ID: 1078188692

View in Genome Browser
Species Human (GRCh38)
Location 11:9074091-9074113
Sequence CTCCCTGCTCTGGGTGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 322}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078188692_1078188701 26 Left 1078188692 11:9074091-9074113 CCCTACCCACCCAGAGCAGGGAG 0: 1
1: 0
2: 1
3: 37
4: 322
Right 1078188701 11:9074140-9074162 CAGCACCTTTTTGAAAAACTTGG 0: 1
1: 0
2: 0
3: 14
4: 175
1078188692_1078188699 -9 Left 1078188692 11:9074091-9074113 CCCTACCCACCCAGAGCAGGGAG 0: 1
1: 0
2: 1
3: 37
4: 322
Right 1078188699 11:9074105-9074127 AGCAGGGAGCAGGCTCATACTGG 0: 1
1: 0
2: 1
3: 19
4: 195
1078188692_1078188700 -1 Left 1078188692 11:9074091-9074113 CCCTACCCACCCAGAGCAGGGAG 0: 1
1: 0
2: 1
3: 37
4: 322
Right 1078188700 11:9074113-9074135 GCAGGCTCATACTGGTGCTGTGG 0: 1
1: 0
2: 1
3: 14
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078188692 Original CRISPR CTCCCTGCTCTGGGTGGGTA GGG (reversed) Intronic
900121606 1:1050713-1050735 CTCCCTGCTCCTGGTGAGGAGGG - Exonic
900150624 1:1177837-1177859 CCTCCTGTTCTGGGTGGGGAGGG + Intronic
900203315 1:1420748-1420770 GTCCCTTCTCTGGGTGGGGCAGG - Intronic
900208089 1:1440015-1440037 CGCCCGGCTCTGGGCGGGGATGG - Exonic
900363144 1:2299579-2299601 CTCCTTGCTCTGGGGGGTTGAGG + Intronic
902070306 1:13729091-13729113 TTCCCTGCTCTGTGTGGAGAGGG + Intronic
902244885 1:15114303-15114325 CTCCCTGCTCAGGGAGGTTGAGG - Intronic
902260458 1:15221201-15221223 CTTCCTGCTATTGGTGGGCATGG + Intergenic
902741188 1:18439498-18439520 CTCCCTCCTCAGGGTGGGGTGGG + Intergenic
902784221 1:18722608-18722630 TTCCCTGCCCTGTGTGGGTGAGG + Intronic
903279801 1:22244007-22244029 CTCCCTGCCCTGGGTGCCCAGGG + Intergenic
903557907 1:24206600-24206622 CTTCCTGCTCAGGGAAGGTAGGG - Intergenic
904260397 1:29284458-29284480 CTCCCAGCTCTCAGTGGATAGGG - Intronic
904429540 1:30453175-30453197 CTCCCTGTTCTGCATGGTTATGG + Intergenic
904494556 1:30879268-30879290 CTCCCTGCCCTGGCTGGGCTGGG - Intronic
905453468 1:38071804-38071826 CTCCTTGCCCTGGATGGGGAAGG + Intergenic
907456264 1:54578023-54578045 CTCCCTGCACAGCCTGGGTAGGG - Intronic
907873331 1:58463230-58463252 CTCTCTGCTCTCAGTGGGGAAGG - Intronic
915116907 1:153607134-153607156 CTCCCTGCTCTTGGTGGCAGTGG - Exonic
917306332 1:173628681-173628703 CCCCAGGCTCTGGGTGGGTCTGG - Intronic
917788924 1:178487176-178487198 CTGTCTGCACTGGGTGGGCAAGG - Intergenic
918082964 1:181221617-181221639 CATCCTGCTCTGGGAGGGTAGGG - Intergenic
920076299 1:203339658-203339680 CTCCCTGCTCTGTCTTGGTTGGG + Intergenic
920516611 1:206589122-206589144 CTCCCACCTCTGGGAGGGAACGG - Intronic
920536474 1:206740014-206740036 GACCCTCCTGTGGGTGGGTAGGG - Intergenic
921388022 1:214590353-214590375 CTTCCTACTCTGGGAGGGAATGG - Intergenic
922831444 1:228556503-228556525 CTGACGGCTCTGGGTGGGTGGGG - Intergenic
922831922 1:228608457-228608479 CTGACGGCTCTGGGTGGGTGGGG - Intergenic
922832483 1:228610698-228610720 CTGACGGCTCTGGGTGGGTGGGG - Intergenic
922833043 1:228612939-228612961 CTGACGGCTCTGGGTGGGTGGGG - Intergenic
922833604 1:228615180-228615202 CTGACGGCTCTGGGTGGGTGGGG - Intergenic
922834163 1:228617421-228617443 CTGACGGCTCTGGGTGGGTGGGG - Intergenic
922834721 1:228619662-228619684 CTGACGGCTCTGGGTGGGTGGGG - Intergenic
922835272 1:228621877-228621899 CTGACGGCTCTGGGTGGGTGGGG - Intergenic
922835831 1:228624097-228624119 CTGACGGCTCTGGGTGGGTGGGG - Intergenic
922836390 1:228626339-228626361 CTGACGGCTCTGGGTGGGTGGGG - Intergenic
922836948 1:228628578-228628600 CTGACGGCTCTGGGTGGGTGGGG - Intergenic
922837507 1:228630820-228630842 CTGACGGCTCTGGGTGGGTGGGG - Intergenic
922838066 1:228633061-228633083 CTGACGGCTCTGGGTGGGTGGGG - Intergenic
922838626 1:228635301-228635323 CTGACGGCTCTGGGTGGGTGGGG - Intergenic
922839184 1:228637526-228637548 CTGACGGCTCTGGGTGGGTGGGG - Intergenic
922839742 1:228639767-228639789 CTGACGGCTCTGGGTGGGTGGGG - Intergenic
922840305 1:228641998-228642020 CTGACGGCTCTGGGTGGGTGGGG - Intergenic
922840865 1:228644239-228644261 CTGACGGCTCTGGGTGGGTGGGG - Intergenic
922841428 1:228646470-228646492 CTGACGGCTCTGGGTGGGTGGGG - Intergenic
922979068 1:229809641-229809663 CTCCCTGCACTTGGTGGGTGGGG + Intergenic
923030263 1:230243850-230243872 CTCTCTGCTCTTAGTGAGTAGGG + Intronic
923268421 1:232334279-232334301 CTTTCTGCTTTGGCTGGGTAAGG - Intergenic
924415325 1:243850803-243850825 CTCCCGGCTCTGGCTGGCTAGGG - Intronic
1063157947 10:3397226-3397248 CTCTCTGCTATGGGAGGGCATGG + Intergenic
1064016019 10:11773023-11773045 CTCCCTCCTCTGGGTGGGCCTGG - Intergenic
1067041304 10:42954595-42954617 CTCCATGCTCTCGGTGGCTGTGG + Intergenic
1067819928 10:49519625-49519647 TTCCCTGATCGGGGTGGGCATGG + Intronic
1067826632 10:49578764-49578786 GTGCCTGCTCTGGCTGGGCATGG + Intergenic
1067904382 10:50275586-50275608 CAGTCTGCACTGGGTGGGTATGG - Intergenic
1069851783 10:71409914-71409936 GTGCCTGGTCTGGGTGGGTGTGG + Intronic
1070630693 10:78082451-78082473 CCCCCTGGGCTGGGTGGGTGTGG + Intergenic
1070772774 10:79091994-79092016 CTCCCTGTACTGGGTGGGATGGG + Intronic
1070775375 10:79106711-79106733 CTCCCTGCTAGGGCTGGATATGG + Intronic
1071417545 10:85455246-85455268 CACCCTGCTCTGTGAGGCTAGGG - Intergenic
1071458197 10:85867462-85867484 CCCGCTGCACTGGGTGGGAATGG + Intronic
1073207194 10:101775586-101775608 CTCCCTCCTCGGGGTGGCTCGGG + Intronic
1073607795 10:104913884-104913906 GTCCCAGCTCTGGGAGGCTAAGG - Intronic
1074214292 10:111369246-111369268 CTCCTTGTTCTGGGTGGGGTGGG - Intergenic
1075789179 10:125071212-125071234 CTCCCTGCTCTGGGAAGGGAAGG + Intronic
1076349930 10:129808706-129808728 GCCCCTGCTCTGGGCGAGTAGGG - Intergenic
1076652907 10:132002260-132002282 CTCCCACCTCTGTGTGGGCAGGG - Intergenic
1077061482 11:619638-619660 CTCCCCTCTGTGGGTGGGTCAGG - Intronic
1077143114 11:1033528-1033550 CTCCCTGCTCTCGGTGGCTCCGG + Intronic
1077164067 11:1127267-1127289 CACCCTGGTCTGTGTGCGTAAGG + Intergenic
1077482628 11:2823520-2823542 CTCCCTGTTCTGTCTGTGTAGGG - Intronic
1077654547 11:4006234-4006256 CCTCCTGCTCTGGCTGTGTATGG + Intronic
1078188692 11:9074091-9074113 CTCCCTGCTCTGGGTGGGTAGGG - Intronic
1078366464 11:10710731-10710753 CTGCCTGCTCTGTGGGGGCAGGG - Intergenic
1080750083 11:35143014-35143036 CCCCCTGCAGTGGGTGGGGAGGG + Intronic
1081576167 11:44319689-44319711 GGGCCTGCTCTGGGCGGGTAGGG - Intergenic
1081936017 11:46904378-46904400 CTCCCTGCTTTTGGAGGGCATGG - Intronic
1083267025 11:61551512-61551534 GTCCCTGTTCTGGGGAGGTAGGG - Intronic
1083587236 11:63869219-63869241 CTCCCTGCCCAGGGTGGGGGTGG - Intronic
1084085930 11:66855267-66855289 CTCCCAGCACTGGGTGGCCATGG + Intronic
1084651072 11:70489919-70489941 TGCCCTGCTCAGGGTGGGAAGGG - Intronic
1084705713 11:70814979-70815001 GTCCCTGCTCTGGGAGTGTGTGG - Intronic
1085034388 11:73291368-73291390 CGCCCTGCTGGGAGTGGGTACGG + Intronic
1085533362 11:77204330-77204352 CTCCCGGCTCTGTGTGAGGAAGG - Intronic
1085689369 11:78652934-78652956 CTCCCTCCTCTGGGAGGGTTGGG + Exonic
1089589882 11:119533442-119533464 CTCCCTGCCAGGGGTGGGGAAGG - Intergenic
1089697535 11:120225360-120225382 CACCCTGATCAGGGTGGGTCAGG - Intronic
1091239555 11:134043442-134043464 CTCCCCGCCCCTGGTGGGTAGGG + Intergenic
1091283930 11:134397633-134397655 CCCGCGGCTCTGGGTGGGAATGG - Intronic
1091304386 11:134528187-134528209 CTGTCTGCTCTGGGTGTGTGAGG + Intergenic
1092285683 12:7128138-7128160 CCCGCTGCTCTGGCTGGGGAAGG + Intronic
1094817953 12:34205166-34205188 CTGGCAGCTCTGGGTGGGTGGGG + Intergenic
1095098954 12:38162095-38162117 CTAGCAGCTCTGGGTGGGTGAGG - Intergenic
1096148100 12:49293189-49293211 CTCCCTGCTCCTGGAGGGTGGGG + Intergenic
1096681628 12:53259308-53259330 GTCCCTGCCCTGGGAGGGGAGGG + Intergenic
1097762340 12:63482210-63482232 CTCCCTGCTCTGTGTGTGGCTGG - Intergenic
1101441814 12:104709479-104709501 CTGCCAGCTCTGGGTGGGGCCGG + Intronic
1102569066 12:113816278-113816300 CTCACTGCTCTGGGGAGGTAGGG + Intergenic
1104125222 12:125839632-125839654 CTTCCTGCTCTGGATGGGAAGGG + Intergenic
1104685244 12:130780627-130780649 CTCCCTGCCCTGGCTGGGATAGG - Intergenic
1104859002 12:131915149-131915171 CTCCATGCTCAGCGTGGGCAGGG - Exonic
1104947814 12:132424670-132424692 CTCCCAGCTTGGGGTGGGGAGGG + Intergenic
1107385530 13:39904505-39904527 CTCCATGCTCTGGGTGTTTGAGG + Intergenic
1107728551 13:43324793-43324815 CTGCCTCCTCTGCGTGGGTGTGG - Intronic
1108314649 13:49225350-49225372 CACCCTGGGTTGGGTGGGTAGGG - Intergenic
1113732323 13:112650265-112650287 CTCCTTGATATGGGTGGGTGAGG + Intronic
1113922076 13:113918833-113918855 TTCCGTGCTCTGGGTGAGCAAGG + Intergenic
1114815250 14:25949769-25949791 CTGACTGTTGTGGGTGGGTAGGG - Intergenic
1115472837 14:33785991-33786013 CTCCCTGCTGTGGGGTGGTGGGG - Intronic
1118458413 14:65965952-65965974 CTCCCAGATCTGGGTGGGACAGG + Intronic
1118834758 14:69469659-69469681 CTCCGTGCTTTGGGAGGGTGAGG - Intergenic
1118951988 14:70443288-70443310 ATTCTTGCTCTGGGTGGGGAAGG + Intergenic
1119539694 14:75429727-75429749 CTCACACCTCTGGGTGGTTAAGG + Intronic
1121006703 14:90495418-90495440 GTCCCTGCTCAGGGTGAGTGAGG - Intergenic
1121030808 14:90657164-90657186 CTCCCTGCACTGGGTGAGTAGGG - Exonic
1121158112 14:91706345-91706367 CTCCCTGACCTGGGTGTGAATGG - Intronic
1121685692 14:95833380-95833402 CTCCCAGCTCTTGGTGGCTCTGG - Intergenic
1122037034 14:98956431-98956453 CTCCCTGCTCCGGGTGCATGTGG - Intergenic
1122699993 14:103581913-103581935 CTCCCTGCTCTGTGGAGGGAGGG + Intronic
1122767372 14:104081689-104081711 CGCTCTGCTCTGGGTGGGGCTGG + Intergenic
1122848381 14:104513266-104513288 CTCCCTGCCCTGGCGGGGTGTGG - Intronic
1123485209 15:20689045-20689067 TTCCCTGGTTTGGGTGGGTGGGG - Intergenic
1123537936 15:21258101-21258123 TTCCCTGGTTTGGGTGGGTGGGG - Intergenic
1124790016 15:32718350-32718372 CTCGCTGCTCTGGGTCTGCAGGG + Intronic
1126637258 15:50791685-50791707 CTACCTGGTGTGGGTGGGTCTGG - Intergenic
1127251741 15:57245939-57245961 TGCCCTGCTATGGGTGGGTAAGG - Intronic
1129235499 15:74221581-74221603 CTTCCTGCTCTGTGTGGGTGGGG + Intergenic
1129250980 15:74308866-74308888 CTTCCTCCTCAGGCTGGGTAGGG + Intronic
1129461404 15:75701773-75701795 CTCCTTGCTTTGGGTGGGGTTGG - Intronic
1129723430 15:77890034-77890056 CTCCTTGCTTTGGGTGGGGCTGG + Intergenic
1129987773 15:79933766-79933788 CTCCCTGTTATCAGTGGGTATGG + Intergenic
1131869001 15:96742371-96742393 CTCCCTACAGAGGGTGGGTAGGG + Intergenic
1132582782 16:693208-693230 CTCCCTCCTCGGGGTGTCTAGGG + Exonic
1133223105 16:4327698-4327720 CGCCCTGCGGTGGGTGGGAAGGG + Intronic
1133944950 16:10340296-10340318 ATCCCTGCTCTGGGATGGGAGGG - Intronic
1134118256 16:11565639-11565661 CTCCCTGCTCCGGGTTTGTGGGG + Intronic
1135076182 16:19395789-19395811 CTTCCTCCTCTGGATGAGTAGGG + Intergenic
1135139491 16:19909312-19909334 CTCACTTCTCAGGGTGGGCAAGG + Intergenic
1135235032 16:20747204-20747226 ATCCCTGCTCTGGGATGGCAGGG - Intronic
1136453508 16:30368287-30368309 CTCCCTGCTCTAGGTGCCTCAGG + Intronic
1136656538 16:31712602-31712624 CTCCCTGCTCTGGAGAGGGATGG - Intergenic
1138556490 16:57773963-57773985 CTGCCTGCTCTTGGTGGGGCAGG + Intronic
1139178914 16:64722756-64722778 GTCCCTGCTGTGGGTGGATATGG + Intergenic
1139332427 16:66203771-66203793 GTCCCTGCTCTGGGTCTGGATGG - Intergenic
1139469499 16:67170616-67170638 CTCCCGGCTGTGGGAGGGAAGGG + Intronic
1139802091 16:69530955-69530977 ATCCCTGCTCTGGGCGAGGAGGG - Intergenic
1139954249 16:70685786-70685808 CTCCATGCTCTGGCTGGGCCGGG + Exonic
1141525452 16:84608141-84608163 CTCCATGCTCTGGGTGTGGGTGG + Intronic
1141664102 16:85457067-85457089 CTGCCTGCTCGGGGTGGCTGTGG + Intergenic
1141768813 16:86076248-86076270 GTCCCTGCCCTTGGTGGGGATGG + Intergenic
1142137952 16:88460171-88460193 CACCCGGCTCTGGGAGGGTCTGG + Intronic
1142302896 16:89268924-89268946 TGCCCTGCTCTGGGTGGGCCTGG + Intronic
1142499920 17:326544-326566 CTCTCAGCTCTGGGTAGGTCAGG - Intronic
1142591939 17:1010082-1010104 CCCCCTGGTCTGTGTGGCTAAGG + Intronic
1142742753 17:1940639-1940661 CTCCCAGCCCTGGGTGTGGAGGG - Intronic
1143028263 17:3953473-3953495 ATCCCAGCTCTGAGTGGGCAGGG - Intronic
1143260636 17:5595920-5595942 CTCTCTGCTCTGGGTGGGGGAGG + Intronic
1143563867 17:7709880-7709902 CCCCTAGCTCTGGGTGGGTGAGG - Exonic
1143751101 17:9028420-9028442 CTCCCTGCTCTGGGTGGAGCAGG - Intronic
1144682438 17:17204844-17204866 CTCCCTGCTCTGGGTGGTGTGGG - Intronic
1145986908 17:29053167-29053189 CTCCCTGCTCTGGGTGTCCTGGG + Intronic
1146059600 17:29597547-29597569 CTCCGTTCTCTTGGTGGGGAGGG + Intronic
1146969165 17:37058423-37058445 CTTCCTCCTCTGGCTGGGAACGG - Intergenic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1151157271 17:72134113-72134135 CTCCCTTCACTGGGGAGGTATGG - Intergenic
1151908023 17:77061913-77061935 CCCCCTGCTCAGGGTGGCTCTGG + Intergenic
1151950321 17:77349988-77350010 ATTCCTGGTCTGGGTGGCTATGG + Intronic
1151982122 17:77519281-77519303 CTCGCTGCTCTGTGTGTGTGTGG + Intergenic
1152436394 17:80278834-80278856 CTTCCTTCTCTTGCTGGGTATGG - Intronic
1152558816 17:81067777-81067799 CTCCCTGCTCTGGCCGGCTGAGG - Intronic
1153866438 18:9273788-9273810 CTCAATGCTCTGGGAGGCTAAGG - Intronic
1157147697 18:45181370-45181392 CTCCCTGCTCAGGGTGGCAGAGG + Intergenic
1157479049 18:48041051-48041073 CTCACTGCTGTGGTTGGGGAAGG + Exonic
1159339747 18:67119501-67119523 TTACCTGCTGGGGGTGGGTAAGG - Intergenic
1160131626 18:76230550-76230572 CTCACTGCTCTGGAAGGGTAGGG + Intergenic
1161331169 19:3688398-3688420 CCCCCTGCTGTGGGCGGGGAGGG + Intronic
1162053689 19:8050491-8050513 CCTCTTGCTCTGGGTGGGTGAGG - Intronic
1163311600 19:16518266-16518288 CTCCATGCTCTGGATGGGACTGG + Exonic
1163393654 19:17046081-17046103 CTCCCTGCCCTGGATGGGGCTGG + Intergenic
1163569451 19:18072089-18072111 GTGCCTCCTCTGGGTGGGGAGGG - Intronic
1165111162 19:33503167-33503189 CTTCCTGGTTTGGGTGGGGAGGG - Intronic
1165711082 19:38011541-38011563 CCCCCTGATCTGGGTGGTCAGGG + Intronic
1165773668 19:38392306-38392328 CTCTCTGCTGGGGGAGGGTAGGG + Intronic
1166315026 19:41984884-41984906 CTCCTGGGTCTGGGTGGGGAGGG - Intronic
1168713568 19:58514760-58514782 CTCCCTGTGCCGGGTGGGTAGGG - Intronic
925059786 2:881796-881818 GTCCCTGTCCTGGGTGGGGAGGG - Intergenic
925142035 2:1557446-1557468 CTCCCTGCCCTGCGTGGGGGTGG + Intergenic
925189355 2:1870357-1870379 CTCCCTGTTCTGTGTGGCTATGG + Intronic
925971566 2:9110142-9110164 CACTCTGCTCTGGGAGGGCAGGG - Intergenic
926766387 2:16325974-16325996 CTCCCTGTTCTCTGTGGGAAAGG - Intergenic
927132679 2:20073732-20073754 CTCCCTGCTCTCGGGGATTAAGG - Intergenic
927404191 2:22749038-22749060 CTCTCTGCTCTAGGTTGGAAAGG + Intergenic
928087707 2:28356203-28356225 GGCCCTGCTCTGGGTGGGAGGGG - Intergenic
928255740 2:29720756-29720778 TTCCCTGCAGTGGTTGGGTAGGG - Intronic
928823157 2:35387570-35387592 TTCCTTGCTCTGAGTGTGTATGG + Intergenic
929204456 2:39275232-39275254 ATCCCAGCACTGGGTGGGTAAGG + Intronic
930761766 2:55046334-55046356 CCCAATGATCTGGGTGGGTAAGG + Intronic
931763056 2:65433044-65433066 CTCCCCTCTCTGGTTGGGTTGGG - Intergenic
934655333 2:96114359-96114381 CTCCGTGCTCTTTGTGGGTGGGG + Exonic
935822157 2:106905390-106905412 CTCCCTGGTGTTGTTGGGTAGGG + Intergenic
937206177 2:120238574-120238596 TTCCCTTCCCTGGGTAGGTATGG - Intergenic
938197771 2:129345440-129345462 CTGGTGGCTCTGGGTGGGTAGGG - Intergenic
938927201 2:136054964-136054986 CTTCCTCTTCTGGGTGGGTTGGG + Intergenic
938976004 2:136479662-136479684 CACCCTGCTATGGGTAGCTATGG - Intergenic
938989048 2:136609295-136609317 TTCCCCGCTCTGGGTGAGTTGGG - Intergenic
941252836 2:163187409-163187431 ATCCCTGCTTTGTTTGGGTATGG - Intergenic
942641605 2:178066726-178066748 CTGCCAGCTCTGGGTGAGGAGGG - Intronic
943734562 2:191340088-191340110 TTCCCTGGTCTGGGTAGTTAAGG - Intronic
944160583 2:196655325-196655347 CTCCCAGAGCTGGGTGGCTAAGG + Intronic
946189939 2:218002830-218002852 CTGCATGCTCTGGGTAGGTCTGG - Intronic
946419764 2:219558152-219558174 CTCCCTGCCCTGGGTTGGCCAGG + Intronic
946828340 2:223702084-223702106 CTCCCTACTCTGGATTGCTATGG + Intergenic
948827206 2:240578478-240578500 CTCCCTGTTCTGAGGGGCTAAGG - Exonic
948967421 2:241394072-241394094 CTCCCTGCACTAGGTCGGAAGGG - Intronic
1169023748 20:2349862-2349884 GTCCCTGCCCTGGCTGGGGAGGG - Intergenic
1170575785 20:17660364-17660386 CTCCTTGCGCTGGTTGGCTAGGG + Exonic
1172029923 20:31974829-31974851 CTCCCTGCTCTGCCTTTGTAGGG + Intronic
1172781329 20:37438508-37438530 CTCCCTGCTCTGGGCTGGGGAGG - Intergenic
1173167744 20:40697864-40697886 CTCCCTGCTCTGTGTGATCAGGG - Intergenic
1174281942 20:49445803-49445825 CTCCCTGCTCTGGCAGGGAAAGG + Intronic
1174558953 20:51416363-51416385 CTGCCGGCTCTGCCTGGGTAGGG + Intronic
1175266027 20:57704022-57704044 TGCCCTGCTGTGGGTGGGTTAGG - Intronic
1175411953 20:58776311-58776333 CTGCCTGCTCGGGGTGGGTGGGG + Intergenic
1175993954 20:62804284-62804306 CTCCCTAAGCTGGGTGTGTAGGG - Intergenic
1176081400 20:63275081-63275103 CTCCCTGCACTGCGTTGGGAAGG + Intronic
1176285850 21:5019123-5019145 CTCCCAGCTCTGGGTGGCCCAGG - Intergenic
1177449677 21:21249430-21249452 CTAACTGCCCTGGTTGGGTAAGG - Intronic
1179501499 21:41812149-41812171 CTCCCTACTCTGGGAGGCTCTGG - Intronic
1179871331 21:44244352-44244374 CTCCCAGCTCTGGGTGGCCCAGG + Intergenic
1181035061 22:20165841-20165863 CTCCCTGCTCTCGGTGAGGCTGG - Intergenic
1181390101 22:22573956-22573978 ATCCCTGCTCTGAATGGGGAGGG - Intergenic
1181508756 22:23379518-23379540 CTCCCTGCTCTGGGTGAGGCTGG + Intergenic
1181583732 22:23841876-23841898 CTCCCTGCTCTGGAGGGGACGGG + Intergenic
1182640368 22:31762130-31762152 ATGCCTACTCTGGGTGAGTAGGG + Intronic
1182652391 22:31862674-31862696 CCCACTGCACTGGGAGGGTAAGG + Intronic
1183264616 22:36817577-36817599 CTCCCTGCGTCGGGTGGGTCAGG - Intronic
1183673000 22:39283791-39283813 CTCCCTGACCTGGTTGGGCAGGG + Intergenic
1184144921 22:42604269-42604291 CTCCCTACCCTGGGTGGGGCGGG + Intronic
1185127702 22:49021056-49021078 CTCCCTGCTCTGCCTGGCCAGGG + Intergenic
949505508 3:4724102-4724124 CCTCCTGCTCGGGGTGGGGAGGG - Intronic
950421752 3:12903618-12903640 CTCTTGGCTCTGGGTGCGTAGGG + Intronic
951582494 3:24180904-24180926 CTCCCTGCCCTGGAGAGGTAAGG + Intronic
953179505 3:40582873-40582895 CTCCCTCCCCTGGGTGGCCAAGG - Intergenic
953750118 3:45602297-45602319 CTCCCTGCTGTGGGTGGGCCTGG + Intronic
953861203 3:46545390-46545412 CTCCCTGCTGTGGGGGTGCAGGG + Intronic
954403560 3:50332319-50332341 TTGCATGCTCTGGGTGGATAAGG + Intronic
958140488 3:89556319-89556341 CTCCCTTTTCTGGCTGGGTGCGG - Intergenic
958859635 3:99430829-99430851 CTCTCTGTTCTTGGTGGCTAGGG + Intergenic
958944345 3:100347384-100347406 CTCTCAGCTCTGGCTGGGTGCGG - Intronic
961213692 3:125143805-125143827 CTCCCTGGCCTGGGAGGGAAGGG + Intronic
961447449 3:126987564-126987586 CACACAGGTCTGGGTGGGTATGG + Intergenic
961816069 3:129551036-129551058 ATCCCAGCTCTGGGTGGCTCTGG - Intronic
963294486 3:143530464-143530486 CTCACAGCTCTGCGTGGCTAGGG - Intronic
964767218 3:160190671-160190693 CTCCCCACTCTGGGAGGGAAAGG + Intergenic
965230954 3:166052275-166052297 CTCACTGCTCTGGGTGCCTAAGG - Intergenic
966929781 3:184668867-184668889 CTCTGTGCTCTGGGTAGATAGGG - Intronic
966932956 3:184687557-184687579 TTCCCTGCCCTGGGAGGGTGTGG + Intergenic
967945445 3:194800313-194800335 CGCCCTGCTCTGAATGGGGAGGG + Intergenic
968491403 4:892386-892408 CTCCCTGCTCCCCGTGGGTGAGG + Intronic
968588474 4:1445920-1445942 CACCCTGCTCTGGTTTGGGAGGG + Intergenic
969004312 4:4006997-4007019 CTCCCTGCTTTTTGTGCGTATGG + Intergenic
969632050 4:8344470-8344492 CGCCCTGCTGTGGGTGTGCAGGG - Intergenic
969880383 4:10168388-10168410 TTTCCTGCTCTGGGTGGGCCAGG + Intergenic
970857401 4:20665022-20665044 CTCACTGCTCTGGTTGGGTTTGG - Intergenic
974766664 4:66356014-66356036 CTCTCTGCACTGGGTGGGCCGGG - Intergenic
975969560 4:80016923-80016945 TACCCTCCTCTGGGTGGGGAAGG + Intronic
976238546 4:82928227-82928249 CTGCCTGCTCTGCCTGGGCAAGG + Exonic
976987346 4:91318103-91318125 GCCCATGCTCTGGGTGGGGAGGG + Intronic
979630873 4:122901175-122901197 CTCCCTGCTTTGAGTTGGTGAGG + Intronic
981286014 4:143020031-143020053 GTGACTGCTCTGGGTGGCTAAGG + Intergenic
985576040 5:673898-673920 CTCCCTGCGGTGGGTGGGGCTGG - Intronic
985614752 5:912976-912998 CACCCTGCTGTGGTTGGGGACGG + Intronic
985780262 5:1867217-1867239 CACCCTGCTCTGTGTAGGTGTGG + Intergenic
985883417 5:2657687-2657709 CTACCTGCTGGGGGTGGGTGAGG - Intergenic
988937742 5:36105847-36105869 CTCCCTTCTCTATGTGGATAGGG + Intronic
989205503 5:38805434-38805456 CTCCCAGCTCAGGGAGGGTCTGG + Intergenic
991456100 5:66806244-66806266 CTCCCTGCTCTGACAGGGTAAGG - Intronic
991654757 5:68892858-68892880 TGCCCTGCTCTGAGTGGCTAAGG - Intergenic
992088084 5:73296053-73296075 CTCCCTGCTCTTCAGGGGTAGGG - Intergenic
992202505 5:74398281-74398303 CTCCCAGCTCTGTGTGGCCATGG - Intergenic
994260907 5:97657534-97657556 GTCTCAGCTCTGTGTGGGTAGGG - Intergenic
994778189 5:104061848-104061870 CTCAGTGCTGTTGGTGGGTATGG - Intergenic
997721070 5:136078875-136078897 CTTCCTGCTGTGGGTAGGAAAGG - Intergenic
998006677 5:138661774-138661796 CTCCCTGCGCTGGCTGAGGATGG - Intronic
999280824 5:150364430-150364452 CTCCATGCTCTGGGGGTGCAAGG + Intronic
999297947 5:150472405-150472427 ATCCCTGCCTTGGGTGGGCAAGG - Intergenic
999731341 5:154478419-154478441 CTCCCTGCTCTGCGGGCTTAGGG + Intergenic
1000021664 5:157323659-157323681 CTCCCTGCTCTGCTTGGCCAAGG - Intronic
1001151883 5:169236758-169236780 TTCCTTGCTCTGGCTGGGTGTGG - Intronic
1001168519 5:169393735-169393757 CTCCCGCCTCTGGGTGGGACAGG + Intergenic
1001721506 5:173860692-173860714 CTGCCTGCTCTGTGGGGGAAGGG - Intergenic
1002421249 5:179150193-179150215 CTCCCTGCCTGGGGTGGGTGCGG + Intronic
1005500128 6:26422100-26422122 CTGCCTGCTCTGGGTGCTCATGG + Intergenic
1005504606 6:26458618-26458640 CTGCCTGCTCTGGGTGCTCATGG + Exonic
1006175244 6:32117458-32117480 CTCACTCCTGTGGGTGGGCAAGG - Intronic
1006395058 6:33781863-33781885 CTCCCTGCTCTCGGGGAGTCAGG - Intronic
1007275705 6:40671881-40671903 CTCCCTCCTCTGGGTTTGTTTGG - Intergenic
1007623055 6:43226467-43226489 CTCCCTGAGCAGGGTGGGTATGG - Intronic
1007782045 6:44259991-44260013 CTCTCTGCTATGGGTGTGCAAGG + Intronic
1010379410 6:75207854-75207876 CTCCCTGCTCTTTGTGTGTTGGG - Intergenic
1011662018 6:89602914-89602936 CGCTCTGCTCTGTGTGGGGACGG + Intronic
1013615454 6:111838879-111838901 CTCCAGACTCTGGGTGGGTATGG + Intronic
1015485308 6:133763378-133763400 CTCCTTGCTGTGGGAGGGTGGGG + Intergenic
1016322929 6:142867047-142867069 CAACCTGCTCTGGGTAAGTATGG + Intronic
1016468285 6:144348248-144348270 CGCCCAGCTCTGGGGAGGTATGG + Intronic
1018072109 6:160173981-160174003 CTCCCTGCTCAGGGAGGGTGAGG + Intronic
1019278733 7:189281-189303 CTGCCTGCTCTGGGTGTGAGGGG - Intergenic
1019378338 7:708126-708148 CCCCCGGCTCTGGGTGGTTCTGG - Intronic
1019642664 7:2112703-2112725 CTGCCTGCTCCGGGTGTGTCAGG - Intronic
1020324444 7:6963498-6963520 CTCCCTGCTTTTTGTGCGTATGG + Intergenic
1022474560 7:30701462-30701484 CTCCAAGCTCTGGGAGGATAAGG + Intronic
1023601579 7:41886307-41886329 CTCCCTGCTCTGTGGGGGCCAGG - Intergenic
1026947944 7:74328127-74328149 CTCCCTGGTCGGGGTGGGCTGGG + Intronic
1027423578 7:78040496-78040518 CAACCTTCCCTGGGTGGGTAAGG + Intronic
1027469872 7:78560072-78560094 GTCCCTGCTTTGTGTGGGCATGG - Intronic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1034367399 7:150563213-150563235 CTTCCTCCTCTGGATGAGTAGGG + Intergenic
1034450409 7:151134297-151134319 CTCCCTGCTGTGGGAGGAGAGGG - Intronic
1034888237 7:154815710-154815732 CTTGCTGCTCTGAGTGGGAACGG + Intronic
1035262380 7:157670142-157670164 CTTCCTGCTCTGGGGAGGTGAGG + Intronic
1036183180 8:6602240-6602262 CGCCCTGCTCTTGGTGCTTAAGG - Intronic
1037861988 8:22411995-22412017 CTCCCTGCCCTGGGTGGGGCTGG + Intronic
1038062291 8:23926794-23926816 GTCCCTGCTGTGGGTGGGACGGG + Intergenic
1039102031 8:33951269-33951291 CACCCTGCTATGGGTGGCTGTGG - Intergenic
1039466589 8:37789117-37789139 CTCCCTGTTATGGCCGGGTAAGG + Intronic
1040610681 8:48978444-48978466 TTGCCTGCTCTGGGAGGGCAGGG + Intergenic
1041195581 8:55398321-55398343 CTCCCTCATTTGGGTGGGTAGGG - Intronic
1041292359 8:56319771-56319793 CCCTCTGCTCCGGGTGGGGAGGG + Intronic
1042876774 8:73447796-73447818 CTCCCCCCTCTGGGTGGCTAGGG + Intronic
1046838151 8:118825892-118825914 CTCACAGCTCTGTGTGGCTAGGG - Intergenic
1049409469 8:142466018-142466040 CTCCATGCCCTAGGTGTGTACGG - Intronic
1049615880 8:143575694-143575716 CTCACTGCCCTGGGTGGGGAAGG + Exonic
1051857446 9:21585043-21585065 CTCCATGCTCTGGGCTGATAGGG + Intergenic
1053788803 9:41671350-41671372 TTCCCTGCAATGGGTGGGGAAGG - Intergenic
1054156337 9:61643418-61643440 TTCCCTGCAATGGGTGGGGAAGG + Intergenic
1054177084 9:61882689-61882711 TTCCCTGCAATGGGTGGGGAAGG - Intergenic
1054476109 9:65574428-65574450 TTCCCTGCAATGGGTGGGGAAGG + Intergenic
1054660450 9:67698117-67698139 TTCCCTGCAATGGGTGGGGAAGG + Intergenic
1056922993 9:90808614-90808636 CTCCCTGTTCTTTGTGGGTATGG + Intronic
1056960485 9:91118155-91118177 CTGCCCGCTCTGGCTGGGGAGGG - Intergenic
1058626834 9:106942288-106942310 CTCCCTCCTCTGGGTTGGGAGGG - Intronic
1059500286 9:114746458-114746480 TTCTCTGTTCTGGGTGAGTAAGG - Intergenic
1060555913 9:124507124-124507146 CCCCCTGCTCTGGGCAGGGAAGG - Intronic
1062020360 9:134316418-134316440 CTCCCTGCTCTGTGAGTGTCTGG + Intergenic
1062182288 9:135196872-135196894 CTCGCTGCTGGGGGTGGGCACGG - Intergenic
1062496108 9:136832525-136832547 CTGCCTGCTCTGGGTGGCAGAGG + Intronic
1062544535 9:137055548-137055570 CTCCCTCCTCTGGGCGGTCAGGG - Intergenic
1062589239 9:137266028-137266050 CTGGCTGCTCTGGGTGGTCAGGG + Intronic
1062708372 9:137957635-137957657 CTCCCTCCTCTGCGTGGATCAGG - Exonic
1062733149 9:138120476-138120498 CACCCTGCTCTGGCTGGTTATGG - Intronic
1203782287 EBV:107373-107395 CTCCCCGGTCTGGGTGGTCAAGG + Intergenic
1185462251 X:338768-338790 CTCCCTGCTCAGGGTGAGTGCGG - Exonic
1187439753 X:19307419-19307441 CTCCCTCTTCTGGTTGGGTTTGG - Intergenic
1188008705 X:25036830-25036852 CTCCCTTCTCTTTTTGGGTATGG + Intergenic
1190145488 X:47888109-47888131 CCACCTGCTCTCAGTGGGTAAGG + Exonic
1192763453 X:74119699-74119721 CTTCCTGTTCTGTGGGGGTAGGG - Intergenic
1196968675 X:121085483-121085505 TTCCCTGCTCTGGGATGGGAGGG - Intergenic
1199990783 X:152986562-152986584 CTCCTTGCTCTGGGCTGGTGGGG + Intergenic
1200033872 X:153316036-153316058 CTCCTTGCTCTGGGCTGGTGGGG + Intergenic
1200078787 X:153565423-153565445 CTCCCTTCACTTGGTGGGAACGG + Intronic
1200887420 Y:8282716-8282738 CTCTCTTGTCTGGGTGGGGAAGG - Intergenic