ID: 1078195970

View in Genome Browser
Species Human (GRCh38)
Location 11:9137446-9137468
Sequence GTGCAGAAGCTGAGGCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 660
Summary {0: 1, 1: 0, 2: 8, 3: 64, 4: 587}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078195964_1078195970 2 Left 1078195964 11:9137421-9137443 CCTGGGAAGCCCTGAAGTAGAGC 0: 1
1: 0
2: 0
3: 14
4: 180
Right 1078195970 11:9137446-9137468 GTGCAGAAGCTGAGGCAGGCAGG 0: 1
1: 0
2: 8
3: 64
4: 587
1078195967_1078195970 -8 Left 1078195967 11:9137431-9137453 CCTGAAGTAGAGCAGGTGCAGAA 0: 1
1: 0
2: 1
3: 21
4: 221
Right 1078195970 11:9137446-9137468 GTGCAGAAGCTGAGGCAGGCAGG 0: 1
1: 0
2: 8
3: 64
4: 587
1078195959_1078195970 21 Left 1078195959 11:9137402-9137424 CCAGTCCCTGAAATCACAGCCTG 0: 1
1: 0
2: 2
3: 23
4: 254
Right 1078195970 11:9137446-9137468 GTGCAGAAGCTGAGGCAGGCAGG 0: 1
1: 0
2: 8
3: 64
4: 587
1078195962_1078195970 16 Left 1078195962 11:9137407-9137429 CCCTGAAATCACAGCCTGGGAAG 0: 1
1: 0
2: 5
3: 25
4: 270
Right 1078195970 11:9137446-9137468 GTGCAGAAGCTGAGGCAGGCAGG 0: 1
1: 0
2: 8
3: 64
4: 587
1078195966_1078195970 -7 Left 1078195966 11:9137430-9137452 CCCTGAAGTAGAGCAGGTGCAGA 0: 1
1: 1
2: 1
3: 12
4: 187
Right 1078195970 11:9137446-9137468 GTGCAGAAGCTGAGGCAGGCAGG 0: 1
1: 0
2: 8
3: 64
4: 587
1078195963_1078195970 15 Left 1078195963 11:9137408-9137430 CCTGAAATCACAGCCTGGGAAGC 0: 1
1: 1
2: 0
3: 23
4: 306
Right 1078195970 11:9137446-9137468 GTGCAGAAGCTGAGGCAGGCAGG 0: 1
1: 0
2: 8
3: 64
4: 587

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078195970 Original CRISPR GTGCAGAAGCTGAGGCAGGC AGG Intronic
900494258 1:2969339-2969361 GTGTATAAGATGAGGAAGGCAGG - Intergenic
900530195 1:3149281-3149303 CTGAAGAAGATGAAGCAGGCAGG + Intronic
900539791 1:3196981-3197003 GTGCAGCCGCTGAGGCTGGGGGG + Intronic
900546440 1:3231825-3231847 GTGGAGAAGCTGAACCAGGAAGG - Intronic
900567316 1:3339897-3339919 GTGCAGCAGCTGAGGTTGGAAGG + Intronic
900792348 1:4688910-4688932 GTGGAGAAACTGAGGCAGGGAGG + Intronic
901475858 1:9488784-9488806 GTGCAGAAGAATAGGAAGGCTGG + Intergenic
901530217 1:9848368-9848390 CTTCAGAAGATGAGACAGGCCGG + Exonic
901640438 1:10690464-10690486 GATCAGAAGCTGGGCCAGGCTGG - Intronic
902217852 1:14945711-14945733 GAGCAGCTGCTCAGGCAGGCTGG + Intronic
902443283 1:16445280-16445302 GTGCTGAAGCTGAGAAAGCCTGG - Intronic
903430754 1:23297693-23297715 TTTGAGAGGCTGAGGCAGGCAGG - Intergenic
903662610 1:24987520-24987542 GTACTGGGGCTGAGGCAGGCAGG - Intergenic
903892835 1:26581346-26581368 GGGCAGGAGCTGAGGCGGGAGGG - Intergenic
904014205 1:27407677-27407699 GGGCAGAGGGTGAGGCAGTCTGG + Exonic
905028704 1:34867459-34867481 GTGCTGGAGGTGAGACAGGCAGG - Intronic
905326045 1:37152718-37152740 GGGCAGAATTTGAGACAGGCAGG - Intergenic
905868418 1:41388951-41388973 GTGCAGAAGTAGATGCAAGCTGG - Intergenic
906212525 1:44019988-44020010 GAGAGGAAGCTGAGGAAGGCTGG + Intronic
907104228 1:51866112-51866134 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
907277523 1:53325529-53325551 GTGAGGAAACTGAGGCAGGAGGG + Intronic
907333672 1:53687171-53687193 GAGCAGAACCAGAGCCAGGCAGG + Intronic
908298447 1:62736863-62736885 TTTGGGAAGCTGAGGCAGGCAGG + Intergenic
908859444 1:68466450-68466472 CTACAGAGGCTGAGGCAGGAGGG + Intergenic
909780921 1:79545969-79545991 GTGCAGAAACTGAGGGAAGGAGG - Intergenic
910484667 1:87700169-87700191 CTTCAGAAGCTGAGGCAAGAGGG + Intergenic
911091774 1:94022889-94022911 GTGCAGTTCCTGAGGGAGGCTGG + Intronic
911743237 1:101410780-101410802 GCACAGAAGCTGTGGCAGGTGGG + Intergenic
912459934 1:109823856-109823878 GCGCAGAAGCGGAGGAAGGAAGG + Intergenic
912493866 1:110078753-110078775 GGGCAGATGGAGAGGCAGGCAGG + Intergenic
912679671 1:111721126-111721148 AGGCAGACGGTGAGGCAGGCGGG + Intronic
913076945 1:115348402-115348424 AGGAAGTAGCTGAGGCAGGCTGG - Intergenic
914517229 1:148384238-148384260 ATGGAGGAGCTGAGGCAAGCAGG + Intergenic
914827660 1:151146915-151146937 ATACAGAAGCAGAGACAGGCTGG + Intergenic
915367786 1:155325170-155325192 GTGCAGAAGGTGAAGGTGGCTGG + Exonic
915458099 1:156053765-156053787 GCGCAGAAGCCGAGCCGGGCCGG - Exonic
915493036 1:156262162-156262184 GTGAAAAAGCTCAGCCAGGCTGG - Intronic
915915158 1:159936551-159936573 GTGCAGGATCTGAGGCTGGCAGG - Intronic
917620176 1:176787476-176787498 TTTGAGAAGCTGAGGCAGACAGG - Intronic
918107532 1:181426999-181427021 GTGAAGAAGCTGAGGTGGGAAGG - Intronic
918422066 1:184374230-184374252 CTCAAGAAGCTGAGGCAGGCCGG + Intergenic
918438720 1:184544276-184544298 GTTTAGAAGTTGAGGCAGGGTGG + Intronic
919408062 1:197209193-197209215 GCACAGAAGCTGAGGCATGTGGG - Intergenic
919523451 1:198618124-198618146 CTCCAGAGACTGAGGCAGGCAGG + Intergenic
919588185 1:199465267-199465289 GTGCAGAAACTTAGCAAGGCTGG + Intergenic
919640123 1:200038840-200038862 GTGAAGAGGTTGGGGCAGGCCGG + Intronic
919842569 1:201619826-201619848 CTGGAGAAGCAGAGGCAAGCTGG + Intergenic
920436617 1:205950933-205950955 GTGCTGAAGCCGAGGCAAGAAGG - Intergenic
920846335 1:209595912-209595934 CTGCAGACTCTGACGCAGGCTGG + Intronic
920869382 1:209781394-209781416 GTGCTGCAGCTTACGCAGGCAGG - Exonic
921326100 1:213987686-213987708 GTCCCGAAGCTGTGGCAGGGTGG + Intronic
922079074 1:222277063-222277085 GTGGGGATGCTGAGGCAGGAGGG + Intergenic
922221727 1:223613499-223613521 CAGCAGAAACTGAGCCAGGCAGG + Intronic
922681619 1:227603107-227603129 GTGGAGATGCTGAGGCAGCCAGG - Intronic
922785957 1:228282332-228282354 CTGCAGCAGCTGGGGGAGGCAGG - Intronic
923207361 1:231772055-231772077 CTCCAGAGGCTGAGGCAGGGAGG - Intronic
924081491 1:240403389-240403411 TTTGGGAAGCTGAGGCAGGCAGG + Intronic
924323752 1:242875014-242875036 GGGCAGAAACTGAGGTAGGCTGG - Intergenic
1063384381 10:5606900-5606922 GTGAGGAAACTGAGGCATGCAGG + Intergenic
1064369028 10:14734997-14735019 GTGTGGCAGCTGATGCAGGCTGG - Intronic
1064609251 10:17080015-17080037 GAGCAGAAGCTGAGGCAGGAAGG - Intronic
1065133300 10:22643943-22643965 CTGCAGATGGTGGGGCAGGCTGG - Intronic
1065422665 10:25564250-25564272 GTGCAGAGCCTGAGGTCGGCAGG + Intronic
1067084165 10:43229435-43229457 GGGCAGGAGCAGAGGCAGGCTGG + Intronic
1068787215 10:60989696-60989718 GTGCTGAAGCAGAAGCAGGAAGG + Intronic
1070287208 10:75092786-75092808 GTGCAGAATCTGAGGCTGCAGGG - Intergenic
1071429658 10:85596705-85596727 GTGCAGCAGCTGAGGCACAGTGG + Intergenic
1071870604 10:89789972-89789994 GCACAGAAGCTGCGGCAGGTGGG - Intergenic
1072803555 10:98409833-98409855 TTTCAGAGGCTGAGGCAGGCGGG + Intronic
1073542132 10:104323112-104323134 GTGGAGTAGAAGAGGCAGGCTGG + Intronic
1074284615 10:112086397-112086419 CTGGAGAAGCTGAGGCAAGAAGG + Intergenic
1074517732 10:114186505-114186527 TTTGAGAGGCTGAGGCAGGCGGG - Intronic
1074912782 10:117926747-117926769 TTTGAGAGGCTGAGGCAGGCAGG + Intergenic
1075086457 10:119417318-119417340 TTTCAGACACTGAGGCAGGCTGG - Intronic
1075921987 10:126221139-126221161 TTTGGGAAGCTGAGGCAGGCAGG + Intronic
1076313987 10:129527918-129527940 GAGGAGAGACTGAGGCAGGCAGG - Intronic
1076316517 10:129545628-129545650 TTGCAAAAGCAGAGGGAGGCTGG - Intronic
1076375772 10:129983731-129983753 GCCCAGAAGCTGCAGCAGGCAGG + Intergenic
1076560205 10:131357830-131357852 GTGGAGCTGCTGAGACAGGCAGG - Intergenic
1076596409 10:131625335-131625357 CTGCAGAGGCTGAGGCACTCGGG - Intergenic
1076818171 10:132924761-132924783 GTGCTGCAGCAGGGGCAGGCAGG + Exonic
1077228416 11:1448242-1448264 CTGCAGGAGCTGAGGAGGGCAGG + Intronic
1077250884 11:1560179-1560201 GTGCAGAGCCTGAGGCAGCTGGG + Intronic
1077363930 11:2153920-2153942 ATCCAGCAGCTGAGGCAGGCAGG + Intronic
1077729363 11:4713173-4713195 GTGAAGCAGCTGAGGAAGTCAGG - Intronic
1078062746 11:8059056-8059078 GTGCAGACGGTGAGGTAGGGTGG + Intronic
1078157565 11:8811839-8811861 CTTCAGAGGCTGAGGCAGGAGGG - Intronic
1078172491 11:8939045-8939067 TTGGAGAGGCTGAGGCAGGCGGG - Intergenic
1078195970 11:9137446-9137468 GTGCAGAAGCTGAGGCAGGCAGG + Intronic
1078243053 11:9547946-9547968 GCTCAGAGGCTGAGGCAGGAGGG + Intergenic
1078608189 11:12796076-12796098 GTGCAGAAACTGGGCCAGGAGGG + Intronic
1078891476 11:15561824-15561846 ATGCAGAAGCTGACTCAAGCGGG - Intergenic
1079806124 11:24932768-24932790 ACACAGAAGCTGCGGCAGGCAGG - Intronic
1080463646 11:32477126-32477148 TTGAAGAAGCAGAGTCAGGCCGG + Intergenic
1081612862 11:44573527-44573549 GTGGAGTAACTGAGGCAGGGAGG + Intronic
1081724809 11:45320869-45320891 CTGGAGAAGCTGAGGCAGCATGG + Intergenic
1081828052 11:46077733-46077755 CTGAAGAATCTGAGGTAGGCAGG - Intronic
1082809178 11:57468197-57468219 ATGGAGATGCTGAGGCAGGAAGG - Intronic
1083303124 11:61749091-61749113 GGGCAGAGGCTGGGGCAGGAAGG - Intergenic
1083308845 11:61774409-61774431 CTTGGGAAGCTGAGGCAGGCAGG + Intronic
1083738899 11:64697379-64697401 TTCCAGATGCTGGGGCAGGCTGG - Intronic
1084054671 11:66624758-66624780 GTGAAGAAGCTGCAGCAGACTGG - Exonic
1084294677 11:68204430-68204452 GTACAGAAGGTGAAGCAGACTGG + Intronic
1084323004 11:68384059-68384081 CTGGGGAAACTGAGGCAGGCAGG - Intronic
1084409234 11:68996910-68996932 GTGCAGAGGCCCTGGCAGGCGGG - Intergenic
1084626521 11:70312084-70312106 TTTGAGAAGCTGAGGCAGGCAGG - Intronic
1084950399 11:72662138-72662160 GAGGAGAAGCTGGGGCAGGGAGG + Intronic
1084969711 11:72764500-72764522 GTGAAGAAACTGAGGCAGGCCGG + Intronic
1088120539 11:106363783-106363805 ATGAAGAAACTGAGGCAGGGAGG - Intergenic
1089255168 11:117190305-117190327 GAGCTGAGGCTGCGGCAGGCAGG - Intronic
1089730051 11:120513687-120513709 GTGGAGCTGGTGAGGCAGGCGGG - Intronic
1090068824 11:123526330-123526352 GTGCAGCAGCTGGGGGAGCCAGG - Intronic
1090082398 11:123622800-123622822 GTGGAGCAGCTGAGGAGGGCAGG + Intronic
1090394895 11:126412414-126412436 TTGCTGAAGCGGAGGAAGGCGGG + Intronic
1091400538 12:178112-178134 GTGCAGACGGGCAGGCAGGCAGG - Exonic
1092247546 12:6872116-6872138 GAACAGAGGTTGAGGCAGGCTGG + Intronic
1092260697 12:6951930-6951952 GTGCAGGAGTAGAGGCAGGAGGG - Intronic
1092294614 12:7188668-7188690 GTGCATGAGCGGAGGCAGGCAGG - Intronic
1092439830 12:8490545-8490567 TTTGGGAAGCTGAGGCAGGCAGG + Intergenic
1092624436 12:10311581-10311603 GTTTTGAAGCTGAAGCAGGCTGG - Intergenic
1092726192 12:11487916-11487938 GTGAAAAGGCAGAGGCAGGCTGG - Intronic
1093047171 12:14460711-14460733 CTGTAGAAGCTGAGGCTGGGAGG - Exonic
1094363696 12:29657861-29657883 TTGGAGAGGCTGAGGCAGGTGGG + Intronic
1094687536 12:32732986-32733008 CTGGGGAGGCTGAGGCAGGCAGG + Intronic
1095454652 12:42370272-42370294 CTGCAAATGCTGAGGCAGGTAGG + Intronic
1095477040 12:42596173-42596195 GGGCAGAGGCTGAGGCATGTAGG + Intergenic
1095680785 12:44973029-44973051 ATGCAGATGGTAAGGCAGGCTGG - Intergenic
1096113418 12:49041641-49041663 GTGCAGAAGGTGAGTGGGGCTGG - Exonic
1096561412 12:52438400-52438422 GTGGAAGATCTGAGGCAGGCTGG - Intergenic
1096742046 12:53700784-53700806 GTACTGAAGCTGAAGCTGGCTGG - Intergenic
1097166979 12:57091246-57091268 GTGCAGCAGCTGTGTGAGGCGGG + Exonic
1097472393 12:60010719-60010741 GTGCACAATCAGAGGCAGGGTGG - Intergenic
1099148711 12:79081041-79081063 GTGCAGAGGCTGAGGGTGGTGGG + Intronic
1099234177 12:80062543-80062565 GTGCAGATGCTGAGCCAAGTAGG - Intergenic
1099458282 12:82891548-82891570 TTTCGGAGGCTGAGGCAGGCGGG - Intronic
1099972280 12:89512646-89512668 CTCCAGAGGCTGAGGGAGGCGGG + Intronic
1100461652 12:94805546-94805568 GTGCATAAGCTGGAGCTGGCTGG - Intergenic
1101104325 12:101424866-101424888 TTTGAGAGGCTGAGGCAGGCGGG + Intergenic
1101215489 12:102577740-102577762 GTGCAGGAGGTGAGGCACACAGG - Intergenic
1101467021 12:104958752-104958774 GTGCAGGAGCCGAGACGGGCAGG + Intergenic
1101727025 12:107396160-107396182 GTGGAGAGGCAGAGGAAGGCTGG - Intronic
1101754255 12:107608423-107608445 AGGCAGAAGCTGAGGTAAGCAGG - Intronic
1101814253 12:108133749-108133771 TTACAGAAGGTGAGGGAGGCGGG - Intronic
1102581344 12:113890238-113890260 CTGCCGGAGCTGAGCCAGGCTGG + Intronic
1102670486 12:114614838-114614860 TTGGAGATGCTGAGCCAGGCTGG - Intergenic
1103985234 12:124762551-124762573 GTGCAGAAGGTGTGTCAGTCAGG + Intergenic
1104971747 12:132533944-132533966 GTGCAGAACCTGAGGCGGGTGGG + Intronic
1107016938 13:35714917-35714939 GGGGGGAAGCTGAGGCAGCCTGG + Intergenic
1108008067 13:45972832-45972854 GGGCAGAAGCTGAAGCAGCAAGG - Intronic
1110167041 13:72455317-72455339 TTTGAGAGGCTGAGGCAGGCAGG - Intergenic
1110295217 13:73856230-73856252 TAGCAGAAGCTGTGGCTGGCGGG - Intronic
1111113456 13:83745819-83745841 GTGCAGTAGCTGATGCAGGCTGG - Intergenic
1111379797 13:87434413-87434435 CTCCAGAGGCTGAGGCAGGGAGG - Intergenic
1112029912 13:95447618-95447640 GTGAAGGAGCTGAAGCAGGGAGG - Intronic
1112091823 13:96090944-96090966 GTGCAGGAGCTGGTGCAGGAGGG - Exonic
1112845048 13:103631699-103631721 GTTGAGAGGCTGAGGCAGGAGGG + Intergenic
1113037039 13:106062003-106062025 GAGCACAGCCTGAGGCAGGCAGG - Intergenic
1113087242 13:106581181-106581203 GTGAGGGAACTGAGGCAGGCAGG + Intergenic
1113149014 13:107241537-107241559 GGGCAGAAGCTGAGGCACAGTGG - Intronic
1113240897 13:108335785-108335807 CTGCTCTAGCTGAGGCAGGCTGG + Intergenic
1113475332 13:110576475-110576497 CTCCAGAGGCTGAGGCAGGAGGG + Intergenic
1113639521 13:111947219-111947241 GTCTACAAGCTGAGGCATGCCGG + Intergenic
1113884612 13:113652066-113652088 GTGCAGAGCAGGAGGCAGGCCGG - Intronic
1117019081 14:51550632-51550654 GTGCAGAGGCAGAGGAAGGGCGG + Intronic
1118029558 14:61807247-61807269 CTCGGGAAGCTGAGGCAGGCAGG - Intergenic
1118315444 14:64723094-64723116 TTGCAGGTGCAGAGGCAGGCAGG - Intronic
1118944219 14:70368651-70368673 GTGCAGAAGCTCAGGAAGCTGGG + Exonic
1118994495 14:70823519-70823541 AAGCAGAAGCTGAGACAGGGAGG - Intergenic
1119002742 14:70897768-70897790 GTACAGAAGCAGAGGGAGGAAGG + Intergenic
1119185762 14:72641408-72641430 GGACAGAAACTGAGGCTGGCAGG - Intronic
1119622192 14:76139375-76139397 GGGCAATGGCTGAGGCAGGCAGG + Intergenic
1121030551 14:90654873-90654895 GTGCAGAAGCTGGGGCATTCTGG - Intronic
1121281679 14:92703534-92703556 GGGGAGAAGGTGAGGAAGGCTGG + Intergenic
1121487622 14:94330870-94330892 GCACAGAAGCTGAGCCAGGAGGG + Intergenic
1121487630 14:94330924-94330946 GCACAGAAGCTGAGCCAGGAGGG + Intergenic
1121584096 14:95051112-95051134 GTGCAGAGACAGAGCCAGGCAGG - Intergenic
1122210483 14:100170656-100170678 TTTGAGAGGCTGAGGCAGGCAGG - Intergenic
1122473200 14:101986260-101986282 GGGCAGAAGCTGAAGCAGGATGG + Exonic
1122481266 14:102049022-102049044 GTGGAAAAGCAGGGGCAGGCGGG + Intronic
1122900375 14:104779877-104779899 GTCCCAAAGCTGAGGCTGGCTGG - Intronic
1123441551 15:20295385-20295407 TCGCGGAAACTGAGGCAGGCAGG - Intergenic
1123945712 15:25237901-25237923 GTGCAGGAGCTGAGGGTGCCAGG - Intergenic
1124158755 15:27250814-27250836 GTGCAGAGGCTGAGGCCACCAGG + Intronic
1125722977 15:41853944-41853966 GAGAAGAGGCTGAAGCAGGCTGG + Intronic
1125819916 15:42620371-42620393 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
1125824171 15:42661550-42661572 CTCCAGAGGCTGAGGCAGGAGGG - Intronic
1127203381 15:56684033-56684055 GTGCAGAAGCTGAGGCAAGAAGG + Intronic
1127322775 15:57863662-57863684 GAGCGGAAGTAGAGGCAGGCAGG + Intergenic
1127758699 15:62117158-62117180 CTCGGGAAGCTGAGGCAGGCGGG - Intergenic
1128796468 15:70470120-70470142 ATGCAGGAGCTGAGGGAGGATGG - Intergenic
1129081102 15:73041864-73041886 TTGGGGAGGCTGAGGCAGGCAGG - Intergenic
1129999023 15:80031429-80031451 GTGAAGACTCTGAGGCAGGGAGG + Intergenic
1130323900 15:82863267-82863289 TTGCAGATGGTAAGGCAGGCAGG - Intronic
1130434409 15:83883413-83883435 TTTGGGAAGCTGAGGCAGGCAGG - Intronic
1130858240 15:87861217-87861239 GTACAGAAGCTTAGGGAGGGGGG + Intronic
1131019483 15:89086520-89086542 GTGGGGAGGCTGAGGCAGGAGGG - Intergenic
1132150080 15:99452929-99452951 ATGCAGAAGCGGAGTCCGGCTGG + Intergenic
1132200201 15:99947801-99947823 TTTGGGAAGCTGAGGCAGGCGGG - Intergenic
1132414516 15:101610803-101610825 GTGCAGAGGGTGACGCAGGAAGG - Intergenic
1132716665 16:1293597-1293619 TTTGGGAAGCTGAGGCAGGCAGG + Intergenic
1132743052 16:1425491-1425513 TTTGGGAAGCTGAGGCAGGCAGG - Intergenic
1133024564 16:2982462-2982484 ACGCAGAAACTGGGGCAGGCAGG - Intergenic
1133437596 16:5793262-5793284 GGGGAGAAGCAGAGGCAGCCAGG - Intergenic
1134584018 16:15395804-15395826 GTGCAGTAGCTGCTGGAGGCTGG + Exonic
1136030008 16:27495907-27495929 GTGCAGCACCTGCGGCAGGAGGG + Intronic
1136099161 16:27980584-27980606 ATGAAGAAACTGAGGCTGGCTGG + Intronic
1136838026 16:33516405-33516427 TAGCGGAAACTGAGGCAGGCAGG + Intergenic
1139605361 16:68014330-68014352 GTGGAGAAACTCAGGTAGGCTGG - Intronic
1139735613 16:68985465-68985487 TTCGAGAGGCTGAGGCAGGCAGG + Intronic
1140863237 16:79037601-79037623 TCCCAGAAGCTGAGGCAGGATGG + Intronic
1141367576 16:83457497-83457519 GTGCTGAAGCTGGGGCTGGGTGG - Intronic
1141528894 16:84632189-84632211 TTGCAGAAACTGGGGAAGGCTGG - Intergenic
1142107806 16:88315671-88315693 GTGCAGAAGGTGGGGGAGGGAGG + Intergenic
1203148202 16_KI270728v1_random:1816685-1816707 TAGCGGAAACTGAGGCAGGCAGG + Intergenic
1142740688 17:1930298-1930320 CTGCAGAAGCAGTGGCTGGCGGG + Intergenic
1143020586 17:3915448-3915470 GTGCAGAATCAGAGGCAGCGTGG - Intronic
1143238971 17:5427772-5427794 GGGCAGAGGCAGAGGGAGGCTGG + Intronic
1143321599 17:6072003-6072025 GCGGAGAAGATGAGGCAGTCAGG - Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144311241 17:14016108-14016130 GTGAAGTGGGTGAGGCAGGCAGG - Intergenic
1144645643 17:16971865-16971887 GTGCAGGAGCTTGGGGAGGCTGG + Intronic
1144810042 17:17993187-17993209 ATGAAGAAGCTGAGGAGGGCTGG + Intronic
1144837662 17:18165476-18165498 GACCAGAAGCAGAGGCTGGCAGG - Intronic
1146022940 17:29294024-29294046 GTGCTGAGGCTGTGGCTGGCCGG + Exonic
1146077568 17:29745400-29745422 TTTCAGAGGCCGAGGCAGGCGGG - Intronic
1146376298 17:32296960-32296982 CTAGAGAAGCTGAGGCTGGCAGG - Intronic
1146410967 17:32584592-32584614 CTCCAAAGGCTGAGGCAGGCAGG - Intronic
1146561080 17:33871201-33871223 GTTCAGAAGCTGAATGAGGCTGG + Intronic
1146950133 17:36899962-36899984 GTGCAGGAGCTGAGGCTGACAGG + Intergenic
1146957304 17:36942986-36943008 GTGCAGAGGCCCGGGCAGGCTGG - Exonic
1147253901 17:39170263-39170285 TTGCAGAAGCTGATGCATCCTGG + Intergenic
1147596841 17:41723226-41723248 GTGCAAAAGCTGTGGCTGCCAGG - Exonic
1147659165 17:42107981-42108003 GTGGTGAAGCTGAGTGAGGCTGG - Exonic
1147818823 17:43229604-43229626 TTCCAGAGGCTGAGGCAGGAGGG + Intergenic
1147832106 17:43304306-43304328 TTCCAGAGGCTGAGGCAGGAGGG + Intergenic
1147833664 17:43314988-43315010 ATGCAGAAGCTGAGGCAGAGAGG - Intergenic
1147920699 17:43915217-43915239 GTGCAGAATCTCTGGGAGGCAGG + Intergenic
1148094747 17:45044447-45044469 TTTCGGAGGCTGAGGCAGGCGGG + Intronic
1148539471 17:48468438-48468460 GCACAGAAGCTGAGGCATGTTGG - Intergenic
1148582579 17:48753896-48753918 GAGAGGAAGATGAGGCAGGCGGG - Intergenic
1148733216 17:49850480-49850502 GTGTGGAAACTGAGGCAGGCCGG + Intergenic
1149021981 17:51978945-51978967 GTGAAGTAGCTGTGGCATGCAGG - Intronic
1149032955 17:52104444-52104466 TTTGGGAAGCTGAGGCAGGCGGG - Intronic
1151479859 17:74363591-74363613 ATGCAGAGGCTGAAGGAGGCTGG - Intergenic
1151557983 17:74856297-74856319 GTGCAGATCCTGGGGGAGGCGGG - Intronic
1151870353 17:76832661-76832683 GTGCAGAAGATGATGGAGGAAGG - Intergenic
1152113936 17:78373277-78373299 GTAAAGATGCTGAGGAAGGCCGG + Intergenic
1152132170 17:78484294-78484316 GTGAAGAAGCCCAGGAAGGCCGG - Intronic
1152223481 17:79081959-79081981 GAGCGGATGCTGGGGCAGGCTGG + Exonic
1152395558 17:80030761-80030783 GGGCAGAGGCAGAGGCAGGCAGG + Intronic
1152736320 17:81999064-81999086 GTGAGGAAGCTGAGGAAGTCAGG - Intronic
1152741930 17:82022265-82022287 GTGGAGAAACTGAGGCACGGGGG - Intronic
1152756526 17:82089344-82089366 GTGGAGCAGCTGAGGAAGGAGGG - Exonic
1153295900 18:3546178-3546200 GTTGGGAAGCTGAGGCAAGCAGG + Intronic
1153300151 18:3585184-3585206 GGGAAGAACCTGAGGCTGGCTGG - Intronic
1153342410 18:3989027-3989049 GTGCAGCAGTGGAGGCAGGAGGG - Intronic
1153468639 18:5417468-5417490 GTACAGCAGCTGCTGCAGGCCGG + Intronic
1154297821 18:13165685-13165707 GCACAGAAGCCGCGGCAGGCGGG + Intergenic
1155043577 18:22085095-22085117 GGGCAGAAGCAAAGGCAGGAGGG + Intergenic
1155465793 18:26133906-26133928 CTGCTGCAGCTGAGGCAAGCGGG - Exonic
1156238678 18:35229766-35229788 ACTCAGAAGCTGAGGCAGGGGGG + Intergenic
1156268007 18:35505541-35505563 GGGCAGACGCTGAGCCAGGCTGG - Intergenic
1157006490 18:43589942-43589964 GGCCAGAAGCTGTGGCAGCCAGG - Intergenic
1157282392 18:46354613-46354635 GTGCTGATGCTGTGGCTGGCAGG - Intronic
1157449225 18:47772895-47772917 GTGCAGAGGCTGAAGCAGGAAGG + Intergenic
1157898014 18:51486834-51486856 GGGCAGAGGGTGAGGCAGACTGG + Intergenic
1158665483 18:59429025-59429047 GTGAAGCTGCAGAGGCAGGCGGG + Intergenic
1159067695 18:63588338-63588360 GTGGAGAGGCAGAGACAGGCAGG + Intronic
1159687686 18:71443813-71443835 CTGCAGAAGCTGGGAAAGGCAGG - Intergenic
1160216361 18:76935869-76935891 GTGCGGATGCTGGAGCAGGCGGG + Intronic
1160591248 18:79945753-79945775 GTGCAGAGGCTGAGGCCTGGAGG - Intronic
1160696314 19:486300-486322 GTGCAGAGGCTGAGTCCGGAGGG - Intergenic
1160939837 19:1615068-1615090 GAGGGGATGCTGAGGCAGGCAGG + Intronic
1161243228 19:3234580-3234602 GTGCAGAAGCTGAGAAACCCTGG + Intronic
1161316410 19:3619568-3619590 GAGCTGAAGCAGAGGCAGGCTGG + Intronic
1161686984 19:5707797-5707819 GTGCTGCAGATGATGCAGGCTGG - Exonic
1161823666 19:6547287-6547309 GATGAGAAGCTGAGGCAGGAAGG + Intergenic
1162712126 19:12603242-12603264 GTTGGGAGGCTGAGGCAGGCAGG + Intronic
1162736939 19:12752033-12752055 GTGCACAGGCTGGGGCAGGGGGG + Intronic
1162931270 19:13959137-13959159 GGGCAGAAGCTGGGGAGGGCAGG - Exonic
1162992847 19:14314596-14314618 GTGCAGAAGGGGAGGCTGGGTGG + Intergenic
1163002753 19:14379024-14379046 CTGCAGAATCTCAGGGAGGCAGG - Intergenic
1163013718 19:14441059-14441081 GGGCAGAGGCTGGGCCAGGCTGG + Intronic
1164616436 19:29669347-29669369 ATTCAGTAGCTGAGGCAGGTGGG - Intronic
1165197151 19:34113180-34113202 TTTGAGAGGCTGAGGCAGGCGGG - Intergenic
1165256675 19:34580459-34580481 GTGGAGGAGCTGGGGCAGGCAGG + Intergenic
1165259440 19:34599275-34599297 GTGGAGGAGTTGGGGCAGGCAGG + Intronic
1165265909 19:34663930-34663952 GTGGAGGAGCTGGGGCAGGCAGG - Intronic
1165273544 19:34730947-34730969 GTGGAGGAGCTGGGGCAGGCAGG - Intergenic
1165308123 19:35014379-35014401 GGGAGGAAGGTGAGGCAGGCGGG + Exonic
1165472803 19:36013305-36013327 GTGCAGAGGGTGAAGGAGGCAGG - Intronic
1165789734 19:38484082-38484104 GTTGGGAGGCTGAGGCAGGCAGG + Intronic
1166140570 19:40803093-40803115 GTGAAGATGCTGAGCCAGGGAGG - Intronic
1167241619 19:48347043-48347065 GGACATAAGATGAGGCAGGCAGG - Intronic
1167410415 19:49340804-49340826 GTGCAGGAGCAGAGCCAGGTGGG - Exonic
1167642136 19:50687775-50687797 GGGGAGAAACTGAGGCAGGGAGG - Intronic
1167714098 19:51129932-51129954 GGGCAGAAGCTGGGGGAGGCTGG - Intronic
1167785492 19:51632457-51632479 GTGCAGCAGGTGAGGGAGGCTGG - Intronic
1167792871 19:51691835-51691857 GTCCAGAAGCTGGAGAAGGCTGG + Intergenic
1168358034 19:55714432-55714454 CTGCACAAGCTCAGGCAGTCAGG + Intronic
1168639281 19:58020073-58020095 GTCCAGGAGCTGGGCCAGGCTGG - Intergenic
1168670066 19:58234277-58234299 AGGCAGAAGCTGAGGCAGATTGG - Intronic
925142459 2:1559414-1559436 GTTCAGGAGATGAGGAAGGCAGG - Intergenic
925274763 2:2640986-2641008 GAGCAGAAGCAGAGGCAGAAGGG + Intergenic
925292345 2:2756154-2756176 AGGCAGAAGCTGAGGGTGGCAGG - Intergenic
925296967 2:2783662-2783684 GTAGAGCAGCTGAGACAGGCAGG - Intergenic
925305708 2:2846840-2846862 GTGCAGCAGCCCAGGGAGGCAGG + Intergenic
925669389 2:6294562-6294584 CTGTAGAGGCTGAGCCAGGCTGG - Intergenic
925719906 2:6817253-6817275 GTCCACCAGCTGGGGCAGGCAGG + Intergenic
925842903 2:8009194-8009216 GGGCTGGAGCTGAGTCAGGCCGG + Intergenic
926647950 2:15310387-15310409 TTGCAGGAGCTGAGGCTGACTGG - Intronic
926776928 2:16432167-16432189 GTGGGGAAGATGAGGCAGACTGG + Intergenic
927478533 2:23432729-23432751 GTGCAGGTGCTGAGGCAGGAGGG + Intronic
928361740 2:30668285-30668307 TTTGGGAAGCTGAGGCAGGCAGG - Intergenic
928916095 2:36472538-36472560 GTGCAGAAGCTTAAGCAGGAGGG - Intronic
929456861 2:42072404-42072426 GTACAGCAGATGAGGCAGGCTGG + Intergenic
929924670 2:46198306-46198328 ATGGAAAAGCTGAGGCAGGAAGG - Intergenic
931354897 2:61528165-61528187 TTGGGGAGGCTGAGGCAGGCGGG - Intronic
931625311 2:64251797-64251819 GCTGAGAAGCTGAGCCAGGCTGG - Intergenic
932196147 2:69785801-69785823 GTCCAGAGGCTGAGGAAGGAGGG - Intronic
932635728 2:73386184-73386206 CTGGAGAAGGTGAGGCGGGCCGG + Exonic
932883723 2:75528297-75528319 GCACAGAAGCTGTGGCAGTCAGG + Intronic
933861027 2:86467916-86467938 CTGGAGAAGCTGAGGCAGGGGGG + Intronic
934228299 2:90153980-90154002 GAGCAGAGGATGGGGCAGGCTGG - Intergenic
934228892 2:90159743-90159765 GAGCAGAGGATGGGGCAGGCTGG - Intergenic
934704104 2:96464309-96464331 GTGTAGCAGCTGAGGCCGCCAGG + Intergenic
935583248 2:104777722-104777744 GTGCCAGTGCTGAGGCAGGCAGG - Intergenic
936005328 2:108882044-108882066 CTCGAGAAGCTGAGGCAGGAGGG + Intronic
936067533 2:109343703-109343725 GGGCAGAAGCAGGGGCAGACTGG - Intronic
936398168 2:112145377-112145399 CTCCAGAGGCTGAGGCAGGAGGG - Intronic
936894571 2:117412987-117413009 GTACAGAAGCTGAGGCCGGCAGG + Intergenic
936913210 2:117613779-117613801 ATACAGCACCTGAGGCAGGCAGG - Intergenic
937021999 2:118665666-118665688 GTGCAGAAGCTGGGGAAGTCTGG - Intergenic
937085779 2:119170716-119170738 GTGCAGGAGCAAGGGCAGGCCGG + Intergenic
937997751 2:127708021-127708043 GAGCACAAGCTGGGGCATGCGGG + Intronic
938132727 2:128731495-128731517 GTGAAGAAGGTGAGGCTGACAGG + Intergenic
938249898 2:129806508-129806530 GTGGGGAAGCTGAAGGAGGCTGG - Intergenic
938411507 2:131068618-131068640 ATCCAGAAGCTGGGACAGGCAGG - Intronic
941800113 2:169650404-169650426 TTGCAGAAGCTGAGGCTGAATGG - Exonic
942303681 2:174586173-174586195 GAGCAGCAGCTGAGGCGGGGTGG + Intronic
942446272 2:176080753-176080775 GTGTAGAAGCTGGGGTCGGCTGG + Exonic
942841879 2:180371804-180371826 GTGCAGAAACTCAGAGAGGCAGG - Intergenic
943228691 2:185215518-185215540 GTCAAGAAACTGAGGCAGGGAGG - Intergenic
944550673 2:200841828-200841850 CTCCAGAGGCTGAGGCAGGAAGG + Intergenic
944580412 2:201127298-201127320 GTCCAGCAGCTCAGGCAGGGTGG + Intronic
945425410 2:209694638-209694660 GTGCAGATGCTGAGGTTGCCAGG + Exonic
945739300 2:213641395-213641417 GCACAGAAGCTGTGGCAGACAGG - Intronic
945783315 2:214203853-214203875 GCACAGAAGCTGTGGCAGGTGGG + Intronic
946226153 2:218265143-218265165 GTGCAGCTGCTGTGGGAGGCAGG - Exonic
946339767 2:219059779-219059801 GTGCAGAAGGTTAGGCCGGGAGG + Intronic
946783591 2:223219129-223219151 GGGCAGAAGCTGGGGAAGGGAGG - Intergenic
947206636 2:227667066-227667088 GTCCAGAAGCAGAGCCAGGCCGG - Intergenic
947460449 2:230299631-230299653 GTGCAGAAGCCATGGCAGGCAGG + Intronic
947590979 2:231385623-231385645 GAGCAAAGGTTGAGGCAGGCTGG + Intergenic
947858687 2:233342864-233342886 CTTCAGAAGCTGAGGTAGGAGGG - Intronic
948052922 2:234991988-234992010 GTCCTGAAGCTGAGCCCGGCAGG - Intronic
948399192 2:237670762-237670784 ACGCAGAAACTGAGGCAGGCAGG - Intronic
948884106 2:240874464-240874486 GTCCAGATTCTGAGCCAGGCCGG + Intronic
1168902466 20:1376650-1376672 ATGAAGAAACTGAGGCAGACAGG + Intronic
1169329917 20:4708279-4708301 ATGCATCAGCTGAAGCAGGCAGG - Intergenic
1170536041 20:17341941-17341963 GAACAGCAGCTGAAGCAGGCTGG - Intronic
1170842222 20:19933295-19933317 GTGCAGGAGGAGAGGCAGGCAGG - Intronic
1170924157 20:20707739-20707761 AAGCAGAAGCTGAGGCTGGCTGG - Intronic
1171035002 20:21707103-21707125 GGGCAGAACCTGGGGCGGGCAGG + Intronic
1171091615 20:22290729-22290751 GAGCAGATGCTGTGGGAGGCTGG + Intergenic
1171094269 20:22316535-22316557 GGGGACAAGCTGAGCCAGGCAGG - Intergenic
1171376363 20:24696621-24696643 GGGCATGAGCTGAGACAGGCTGG + Intergenic
1172260044 20:33556197-33556219 GGGGAGAAGAGGAGGCAGGCAGG - Intronic
1173189199 20:40863277-40863299 GTTGAGAAGCTGAGGCCTGCAGG + Intergenic
1173224288 20:41152891-41152913 GTGCAAAGGCTGAGGCAGGAAGG + Intronic
1174163829 20:48570667-48570689 GTCCAGAAGCAGAGTCAAGCGGG - Intergenic
1174244240 20:49164406-49164428 CTCCAGAGGCTGAGGCAGGAGGG - Intronic
1174340537 20:49892453-49892475 GAGGAGAAGCTGAGCCTGGCTGG - Intergenic
1174368326 20:50069727-50069749 CTAAAGAAGCTCAGGCAGGCAGG + Intergenic
1174427044 20:50439219-50439241 GAGCAGGAGCTGACACAGGCGGG - Intergenic
1174857670 20:54062392-54062414 GTGTGGAAACTGAGGCACGCAGG + Intronic
1174998918 20:55604482-55604504 GTGCACAAAAGGAGGCAGGCAGG - Intergenic
1175453611 20:59092389-59092411 GTGCAGAAGGTGATACAGCCTGG - Intergenic
1175611309 20:60353448-60353470 GAGCAGCAAATGAGGCAGGCAGG - Intergenic
1176021623 20:62965149-62965171 GTGCGGAAGCTCATGCAGGTAGG + Exonic
1176668122 21:9706035-9706057 GAACAGACGCTGAGGAAGGCGGG - Intergenic
1176844985 21:13869790-13869812 GTGCAGGAGCTGGGGCAGCCGGG + Intergenic
1178470097 21:32884804-32884826 GAGCAGATGCTGGGACAGGCAGG + Intergenic
1178830722 21:36054313-36054335 GAGCAGAAGCTTAGGCATGAAGG - Intronic
1179261201 21:39759568-39759590 CTGAAAAAGCTGAGGCAGGCTGG + Intronic
1179461415 21:41537980-41538002 CTGCAGAAGCAGAGACAGACGGG - Intergenic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1179586607 21:42377399-42377421 GTGCAGACGCTGGGAAAGGCAGG + Intronic
1179929426 21:44557599-44557621 CTGGAGACGCTGAGGCTGGCAGG + Intronic
1179934075 21:44591409-44591431 GAGCAGAGGCTGTAGCAGGCAGG + Exonic
1179939326 21:44628006-44628028 GAGGAGAAGCTGTAGCAGGCCGG - Exonic
1179940810 21:44638129-44638151 GAGCAGAGGCTGTAGCAGGCAGG - Exonic
1180175021 21:46083141-46083163 GTGCAGATGTGGTGGCAGGCGGG - Intergenic
1180215055 21:46318434-46318456 GGGCAGCAGCTGAGGCAGAGGGG + Intronic
1180701115 22:17781857-17781879 CTGCAGAAGCTCTGGGAGGCTGG + Intergenic
1180931094 22:19592354-19592376 CTGTGGAAGCTGAGGCAGGAGGG - Intergenic
1181027145 22:20132749-20132771 GTGAAGAAGTTGAGGCTGGAGGG - Intronic
1181048572 22:20228068-20228090 ATGCAGAAGCCGAGCCAGGCTGG + Intergenic
1181404395 22:22672447-22672469 GTGCAGGAGGTGGGGCAGGGAGG + Intergenic
1181739802 22:24911810-24911832 TTTGAGAGGCTGAGGCAGGCAGG + Intronic
1181781390 22:25196118-25196140 GTGCAAAAGGAGACGCAGGCTGG - Exonic
1182070922 22:27463058-27463080 CAGCAGAGGCTGAGGCAGGGAGG + Intergenic
1182280237 22:29214247-29214269 GTGCAGATGCTGCGGGAGCCAGG + Intronic
1182298374 22:29324180-29324202 TTTGGGAAGCTGAGGCAGGCAGG + Intergenic
1182430288 22:30295132-30295154 GGGCAGATTCTGAGGCTGGCTGG - Intronic
1182701685 22:32245316-32245338 GTGCAGAGTCTGTGGCTGGCTGG - Intronic
1183044423 22:35208292-35208314 GTGCACAAGCTGTGGCAGCATGG - Intergenic
1183109394 22:35637796-35637818 GTGCAGAAGGTGCGTCAAGCTGG + Intronic
1183270959 22:36862375-36862397 GTGCAGGAGCTGGGTAAGGCTGG + Intronic
1183388904 22:37532371-37532393 TTCCAGAGGCTGAGGCAGGAGGG - Intergenic
1183524804 22:38316895-38316917 GGGGGGAAGCGGAGGCAGGCCGG + Intronic
1183650801 22:39152362-39152384 GTGCGGAAGGTGAGGCTGCCCGG - Exonic
1184477774 22:44730699-44730721 GTGCAGAGGGTCAGGCAGGGAGG - Intronic
1184626706 22:45739130-45739152 ATGAAGAAGGTGGGGCAGGCAGG + Intronic
1184948376 22:47820724-47820746 TTTGGGAAGCTGAGGCAGGCAGG - Intergenic
1185190364 22:49432646-49432668 GTGCTGAGGCAGGGGCAGGCGGG - Intronic
1185284037 22:49992249-49992271 GTGCAGAAGGTGAGGCCTTCGGG - Intergenic
1185372596 22:50467979-50468001 GTGCAGATGCTGGGGCGGGTGGG - Intronic
949904668 3:8849035-8849057 GTGCAGAAGCAGAGACAGGGAGG - Intronic
950418154 3:12880390-12880412 GTGCAGATGCAGAGGCAGCTGGG + Intergenic
950677049 3:14560605-14560627 GTGGAGAAGCTGTGTCAGTCAGG + Intergenic
950678646 3:14569715-14569737 GCGCAGAGGCTGAGGCTGGAAGG - Intergenic
950716515 3:14851319-14851341 ATGAGGAAACTGAGGCAGGCAGG + Intronic
950906162 3:16540425-16540447 GAGCAGGAGATGAGGCAGCCTGG + Intergenic
951748775 3:26010447-26010469 TTTGAGAGGCTGAGGCAGGCAGG - Intergenic
952357286 3:32596302-32596324 TTTCAGAGGCTGAGGCAGGCGGG - Intergenic
952887382 3:38020012-38020034 GTGGGGAAACTGAGGCTGGCTGG - Intronic
953094606 3:39762620-39762642 ATGCAGATGCTGAGGCTAGCAGG + Intergenic
953240830 3:41148002-41148024 TTTCAGAGGCTGAGGCAGGAGGG + Intergenic
953289671 3:41649018-41649040 CTTGGGAAGCTGAGGCAGGCGGG + Intronic
953727060 3:45408664-45408686 CTGCAGAAGCTCAAACAGGCTGG - Intronic
953762642 3:45702499-45702521 TTCCAGAAGCTGAGCAAGGCTGG - Intronic
954658562 3:52213294-52213316 GTGAGGAAGCTGAGCCACGCTGG - Intronic
955089002 3:55730891-55730913 GTGCAGATGTTGAGGCAGACTGG - Intronic
955450814 3:59064990-59065012 GCACAGAAGCTGTGGCAGGCAGG - Intergenic
955540648 3:59972587-59972609 GTTCAGAATCTGGGGCAGGATGG - Intronic
958081073 3:88747058-88747080 GAGCACAAGCTGAAGCAGGGTGG + Intergenic
958521092 3:95186523-95186545 CTGCAGAGGCTAAGGCAGGAGGG - Intergenic
958787476 3:98613350-98613372 GCACAGAAGCTGTGGCAGGCGGG - Intergenic
959626486 3:108457789-108457811 TTTCAGAGGCTGAGGCGGGCAGG + Intronic
959664640 3:108906962-108906984 GTGCAGAAACGGAGGCAAGGAGG - Intergenic
959679730 3:109081281-109081303 GTGCAGAAGTAGAAGCAAGCTGG + Intronic
959815198 3:110666406-110666428 GCGCAGAAGCTGTGGCAGGCAGG + Intergenic
960153220 3:114272037-114272059 GCACAGAAGCTGCAGCAGGCAGG - Intergenic
961324726 3:126103384-126103406 GAGCAGAAGCTGCGACAGTCAGG - Intergenic
961978132 3:131048245-131048267 GCACAGAAGCTGCGGCAGGTGGG - Intronic
966465555 3:180227754-180227776 ATTCAGGAGCTGAGGCAGCCAGG - Intergenic
966914969 3:184579624-184579646 GATGAGAAGCTGAGGCGGGCTGG + Intronic
968694067 4:2012879-2012901 TTTGAGAGGCTGAGGCAGGCGGG + Intronic
968978442 4:3834059-3834081 GTGGAGAAGGTGTGGGAGGCAGG - Intergenic
969463916 4:7343651-7343673 ATGGGGAAACTGAGGCAGGCAGG - Intronic
969584711 4:8085035-8085057 GTGGGGAAGCTGAGGCATGCGGG + Intronic
970372746 4:15424492-15424514 GTACAGAATCTGAGGCTGGTGGG - Intronic
970715642 4:18919265-18919287 GTGCATAAGCTGAGTTAGGATGG + Intergenic
970769916 4:19599676-19599698 GTGCAGATACTGAGTCATGCTGG + Intergenic
971375348 4:26051561-26051583 GTGCAGCAGCTGAGTGGGGCTGG + Intergenic
971457773 4:26860676-26860698 GTGGAGAGCCTGAGGGAGGCGGG + Intronic
971713464 4:30146705-30146727 TTTGAGAAGCTGAGGCAGGAGGG + Intergenic
972442192 4:39105387-39105409 TTTGAGAGGCTGAGGCAGGCAGG - Intronic
973828930 4:54738523-54738545 GTGCACAAGCAGAGGCTGGGAGG - Exonic
975370033 4:73574372-73574394 GTGGACCAGCTGAGGCAGGTGGG - Exonic
975534527 4:75435561-75435583 GCACAGAAGCTGCAGCAGGCAGG + Intergenic
975795591 4:78003370-78003392 CTTCAGAGGCTGAGGCAGGAGGG - Intergenic
976357572 4:84137131-84137153 GTGCAGAAGCAGAGGCAGGGTGG - Intergenic
978160657 4:105543686-105543708 GTGAAGAAACTGAGTCAGGGAGG + Intergenic
980087893 4:128410324-128410346 GCACAGAAGCTGAGGCAGGTGGG - Intergenic
980595786 4:134952713-134952735 GTGCAGAAGCAGACCCATGCTGG - Intergenic
981392210 4:144204385-144204407 GTTTAGAAGCTGACTCAGGCTGG - Intergenic
981490393 4:145333350-145333372 GTACAGATCCTGAGGCAAGCTGG + Intergenic
981515589 4:145605500-145605522 GGGTAAAGGCTGAGGCAGGCAGG - Intergenic
982130924 4:152227983-152228005 GTGTAGAAGCTGAGGGCTGCTGG - Intergenic
982960369 4:161827905-161827927 GCACAGAAGCTGCGGCAGGCAGG - Intronic
983253169 4:165368009-165368031 GTGCATAAGGAGAGTCAGGCAGG - Intronic
984942573 4:184946669-184946691 TTTGAGAGGCTGAGGCAGGCAGG - Intergenic
985355689 4:189116681-189116703 GCACAGAAGCTGTGGCAGGCGGG + Intergenic
985394841 4:189531238-189531260 GTGGAGAAGCAAAGGCAGGTGGG + Intergenic
985406808 4:189646211-189646233 GAACAGATGCTGAGGAAGGCGGG + Intergenic
985406844 4:189646391-189646413 GAACAGATGCTGAGGAAGGCGGG + Intergenic
985429774 4:189868018-189868040 GAGAAGAAGCAGATGCAGGCAGG - Intergenic
985677749 5:1241016-1241038 GTGCAGAAGCTGGAAGAGGCGGG + Intronic
985711030 5:1430126-1430148 TTTCAGAAGGTGGGGCAGGCGGG - Intronic
986168161 5:5293532-5293554 TTTCAGGAGCTGAGGCGGGCAGG + Intronic
986199388 5:5567807-5567829 GTGGAGCAGCTGAGCCGGGCTGG - Intergenic
986233540 5:5887127-5887149 GGGCAGGAGCTGAAGCTGGCAGG - Intergenic
987372614 5:17207262-17207284 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
987440663 5:17951997-17952019 GCTCAGAAGCCAAGGCAGGCAGG - Intergenic
989373969 5:40740488-40740510 GTGTAGAAGCTGAGGTCAGCTGG - Intronic
990753122 5:59039442-59039464 GTGCAGAAGGCTCGGCAGGCGGG - Intronic
990846479 5:60145969-60145991 TTTGGGAAGCTGAGGCAGGCGGG + Intronic
992520489 5:77545704-77545726 GTGCAGAAGCAGACCCACGCTGG + Intronic
992763109 5:79969197-79969219 GTGGAGATGCTGAGTAAGGCTGG - Intergenic
992898598 5:81270147-81270169 GCACAGAAGCTGTGGCAGGCAGG + Intergenic
993563408 5:89441199-89441221 GGGCTGAAGCTCAGGGAGGCGGG + Intergenic
994281849 5:97914026-97914048 TTCCAGAGGCTGAGGCAGGAGGG + Intergenic
994350230 5:98737357-98737379 GAGCATAAGCTGAAGCAGGGTGG + Intergenic
995502374 5:112821397-112821419 CTCCGGAAGCTGAGGCAGGAAGG + Intronic
995658898 5:114458937-114458959 GTGCGGGTGCTGAGGGAGGCAGG + Intronic
996327050 5:122286814-122286836 GCACAGAAGCTGTGGCAGGCAGG - Intergenic
997892091 5:137686296-137686318 CTGCAGATGATGAGGCTGGCAGG + Intronic
997948736 5:138224933-138224955 TTCCAGAAGCTGAGGAAGGAGGG + Intergenic
997969995 5:138393203-138393225 GTGAAGAAGCTGAAGCAATCTGG + Exonic
998043758 5:138970135-138970157 TTGCAGAAGCAGAGGCAGAGAGG + Intronic
999095442 5:148973917-148973939 GTGCAGCTGGAGAGGCAGGCAGG - Intronic
999153527 5:149442219-149442241 GGGCACCAGCTGAGGGAGGCTGG + Intergenic
999305418 5:150516200-150516222 GAGCAAGGGCTGAGGCAGGCAGG - Intronic
1000114764 5:158143341-158143363 GTGCAGCAGTGGAGGAAGGCTGG + Intergenic
1000300152 5:159949776-159949798 GTGCACAAATGGAGGCAGGCTGG - Intronic
1001092827 5:168753924-168753946 GTGCAGGAGCTGATGCTGACAGG - Exonic
1001103857 5:168836219-168836241 TGGCAGCAGCTGTGGCAGGCAGG + Intronic
1001651734 5:173320621-173320643 GTGCAGAAAGTGGGGCGGGCAGG + Intronic
1001878356 5:175220387-175220409 GTGAAGAAACTGAGGCTGGGTGG - Intergenic
1002430177 5:179198895-179198917 GTGCTGAGCCTGTGGCAGGCAGG - Intronic
1002460362 5:179370279-179370301 GTGCTGAGGGTGAGGCAGACAGG - Intergenic
1002861773 6:1085768-1085790 GCCCATAGGCTGAGGCAGGCTGG - Intergenic
1003114744 6:3276399-3276421 GTGCAGAAGATGCGCCAGGGAGG - Intronic
1004000861 6:11595882-11595904 GTCAAAAAGCTGAGGGAGGCGGG + Intergenic
1004330583 6:14717024-14717046 CTGCAGCAGCTGAAGCAGCCAGG + Intergenic
1004498679 6:16189334-16189356 GTGCTGAGGCTGAGACAGGCAGG - Intergenic
1004699114 6:18062079-18062101 TTTCGGAGGCTGAGGCAGGCAGG - Intergenic
1005833919 6:29693186-29693208 CTCCCGAAGCTGAGGCAGGAAGG - Intergenic
1005957135 6:30672012-30672034 GTTCAGAAGATGAGGGGGGCCGG + Intronic
1006018741 6:31104051-31104073 TTGGGGAAGCTGAGGCAGGAGGG - Intergenic
1006034806 6:31202822-31202844 GGGCAGAAGGTGCGGCAGGAAGG - Exonic
1006073813 6:31516395-31516417 GGGCAGAAGCTGCAGCAGGAAGG - Intergenic
1006102200 6:31692623-31692645 GTGCAGACACTGAGGCACACAGG + Intronic
1006629033 6:35418237-35418259 GTGCAGATGCTGGGGCAGGCAGG - Intronic
1006744570 6:36332195-36332217 GTGAAGGGCCTGAGGCAGGCGGG - Intronic
1007197330 6:40074010-40074032 GCACAGAAGCTGTGGCAGGTGGG - Intergenic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007585435 6:42986256-42986278 GAGGAGAAGCTGGGGGAGGCTGG - Intronic
1009485130 6:64211871-64211893 TTTCAGAGGCGGAGGCAGGCAGG + Intronic
1010145498 6:72664409-72664431 GTTGGGAGGCTGAGGCAGGCAGG + Intronic
1010569852 6:77463567-77463589 GTGCGGCAGCCAAGGCAGGCGGG + Intergenic
1012684075 6:102221472-102221494 GTTAAGAAGCAAAGGCAGGCCGG - Intergenic
1013504738 6:110788268-110788290 TTTGAGAAGCTGAGGCAGGAGGG - Intronic
1013839040 6:114368156-114368178 GAGCTGAAGCTGAAGCTGGCTGG + Intergenic
1014090359 6:117397683-117397705 GTGCTGAAGCTCAGTCAGCCTGG - Intronic
1014313233 6:119831003-119831025 GCACAGAAGCTGTGGCAGGCAGG - Intergenic
1014778209 6:125534192-125534214 GCGAGGACGCTGAGGCAGGCGGG + Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016909109 6:149179395-149179417 GTGGAGAAGGTGAGGCAGGGAGG + Intergenic
1016911092 6:149200046-149200068 GCCCACAAGCTGAGGCAGGGTGG + Intergenic
1018052525 6:160023600-160023622 GTGGGGAAGCTGAGGCATGGAGG + Intronic
1018169235 6:161131315-161131337 CTGCAGGAGCTGAGGAAGGAAGG + Exonic
1018694153 6:166377382-166377404 AGGCAGAAGTGGAGGCAGGCAGG + Intronic
1019190429 6:170247644-170247666 GGGCAGCAGCAGAGGCAGGAGGG + Intergenic
1019607975 7:1919535-1919557 TGGTAGAAGCTGAGCCAGGCTGG - Intronic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1020092190 7:5348052-5348074 CTGCAGACTCTCAGGCAGGCAGG - Intronic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1021631319 7:22650222-22650244 AAACAGAATCTGAGGCAGGCTGG + Intergenic
1021867578 7:24973718-24973740 TTGCAGAAGCTTGTGCAGGCAGG - Intronic
1022746755 7:33180595-33180617 TTTGAGAGGCTGAGGCAGGCGGG - Intronic
1023251680 7:38269992-38270014 CTCGAGAAGCTGAGGCAGGAGGG + Intergenic
1023728867 7:43170924-43170946 GTGCAAAAGGTTAGGCAGCCAGG + Intronic
1023849592 7:44142798-44142820 CTCCAGAGGCTGAGGCAGGAAGG - Intergenic
1023871936 7:44268034-44268056 GTGCTGAGGCACAGGCAGGCTGG + Intronic
1023902184 7:44490395-44490417 GTGCTGCAGGTGAGGCGGGCGGG - Exonic
1023966589 7:44966059-44966081 TTGCAGAAGGTGAGGTGGGCGGG - Exonic
1024537199 7:50446923-50446945 GTACAGAAGATGATGCAAGCTGG - Exonic
1024541669 7:50479932-50479954 GTGCCTGAGCTGAGGCAGGTGGG - Intronic
1024825062 7:53381568-53381590 GTGCAGAAGCTGAGGGAAAAAGG - Intergenic
1025079947 7:55972858-55972880 TTTGGGAAGCTGAGGCAGGCAGG + Intronic
1026233370 7:68505022-68505044 CTGCAGGAGCTGAGGCTGCCAGG + Intergenic
1026644932 7:72159389-72159411 CTTCAGAGGCTGAGGCAGGGAGG + Intronic
1026867359 7:73831950-73831972 GGGCAGAGACTGAGCCAGGCAGG + Exonic
1028201134 7:87963167-87963189 GTGGAGACGGTGAGGCATGCAGG + Intronic
1028529696 7:91824947-91824969 GCACAGAAGTTGTGGCAGGCAGG - Intronic
1028789299 7:94835188-94835210 CTGAGGAGGCTGAGGCAGGCAGG - Intergenic
1029248146 7:99217504-99217526 GTCCACAAGCTGAGGCTAGCTGG + Intergenic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030161411 7:106512175-106512197 GAGCAGAAGCTGAGACAGTCTGG - Intergenic
1030653133 7:112137295-112137317 GTGCAGGTGCTGAGACTGGCTGG - Intronic
1030677468 7:112398937-112398959 GAGGAGAAGCTCAGGCTGGCTGG + Intergenic
1031605504 7:123763312-123763334 GTGCGGAAGCTCAGGCATGGCGG + Intergenic
1031665783 7:124480850-124480872 GTGCAGAAGCTGACCCGCGCCGG + Intergenic
1032033135 7:128501257-128501279 GTGTAGAGGGTGAGACAGGCTGG - Intronic
1032117699 7:129130487-129130509 GTGCTAAAGCTGGGGCAGTCTGG - Intergenic
1032549321 7:132770056-132770078 GTACAGAAACTGAGGCATGGGGG - Intergenic
1032574902 7:133043108-133043130 TTTGGGAAGCTGAGGCAGGCGGG - Intronic
1033210810 7:139458936-139458958 CTGCAGGTGCTGAGGCAGGGTGG - Intronic
1033666640 7:143446900-143446922 TTTGAGAGGCTGAGGCAGGCAGG - Intergenic
1034013550 7:147557027-147557049 GTCGGGAGGCTGAGGCAGGCGGG + Intronic
1034164238 7:149013432-149013454 TTCCAGAAGCTGAGGCGGGAGGG + Intronic
1034203031 7:149294319-149294341 CTGCAGAGCCTGTGGCAGGCAGG + Intronic
1034274551 7:149818330-149818352 GAGCTCAAGCTGAGGAAGGCTGG + Intergenic
1035403852 7:158586462-158586484 GTGCAGAAGCAAACGCAGGCGGG - Intronic
1035471728 7:159114277-159114299 GAGGAGAAGGGGAGGCAGGCAGG + Intronic
1037475124 8:19249534-19249556 GTGAAGAAGCGGAGACAGCCGGG + Intergenic
1038443896 8:27589702-27589724 GTGCAGAAGAGGAGACAGGGAGG - Intergenic
1038959308 8:32501066-32501088 TTGCTGAAGATGAGGCATGCTGG + Intronic
1039011381 8:33097202-33097224 ATGCAGCAGCTGAGGCACACTGG + Intergenic
1039031446 8:33313964-33313986 GGGCAGTAGCTGTGGCAGTCAGG + Intergenic
1039217137 8:35284802-35284824 TTTGGGAAGCTGAGGCAGGCGGG - Intronic
1039938172 8:42066207-42066229 GGGCAGAAAATGGGGCAGGCAGG - Intergenic
1040388569 8:46931339-46931361 TTGCAGCTGCAGAGGCAGGCAGG - Intergenic
1040962672 8:53051642-53051664 GTGCTGTAGCTCTGGCAGGCTGG + Intergenic
1041181702 8:55256099-55256121 GAGCTGAGGCTGAGGAAGGCAGG + Intronic
1042748754 8:72135391-72135413 GAGCAGAAGCCAAGGCATGCAGG - Intergenic
1043012145 8:74894221-74894243 GTGAGGAAGCAGAGGTAGGCAGG - Intergenic
1043586772 8:81779180-81779202 GAGCAGTAGCTAAGGCAGGGAGG + Intergenic
1043941441 8:86199993-86200015 GTGCACCAGCTCAAGCAGGCAGG + Intergenic
1045391393 8:101718536-101718558 ATGCAGACGCTGAGGCAGGGAGG - Intronic
1045964419 8:108007830-108007852 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
1046439527 8:114239997-114240019 TTTGAGAAGCTGAGGCAGGAAGG + Intergenic
1046615320 8:116471160-116471182 GTGCATTAGCTGAGGCAGGGAGG + Intergenic
1046906069 8:119574341-119574363 TTGCAGAAGCAGAGGCTTGCAGG - Intronic
1047691179 8:127356268-127356290 GTGTAAGAGCTGAGGCAGGAAGG + Intergenic
1047744106 8:127831208-127831230 ATACAGAGGCTGAGGCAGGAGGG + Intergenic
1047754892 8:127911072-127911094 TCCCAGAACCTGAGGCAGGCTGG + Intergenic
1048861448 8:138727175-138727197 GTGCTGGAGCTGAGGGAGGAGGG - Intronic
1049404307 8:142444906-142444928 GTGCAGATGTTGAGGAAGGATGG - Intergenic
1049579424 8:143404618-143404640 GAGGAGAGGCTGGGGCAGGCGGG + Intergenic
1049806345 8:144542398-144542420 CTCCTGAGGCTGAGGCAGGCAGG + Intronic
1050382104 9:5041770-5041792 GTCCCGAAGCTGAGGCTGGGAGG - Intronic
1051008109 9:12374106-12374128 GTGCAGAAACAGCTGCAGGCAGG + Intergenic
1052091553 9:24334885-24334907 GGGGGGAAGCTGAGGCAGACAGG - Intergenic
1053248462 9:36554564-36554586 TTTCAGAGGCTGAGGCAGGAGGG - Intergenic
1054777214 9:69133791-69133813 GTTGGGAGGCTGAGGCAGGCGGG - Intronic
1055752553 9:79522831-79522853 GAGCTGCAGCCGAGGCAGGCAGG + Intergenic
1057081488 9:92177365-92177387 GTGAAGATGCTGGGGTAGGCAGG + Intergenic
1057130639 9:92651982-92652004 TTTGGGAAGCTGAGGCAGGCAGG - Intronic
1057423570 9:94930651-94930673 GAAAAGAAGCTGAGGCAAGCAGG + Intronic
1058396172 9:104556920-104556942 GCACAGAAGCTGCAGCAGGCAGG + Intergenic
1058572802 9:106365732-106365754 GTGCAGAAGCTGAGGAGGCAGGG - Intergenic
1058872960 9:109218366-109218388 TTTCGGAGGCTGAGGCAGGCAGG - Intronic
1059095512 9:111409314-111409336 TTTCGGAAGCCGAGGCAGGCAGG + Intronic
1059358272 9:113718297-113718319 CTGCAGAAGCGAAGGCAGGGAGG + Intergenic
1059377732 9:113898983-113899005 CTGGAGACTCTGAGGCAGGCTGG - Intronic
1059415111 9:114157375-114157397 GTCCAGGAGCAGAGGCATGCTGG - Intronic
1059890239 9:118794173-118794195 GTGCAGAAGTGGAGGAATGCTGG - Intergenic
1060916212 9:127392558-127392580 GGGCAGCAGCTGAGCCAGGTGGG + Intronic
1061399380 9:130360085-130360107 GGGCAGAGGCTGAGGCAGCCAGG - Intronic
1061676629 9:132220688-132220710 TTTCGGAGGCTGAGGCAGGCAGG - Intronic
1062018967 9:134307321-134307343 CCCCAGAAGATGAGGCAGGCTGG + Intergenic
1062077763 9:134601156-134601178 GCCCAGAAGCTGAGGGAGGTGGG - Intergenic
1062103750 9:134741591-134741613 GTACAGAAGCAGAGGCAGGAGGG + Intronic
1062478399 9:136740733-136740755 GGGCAGGAGGTGAGGCGGGCAGG - Intronic
1062485960 9:136775803-136775825 TTTGGGAAGCTGAGGCAGGCAGG + Intergenic
1203657743 Un_KI270753v1:14920-14942 GAACAGACGCTGAGGAAGGCGGG + Intergenic
1185866472 X:3628796-3628818 TTTGAGAGGCTGAGGCAGGCAGG + Intronic
1187052059 X:15704619-15704641 TTTGGGAAGCTGAGGCAGGCAGG + Intronic
1187464700 X:19516414-19516436 TTGGAGAGGCTGAGGCGGGCGGG - Intergenic
1187521779 X:20020616-20020638 TAGCAGCAGCTGAGGCAGGAAGG - Intronic
1187615942 X:20993016-20993038 TTGCAGAAGCTGGGGAAGGAGGG + Intergenic
1188941389 X:36241807-36241829 GGGCAGAGGCTGCAGCAGGCAGG - Intronic
1191731757 X:64343807-64343829 GTGAGGAAGCTGAGGCAGAAAGG + Intronic
1192190291 X:68987140-68987162 GGGCAGCAGCAGAGGCAGGATGG - Intergenic
1192191886 X:68996078-68996100 GTGGAGAAGCTGGGGCAGGGCGG + Intergenic
1192895753 X:75441139-75441161 GCACAGAAGCTGTGGCAGGCAGG - Intronic
1194767621 X:97860448-97860470 AGGAAGAAGCTGAGGGAGGCTGG + Intergenic
1195559084 X:106262791-106262813 GTGGAGAAGGTGAGGCACTCAGG + Intergenic
1196966751 X:121064787-121064809 GCACAGAAGCTGCGGCAGGTTGG - Intergenic
1197364246 X:125544666-125544688 GCACAGAAGCTGAATCAGGCGGG + Intergenic
1197784280 X:130185295-130185317 TTTGGGAAGCTGAGGCAGGCAGG + Intergenic
1197949406 X:131877864-131877886 GGTCAAAAGCTGAGACAGGCTGG + Intergenic
1199284530 X:146041589-146041611 ATGCAGAAGCAGAGGCTGTCAGG + Intergenic
1199836432 X:151596306-151596328 GTGCAAAAAGTGAGGCAGGCAGG + Intronic
1200232556 X:154451277-154451299 TTGGCTAAGCTGAGGCAGGCAGG + Intergenic
1200799327 Y:7371504-7371526 TTTAAGAAGCTGAGGCAGGAGGG - Intergenic