
902796058 1:18800939-18800961 GTGGGGTTAGGGAGGGGATCAGG - Intergenic
902936699 1:19769734-19769756 GTGGGGGTGGGGAGGAGCTCAGG + Intronic
904448016 1:30590207-30590229 GTGAAGTGCTGGAGGAGCTCTGG + Intergenic
906323109 1:44828688-44828710 GTGGAGTGAAGGGGAGGCTCAGG + Intronic
907668932 1:56457791-56457813 GTGGAGTGAAAAAGGGGCTCTGG - Intergenic
907822110 1:57980375-57980397 GTGGAGATAAGGAAGTGCTTGGG - Intronic
908142991 1:61207062-61207084 GTGGACTTGTGGAGGAGCTGGGG + Intronic
912537581 1:110386748-110386770 GTGAAGGTCAGGAGGAGCTAGGG - Intronic
916819815 1:168387240-168387262 TTGGAGTTCTGGAGAAGCTCAGG + Intergenic
918596951 1:186305759-186305781 GGGGACATAAGGAGGAGCTTAGG - Intronic
920738013 1:208552898-208552920 CTGGAGTTGTGGAGGAGCTGAGG + Intergenic
920872995 1:209809484-209809506 GTGGAATTAAGGTAGAGATCAGG + Intergenic
921595432 1:217049122-217049144 TTGGAGTGAGGGAGGAGCTTTGG - Intronic
921790230 1:219281520-219281542 GTGGAGTTCAGGAGAAGGTTTGG + Intergenic
924430525 1:243992552-243992574 GTGGATTTAGGGTGGTGCTCAGG + Intergenic
924455668 1:244217119-244217141 GAGGAGTGATGGAGGAGCACAGG + Intergenic
1067546721 10:47197117-47197139 GGGGAATTAAGGAGAATCTCAGG + Intergenic
1070798066 10:79228684-79228706 GTGGAGGCAAGGAGGGGCTAGGG - Intronic
1074892367 10:117746304-117746326 GTTGTGTCAAAGAGGAGCTCTGG - Intergenic
1076271700 10:129158255-129158277 GTGGGGTTATAGAGGAGTTCTGG - Intergenic
1077211249 11:1371885-1371907 GAGGAGTCATGGAGGAGCCCGGG + Intergenic
1077262712 11:1631352-1631374 GTGGAGATGCGGAGGAGCTTGGG + Intergenic
1077288233 11:1777129-1777151 GTGGAGTTCAGACAGAGCTCTGG + Intergenic
1077441165 11:2569929-2569951 GTGGAGTTGAGGAGGTGTTGGGG + Intronic
1078187179 11:9061986-9062008 GTGGAGTTAAGGAGGAGCTCTGG - Intronic
1085523875 11:77153347-77153369 TTGGAGGGAAGGGGGAGCTCTGG + Intronic
1086824311 11:91476141-91476163 TTGGAGGTAAGAAGGAGTTCAGG - Intergenic
1089639879 11:119840813-119840835 GTGTGGTTGAGGTGGAGCTCAGG - Intergenic
1090880647 11:130829082-130829104 GTCGAGGTAGGAAGGAGCTCTGG + Intergenic
1091356468 11:134941578-134941600 ATGGCGGTGAGGAGGAGCTCAGG - Intergenic
1094165455 12:27438367-27438389 CTGGAGCTAAGGAGAAGATCAGG - Intergenic
1098674143 12:73267275-73267297 TTGGAGGAAAGGAGGTGCTCTGG - Intergenic
1100218637 12:92479952-92479974 CTGGATCTAAGGAGGAACTCAGG + Intergenic
1101909352 12:108850349-108850371 GGGGAGCTAAGGAGGAGATCTGG + Intronic
1104465277 12:128984840-128984862 GTGGAGGTACGGTGGAGGTCAGG - Exonic
1105235752 13:18551677-18551699 GTGGAGTGAAGGAGGAGTAGAGG - Intergenic
1105998815 13:25699744-25699766 TTTCAGTTAAGGAGGAGCTTTGG + Intronic
1109929731 13:69199159-69199181 ATGGAGTTAATGAGGAATTCAGG - Intergenic
1116809395 14:49524657-49524679 GTGGAGAGTAGGAAGAGCTCCGG - Intergenic
1117194659 14:53327818-53327840 GTGGAGGAGTGGAGGAGCTCTGG - Intergenic
1118175956 14:63440230-63440252 GAGGAGGTGAGGAGGAGCCCAGG - Intronic
1118395688 14:65334547-65334569 GTGTAGGGAAGGAGGAGCTGAGG - Intergenic
1118805414 14:69232238-69232260 GTGCTGTAAAGGAGGAGATCAGG + Intronic
1120604756 14:86560599-86560621 GTGGTGGTGAGAAGGAGCTCGGG - Intergenic
1121463181 14:94097725-94097747 GTGGAGTCAAGGAGGACTCCAGG + Intronic
1122680348 14:103456158-103456180 GTGGTGAGAAGTAGGAGCTCAGG - Intronic
1123943927 15:25229839-25229861 GTTGGGTCAAGGCGGAGCTCTGG + Intergenic
1123946780 15:25242620-25242642 GTTGGGTCAAGGTGGAGCTCTGG + Intergenic
1123947607 15:25246352-25246374 GTTGAGTCAAGGCAGAGCTCTGG + Intergenic
1127315354 15:57789478-57789500 GTTGGGTTGAGGAGGAGCTGAGG + Intergenic
1128804375 15:70519736-70519758 GAGGAGTGAAGGAGCAGCCCCGG - Intergenic
1129079342 15:73025358-73025380 GGGGAGTTAAGGACGAGGTTAGG + Intergenic
1132065611 15:98728367-98728389 GAGCAGTGGAGGAGGAGCTCAGG - Intronic
1132082011 15:98874234-98874256 GTGGACTTAAGGAGAAGTTCGGG + Intronic
1134596414 16:15499596-15499618 GTGGACTCAAGGAGAAGCTGTGG - Intronic
1136190084 16:28610309-28610331 GTGGAGTTCAGGGGCAGGTCAGG - Intronic
1139921814 16:70465227-70465249 GTGGAGTTGAGCAGGACTTCAGG + Intronic
1140244919 16:73239349-73239371 TTGGAGTTAATTAGAAGCTCTGG + Intergenic
1141122692 16:81373304-81373326 GTGGACTTCAGGAGGACCTTGGG - Intronic
1141172405 16:81699796-81699818 GTGGAGGTAAGGAGCTGGTCGGG + Exonic
1144182150 17:12762490-12762512 CTGGAGTTGAGGAGGAAGTCGGG + Intronic
1144622289 17:16825099-16825121 GGGGGGTAAAGGAGGAGCCCCGG + Intergenic
1144727881 17:17510970-17510992 GTGGGGCTCAGGAGGAGCTGTGG - Intronic
1145148094 17:20496763-20496785 GGGGGGTAAAGGAGGAGCCCCGG + Intergenic
1146275046 17:31511238-31511260 GTGGCGTTAAGGACAAGCTCTGG - Intronic
1147574260 17:41589430-41589452 GGGGGGTAAAGGAGGAGCCCCGG + Intergenic
1147574866 17:41593301-41593323 GTGGGGTAAAGGAGGAGCCCAGG + Intergenic
1149588809 17:57812029-57812051 GTGATGTTAAAGAGGAGCTTAGG + Intergenic
1154498179 18:14977726-14977748 ATGGAGGTGAGGAGGAGCTCAGG + Intergenic
1154513788 18:15138321-15138343 GTGGAGTGAAGGAGGAGTAGAGG + Intergenic
1154950985 18:21209566-21209588 GTGGAATTGAAGAGGAGATCTGG + Intergenic
1157589035 18:48825121-48825143 GTGGAGTAAAGGAGGAAGGCAGG + Intronic
1158644991 18:59237896-59237918 CTGGAGGGAAGGAGGAACTCAGG + Intergenic
1159116265 18:64116078-64116100 GTGGAGTTAAGACTGAGTTCTGG + Intergenic
1160825363 19:1077775-1077797 GGGGAGGAAAGGAGGAGCTGGGG + Intronic
1164050627 19:21583414-21583436 TTGGTGTTAAGGATGTGCTCAGG + Intergenic
1164429502 19:28174868-28174890 TTAGGGTGAAGGAGGAGCTCAGG + Intergenic
1164735923 19:30540878-30540900 GAGGGGTCAAGGAGGAGCTGGGG - Intronic
1165788291 19:38475424-38475446 GTGGTGTTGAGGATGATCTCGGG - Exonic
1166682165 19:44775701-44775723 GTGGGGCTAAGGAGGGGCTCAGG + Intergenic
1166690730 19:44820203-44820225 TTGGAGTTAAGGGTGAGCTCAGG - Intronic
925059156 2:877917-877939 CAGGAGTCCAGGAGGAGCTCAGG + Intergenic
925425931 2:3748602-3748624 GTGAAGTCAAGGAAGAGATCAGG + Intronic
925515236 2:4674444-4674466 GGGGAGTTGAGGTCGAGCTCAGG + Intergenic
926808310 2:16733606-16733628 CTGGAGTGAAGGGGGAGCCCTGG + Intergenic
927154879 2:20215809-20215831 GTGGAGGCCAGGAGGAGCACAGG - Intronic
927759498 2:25739906-25739928 GTGGAGTTAAGGGGTAGGGCAGG + Intronic
928886169 2:36151003-36151025 GTAGAGTTAATGAGATGCTCTGG + Intergenic
937862825 2:126724390-126724412 GTGGAGGAAAGGAGGATCTAGGG - Intergenic
938514031 2:131982932-131982954 GTGGAGTGAAGGAGGAGTAGAGG + Intergenic
942156345 2:173132533-173132555 GTGGAGGCAAGGAGGGGCTAGGG - Intronic
943792610 2:191951371-191951393 GTGGTGTTTAGGAGGAGGGCAGG + Intronic
944301671 2:198130963-198130985 GAGAAGTTAAGAAGGAGCTGTGG - Intronic
946644581 2:221819040-221819062 GGGGAGGTAAGGAGGGGCTGAGG - Intergenic
947543975 2:230997762-230997784 GTGGAGTTCAGGAGGTGGGCTGG + Intronic
948169286 2:235888213-235888235 GGGTAGTTCAGGAGGATCTCAGG + Intronic
948466082 2:238152218-238152240 GGGGTGTTAAGGAGGAACCCAGG - Exonic
1169052757 20:2594635-2594657 GGGGAGATATGGAGGGGCTCTGG + Intronic
1169345507 20:4824999-4825021 GTGGGGCTAGGGATGAGCTCAGG + Intergenic
1170924526 20:20711606-20711628 GTGGAGGTTCTGAGGAGCTCAGG - Intronic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1175597124 20:60244189-60244211 GTGGAGTTTAGCAGGTGCACTGG + Intergenic
1176779753 21:13179963-13179985 GTGGAGTGAAGGAGGAGTAGAGG - Intergenic
1176914997 21:14615129-14615151 GTGGAGTAAAGAAGGGGCTTTGG - Intronic
1177977398 21:27868998-27869020 GTGGAGTGAAGGAGGAGTAGAGG - Intergenic
1179818384 21:43922474-43922496 GTGGGGTTAAGGAGGGTCCCAGG - Intronic
1180653639 22:17400368-17400390 GTGGAGTAGATGAGGAGGTCTGG + Intronic
1181368550 22:22398591-22398613 GGGGAGAAAGGGAGGAGCTCAGG - Intergenic
1182585791 22:31343780-31343802 TTGGTGTTAAGCAGCAGCTCTGG + Intronic
1183005135 22:34894951-34894973 GTGGAGAGAAGGGGAAGCTCTGG - Intergenic
1183639162 22:39082896-39082918 GGGGAGCTAAGGAGGGGCTCAGG - Intronic
1184384943 22:44168670-44168692 GTGGAGTGACGGGGGAGCTGTGG + Exonic
1184684550 22:46090234-46090256 CAGGAGATAAGGCGGAGCTCGGG - Intronic
954177732 3:48857863-48857885 GTGGGGTTAGGGAGGGGCTCTGG - Intronic
954458403 3:50612162-50612184 GGGAAGTTAAGGAGGGGCCCGGG + Intronic
963624626 3:147655413-147655435 GTGTGGTTAAGGATGAGCTGGGG + Intergenic
964302502 3:155304669-155304691 GTGAGGCTAAGGAGGAACTCTGG - Intergenic
966125398 3:176570411-176570433 GTGGCATTTAGGTGGAGCTCAGG - Intergenic
966207868 3:177423348-177423370 ATGGAGTTAAGGAGGAACAGTGG + Intergenic
966553998 3:181237889-181237911 ATGGAGTCAAGAAGGAGCCCTGG + Intergenic
967010492 3:185428602-185428624 GTGGAGAAGAGGAGCAGCTCAGG - Exonic
967621917 3:191643483-191643505 TTGGAGGTAAGGAGAGGCTCTGG - Intergenic
968490966 4:890303-890325 GTGCAGTTCAGGAGGGGGTCAGG - Intronic
969424352 4:7115577-7115599 GTGGAGGTGAGGAGGAGGTGAGG + Intergenic
969424358 4:7115599-7115621 GTGGAGGTGAGGAGGAGGTGAGG + Intergenic
969424369 4:7115643-7115665 GTGGAGGTGAGGAGGAGGTGAGG + Intergenic
969424380 4:7115687-7115709 GTGGAGGTGAGGAGGAGGTGAGG + Intergenic
969424391 4:7115731-7115753 GTGGAGGTGAGGAGGAGGTGAGG + Intergenic
970992828 4:22232985-22233007 GTGCAGTTTAGCAGGGGCTCAGG - Intergenic
971177362 4:24293257-24293279 GAGGGGTTAGGGAGGAGCGCAGG - Intergenic
971181382 4:24331298-24331320 GTGCTGTGAAGGAGCAGCTCAGG - Intergenic
972157559 4:36182931-36182953 GTGGAGTACAGGAAGAGGTCAGG + Intronic
974919832 4:68225347-68225369 GTGGAGGTAAGGAGCAGGTGGGG - Intergenic
975986797 4:80207650-80207672 GTGGAGGTGAGGAGGAGCTGAGG - Intergenic
976078573 4:81327566-81327588 CTTGAGTTAAGGAGAATCTCAGG + Intergenic
979361594 4:119771750-119771772 GTGGAGTAAATGAGGATCACAGG + Intergenic
980213306 4:129817734-129817756 GAGGAGTTAAGGAGGAGCTGAGG - Intergenic
983737184 4:171076170-171076192 CTGGAGTGAAGCATGAGCTCTGG - Intergenic
986124233 5:4870266-4870288 CTGGAGTGAAGGAGAAGCTGTGG - Intergenic
986383234 5:7207242-7207264 GTGGTGCTCAGGAGCAGCTCAGG + Intergenic
986800626 5:11256664-11256686 ATGGGGTTAAGGAGGAGCTATGG - Intronic
990499783 5:56384436-56384458 GTGGAGTTTCGGCAGAGCTCAGG - Intergenic
990998245 5:61755293-61755315 GTGGAAGTAGGGAAGAGCTCTGG - Intergenic
996755894 5:126934810-126934832 GTGTAGAAAAGGAGGATCTCAGG + Intronic
998394946 5:141812270-141812292 GTGGGGTTTTGGAGGAGCCCGGG + Intergenic
998614731 5:143727567-143727589 GTGGAGGTAAAGGGGTGCTCTGG + Intergenic
998642820 5:144031431-144031453 GTGGAGTGAGAGAGGAGCTGTGG + Intergenic
1000756373 5:165165748-165165770 GTGCAGTGAAGGAAGACCTCTGG - Intergenic
1002363520 5:178692765-178692787 CAGGAGTTAAGGAGGGGCTGAGG + Intergenic
1003092001 6:3112145-3112167 GTGGAGTAAAGGAGGGGTTAGGG + Intronic
1003899804 6:10644018-10644040 GTGGAGTGAGGGAGGAGTTGGGG - Intergenic
1004266539 6:14152916-14152938 GTGGGGTTAAGGTGGGGCTGAGG + Intergenic
1008019056 6:46555155-46555177 ATGGTGTCAAGGGGGAGCTCTGG - Intronic
1008075320 6:47139501-47139523 GTGGGGCCAAGGAGGGGCTCAGG + Intergenic
1011352215 6:86435196-86435218 GTGGGGTTAGAGAGGAGCTGGGG - Intergenic
1014155533 6:118104953-118104975 CAGGAGTGAAGGAGCAGCTCTGG - Intronic
1016108470 6:140191369-140191391 GTGGAGAAATTGAGGAGCTCAGG + Intergenic
1016376861 6:143430214-143430236 GTGGAGTGGAGGGGGACCTCTGG - Intronic
1016774934 6:147895117-147895139 GTGCAGCTTAGGAGGAGCCCAGG + Intergenic
1016988974 6:149916472-149916494 ATGGACTTAAGCAGCAGCTCAGG + Intergenic
1017914429 6:158820112-158820134 GAGGAATTCAGGAGAAGCTCTGG - Intergenic
1018436477 6:163763921-163763943 GTGGAGAGAAGGAAGAGCTTGGG - Intergenic
1018489425 6:164276326-164276348 GGAGAGTTAAGGAGGAGCTGGGG - Intergenic
1018753189 6:166825370-166825392 CTGGAGTTGAGGAAGAACTCGGG + Intronic
1019091225 6:169536330-169536352 GTGGAGTGAAAGTGTAGCTCTGG - Intronic
1022704455 7:32789550-32789572 CAGGAGTTAAGGAGGAGATCGGG + Intergenic
1023901739 7:44486682-44486704 GTGGAGTTAAGATGAAGATCTGG - Intronic
1026261827 7:68762037-68762059 GAGGTGATAAGGAGGAGCTGGGG + Intergenic
1027316988 7:76991866-76991888 GTGGAGTTGAGGGGGAGGTTTGG + Intergenic
1030000909 7:105060642-105060664 CTGGAGTTCAGGAGTAGCTTGGG - Intronic
1030192871 7:106826910-106826932 GTGGAGTTACAGATGAGCTGAGG - Intergenic
1031599911 7:123694048-123694070 GTGTAGTTAAGCAAAAGCTCCGG - Intronic
1032066422 7:128774942-128774964 GCTGAGTTAACTAGGAGCTCAGG - Intronic
1035304309 7:157921304-157921326 GTGGAGGTAATGAGGAGTTGGGG + Intronic
1035332367 7:158104737-158104759 GTGGAGTTGGGAAGGAGCTGAGG - Intronic
1035585533 8:770202-770224 GTGGAGTTAGTGAGGGGCTGCGG + Intergenic
1035660600 8:1344681-1344703 GTGGGGTTACGGAGGAGCGCGGG - Intergenic
1036911594 8:12761878-12761900 GTGGAATTAAGGATGTGGTCTGG + Intergenic
1037169012 8:15867544-15867566 GGGGAGATAAGGAGGAGGACGGG + Intergenic
1038911220 8:31967070-31967092 GATGAGTTAAAGAGGAGCCCTGG + Intronic
1040322892 8:46327431-46327453 GTGCAGTTGAGCAGAAGCTCAGG - Intergenic
1042745917 8:72105338-72105360 GTGGTATAAAGGAGTAGCTCAGG + Intronic
1043835004 8:85035836-85035858 GTGGAGTTCAGAAGGATTTCTGG + Intergenic
1044502298 8:92972525-92972547 GTGGTGTGAAGGAGGAGCACAGG - Intronic
1045122917 8:99057787-99057809 GTAAAGTTAAGGACGACCTCAGG - Intronic
1047213419 8:122858068-122858090 GTGGAGTGAGGGCCGAGCTCGGG + Intronic
1048998316 8:139807873-139807895 CTGGAGGTAGGGATGAGCTCTGG + Intronic
1053129359 9:35606172-35606194 GTGGAACTGAGGAGGAGCTGAGG + Intronic
1057922421 9:99107985-99108007 GTAGAGTTAAGTAGCAGCACAGG - Intronic
1058677749 9:107414812-107414834 GTGGAGTTCAGGAGGTGCTTTGG + Intergenic
1060280452 9:122212645-122212667 GAGGAGTGAGGGAGGAGCCCCGG - Intronic
1061037722 9:128122746-128122768 GGGGAGGTGAGCAGGAGCTCTGG + Intronic
1061226768 9:129284947-129284969 GAGGAGTTCAGGAAGAGCACTGG + Intergenic
1061406348 9:130394809-130394831 GTGCAGTTAAGGGGGACTTCTGG + Intronic
1062178410 9:135177008-135177030 GTGGAGCCAGGGAGGAGCACAGG - Intergenic
1185754948 X:2645746-2645768 GAGGAGGGAAAGAGGAGCTCAGG - Intergenic
1186841064 X:13485061-13485083 GTGCAGTCAAGGAAGAGCTGGGG - Intergenic
1195397462 X:104426518-104426540 GTGGGGGTAGGGAGGAGCTGTGG + Intergenic
1197317858 X:124990829-124990851 GTGAGGCTAGGGAGGAGCTCAGG + Intergenic
1197666141 X:129225401-129225423 TTGAAGAGAAGGAGGAGCTCAGG + Intergenic
1198597173 X:138249363-138249385 GTGGAGTGAAGGAGGTCCTTTGG - Intergenic
1198720366 X:139611798-139611820 GTGCAGGGAAGGAGGAGATCTGG + Intronic
1200096272 X:153665421-153665443 GGGGTGTGAGGGAGGAGCTCTGG + Intergenic
1200147054 X:153931827-153931849 GTGTTGTGATGGAGGAGCTCTGG - Intronic
1200211429 X:154348399-154348421 GTGGGGTGAAGCAGGAGCCCTGG + Intergenic
1201575921 Y:15461196-15461218 AGGGAGTTGAGGAGGAGGTCAGG - Intergenic
1201927185 Y:19300045-19300067 CTGGAGTTAAGGATGTGCCCAGG + Intergenic