ID: 1078197309

View in Genome Browser
Species Human (GRCh38)
Location 11:9146696-9146718
Sequence TTGTGGGTATGCAGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 598
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 545}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078197301_1078197309 7 Left 1078197301 11:9146666-9146688 CCTCTCAGGCGAAAACAAAAGGG 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1078197309 11:9146696-9146718 TTGTGGGTATGCAGGGAGGGAGG 0: 1
1: 0
2: 2
3: 50
4: 545
1078197299_1078197309 16 Left 1078197299 11:9146657-9146679 CCAAGTGAGCCTCTCAGGCGAAA 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1078197309 11:9146696-9146718 TTGTGGGTATGCAGGGAGGGAGG 0: 1
1: 0
2: 2
3: 50
4: 545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078197309 Original CRISPR TTGTGGGTATGCAGGGAGGG AGG Intronic
901768598 1:11519295-11519317 TCCTGGGTACCCAGGGAGGGTGG - Intronic
901804818 1:11731869-11731891 TTGGGGGGATGCGGGGAGGTGGG - Intergenic
901917445 1:12510845-12510867 CTGTGGGGGTGCAAGGAGGGAGG - Exonic
902070247 1:13728498-13728520 CTGTGGGGAAGAAGGGAGGGAGG + Intronic
903140473 1:21335909-21335931 CAGTGGGTCTCCAGGGAGGGAGG + Intronic
903469410 1:23575392-23575414 TTGTAGGTCTCCAGGGATGGGGG + Intergenic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
903741808 1:25562736-25562758 TTGTGGGTGTGGTGGGAGGTGGG + Intronic
903996208 1:27306880-27306902 TGGTGGCTCTGGAGGGAGGGTGG - Exonic
904008982 1:27379415-27379437 TTGTGGGTAAGCGGGGGGCGGGG - Exonic
904038646 1:27571786-27571808 GGGTGGGTTTGCAGGGAGCGGGG + Intronic
904618406 1:31762058-31762080 TTGGGGGTGGGAAGGGAGGGAGG + Intronic
905002994 1:34688103-34688125 GTGTGTGTATGCATGGAGAGTGG - Intergenic
905278575 1:36834745-36834767 TTGTGGACATGCAGGGGGTGGGG - Intronic
905301478 1:36989069-36989091 CTGTGTTTGTGCAGGGAGGGAGG - Intronic
905971618 1:42146076-42146098 GTGTGGGTGGGCTGGGAGGGAGG - Intergenic
906108169 1:43307017-43307039 TTGTGGGTAGGGTGGGAGGCTGG + Intronic
906566327 1:46803758-46803780 TGGTGGGCCTGCAGGGAGGAGGG + Intronic
906652043 1:47519755-47519777 GTGTGGGCAGGGAGGGAGGGTGG + Intergenic
906979306 1:50611829-50611851 GTGTGGGTATGTGGGGAGGTTGG - Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907268859 1:53278698-53278720 TTGTGCATGTGCAGGGAGGGTGG + Intronic
910046439 1:82923306-82923328 TTGTGGATATCCAGGCATGGGGG + Intergenic
912430788 1:109627338-109627360 TTGGGGGGATGCAGCGTGGGAGG + Intronic
912491462 1:110064952-110064974 TTGTGGGTTGGAATGGAGGGAGG + Intronic
912708640 1:111933643-111933665 ATGTGGGAAAGCAGGCAGGGAGG + Intronic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
914474509 1:148012273-148012295 TTGGGGGTGGGGAGGGAGGGAGG + Intergenic
914492080 1:148158587-148158609 TTGGGGGTGGGGAGGGAGGGAGG + Intergenic
915088208 1:153403255-153403277 TTGTGTGTATGAAGGAAGGAAGG + Intergenic
915096679 1:153467565-153467587 TTGTGCGTATGAAGGAAGGAAGG - Intergenic
915268241 1:154733818-154733840 TGTTGGGGATGAAGGGAGGGAGG - Intronic
915284404 1:154843592-154843614 TAGCGAGTATGCAGGGAGGCTGG + Intronic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
916992659 1:170260996-170261018 TTGTGGGGTGGCGGGGAGGGGGG + Intergenic
917109366 1:171529401-171529423 CTGTGGGTATGCAGGAAAGGTGG - Intronic
917147235 1:171905326-171905348 TTCTGAGTATGCAGGGAGTAAGG + Intronic
917654649 1:177113816-177113838 TAGTGGGTATGGAGAGAGTGAGG + Intronic
918234677 1:182569356-182569378 TTGAGGGAAAGGAGGGAGGGGGG - Intergenic
918598087 1:186317135-186317157 GGGTGGGTATACTGGGAGGGAGG - Intronic
918731411 1:188001834-188001856 TTTTGGGGATTCAGTGAGGGAGG - Intergenic
918746201 1:188203457-188203479 TTGTGTGTATGTGGGGTGGGTGG + Intergenic
918816964 1:189199097-189199119 TTGTGGCTATTCAAGGAGGCAGG - Intergenic
919947416 1:202329807-202329829 TTGAGGGTATGCAATGAGGATGG + Intergenic
920189200 1:204181715-204181737 GGGTGGGCAGGCAGGGAGGGAGG - Intergenic
921179245 1:212618785-212618807 TTGTGGGCAAGCAGGGTGGCCGG + Intronic
921479281 1:215645184-215645206 TTGTGGGCATGAAGGGAGAAAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923449939 1:234107062-234107084 ATGTGGGTCTGCAGGTTGGGAGG + Intronic
924373035 1:243375125-243375147 AGGTGGGTATGTAGGGTGGGTGG + Intronic
924716094 1:246575600-246575622 TAGTGGGTATGTAGGGCAGGGGG + Intronic
924852045 1:247840344-247840366 TTGTGGGAAGGAAGGGAGGGAGG - Intergenic
1064163389 10:12965179-12965201 TTTGGGGAAAGCAGGGAGGGGGG - Intronic
1065773482 10:29099144-29099166 GTGTGTGTGTGCAGGTAGGGAGG + Intergenic
1067471596 10:46541984-46542006 TTGGGGGTATTCAGGGAGATGGG - Intergenic
1067684359 10:48457920-48457942 TTGGGGGTGGGTAGGGAGGGGGG + Intronic
1068078239 10:52285129-52285151 TGGTGTGTATGCATGGAAGGGGG - Intronic
1068295502 10:55067220-55067242 TTGTGGGGATGAAGGGAGGTTGG - Intronic
1069966637 10:72123515-72123537 CTGTGCGTGTGCAGGGATGGGGG + Intronic
1070338526 10:75475967-75475989 ATGTGGGAAAGAAGGGAGGGCGG - Intronic
1073176401 10:101560074-101560096 CTGTGGGGCTGCAGGGAAGGGGG - Intergenic
1074043827 10:109818565-109818587 TTGTGGCTATGAAGGTTGGGAGG + Intergenic
1074870857 10:117574958-117574980 TTGTGGGTGTGCAGGTGGGTGGG - Intergenic
1075604991 10:123798313-123798335 TAGTTGGTATGCAGGGAGTGGGG + Intronic
1075656289 10:124163315-124163337 TAATGGGGATGGAGGGAGGGAGG + Intergenic
1075927404 10:126263601-126263623 TTGTTGGTGGGCGGGGAGGGGGG + Intronic
1075945881 10:126432675-126432697 TCGTGGCTGTGCGGGGAGGGAGG + Intronic
1076618724 10:131773348-131773370 TTGTAAGTAAACAGGGAGGGAGG + Intergenic
1077283158 11:1754496-1754518 ATGTGGGGATGGAGGGATGGAGG + Intronic
1077304510 11:1863071-1863093 TGGTGTGTATGTAGGGAGTGGGG + Intronic
1077428774 11:2503536-2503558 TTGTGGGGTTGGGGGGAGGGGGG + Intronic
1077703530 11:4462840-4462862 TTGTGGGTTTGGTGAGAGGGTGG - Intergenic
1078197309 11:9146696-9146718 TTGTGGGTATGCAGGGAGGGAGG + Intronic
1078524326 11:12089154-12089176 AAGTGGGTATGCAGGGAGGCTGG - Intergenic
1078822898 11:14900127-14900149 TTGTGGGTAGGGGGGGTGGGGGG - Intergenic
1079070310 11:17339496-17339518 TTGTGGGGGTGGGGGGAGGGGGG - Intronic
1080816883 11:35766817-35766839 TTGTAAGTATCCAGGGAGGCTGG - Intronic
1082814107 11:57497030-57497052 TGGTGGGCAGGCATGGAGGGTGG - Intronic
1085445138 11:76596469-76596491 CTGTTGGGGTGCAGGGAGGGTGG - Intergenic
1086261201 11:84943381-84943403 ATGTGGGAATGCAGGAAGGCAGG - Intronic
1087888681 11:103511447-103511469 TTGTGGGGTTGGGGGGAGGGGGG - Intergenic
1087922338 11:103880674-103880696 TTGTAGGAATGCAGGAAGTGGGG - Intergenic
1088038877 11:105351884-105351906 TTGTGTATATGAAGGGAGGTAGG - Intergenic
1089096589 11:115924912-115924934 TTGGGGGTGTGGAGGGTGGGAGG - Intergenic
1090344590 11:126059482-126059504 TTGGGGGGATGCGGGCAGGGGGG - Intronic
1090463090 11:126909416-126909438 CTGTGGGTATGCTGGGAGCTGGG - Intronic
1091187940 11:133663311-133663333 ATGTGGGTCTGCAGAGAGGCTGG - Intergenic
1092182017 12:6452476-6452498 TAGTGTGTGTGGAGGGAGGGTGG + Intronic
1092855767 12:12672387-12672409 TTGTGTGAATGTAGGGAGGTAGG - Intronic
1094031057 12:26011449-26011471 TTTTGGGACTGCAGGCAGGGAGG - Intronic
1094344250 12:29449266-29449288 GTGTGTGTGTGTAGGGAGGGGGG - Intronic
1095589351 12:43886779-43886801 TTCTGGGGATGGAGGGTGGGAGG - Intronic
1096227298 12:49874422-49874444 GAGTGGGCTTGCAGGGAGGGAGG + Intronic
1096251166 12:50033338-50033360 TTCTGGGGGTCCAGGGAGGGAGG + Intergenic
1096771507 12:53938748-53938770 TAGAGGGAATGTAGGGAGGGAGG + Exonic
1096790327 12:54040377-54040399 TGGTGGGAAGGGAGGGAGGGAGG - Intronic
1096806530 12:54144344-54144366 TTGTGGGGCTGAAGAGAGGGAGG - Intergenic
1096884280 12:54700859-54700881 TGGTGGTAATGCAGAGAGGGAGG + Intergenic
1097675723 12:62601117-62601139 TTCCTGATATGCAGGGAGGGGGG + Intergenic
1097899425 12:64858185-64858207 TGGTGGGAATGGAGGGTGGGCGG - Intronic
1098177280 12:67805954-67805976 TGGTGGGGAAGGAGGGAGGGAGG - Intergenic
1099220043 12:79902944-79902966 TTGTGGGTATGCCTGCATGGGGG - Intronic
1099444264 12:82733475-82733497 TTGTGCATGTGTAGGGAGGGTGG + Intronic
1101527214 12:105542286-105542308 ATGTGAGGATGCAGGGATGGAGG + Intergenic
1101891044 12:108715641-108715663 TTGTGAGTATGCGGGGGGGAGGG - Intronic
1102636730 12:114331179-114331201 TTGAGGGAATGGAGGCAGGGAGG + Intergenic
1104274965 12:127318308-127318330 CTGTGGGGATGCAGTGAGGATGG - Intergenic
1104509674 12:129365939-129365961 GTGTGGGTGTGCGGGGCGGGTGG - Intronic
1104749518 12:131229550-131229572 AGGTGGGTCTGCAGGGAGGCCGG - Intergenic
1105004107 12:132710614-132710636 TTGTGGGGACGCCGGGAGGGCGG - Intergenic
1105429958 13:20327278-20327300 TTATGGTTAAGCAGGGAGCGGGG - Intergenic
1105818306 13:24057226-24057248 TTGTGGGGTTGGGGGGAGGGGGG - Intronic
1106062777 13:26310943-26310965 TTGTGGGTGGGTAGGGAGGAGGG - Intronic
1106149699 13:27087293-27087315 TCGTGTGCATGCAGGGAGCGGGG + Intronic
1106160347 13:27195739-27195761 TTGAGAGTTTGCGGGGAGGGAGG + Intergenic
1106994594 13:35466996-35467018 TTGTGTATGTGCATGGAGGGGGG - Intronic
1107061295 13:36162583-36162605 TGGTGGGTATGGAGGGGGTGTGG - Intergenic
1107613552 13:42141046-42141068 TTGTGGGGTTGGTGGGAGGGGGG - Intronic
1108579463 13:51816447-51816469 TTGAGGGTATGAAGTGTGGGAGG - Intergenic
1110533698 13:76626891-76626913 ATGTGGGTTTGAAGGTAGGGAGG - Intergenic
1110702257 13:78562530-78562552 ATGATGGTTTGCAGGGAGGGAGG + Intergenic
1110706825 13:78607340-78607362 TAGTGGGTATACAGGGGAGGGGG + Intergenic
1113416058 13:110129602-110129624 GGGTGGGTGTGCAGGGAGTGGGG + Intergenic
1113805358 13:113108279-113108301 TTGTGGGTGTCCCGGGAGTGTGG + Intronic
1114519353 14:23323162-23323184 TTTTGGGTGTGGAGGGAGTGTGG + Intronic
1115955083 14:38768682-38768704 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1117223169 14:53627709-53627731 TGGTGGGGAGTCAGGGAGGGAGG + Intergenic
1119082801 14:71711859-71711881 ATGTGGCCATTCAGGGAGGGTGG + Intronic
1119170278 14:72529651-72529673 CTGTGGGATTGCAGGGAGGGGGG - Intronic
1119202184 14:72764323-72764345 ATGTGGGGGTGCTGGGAGGGTGG + Intronic
1119578652 14:75753900-75753922 TTTTGGTTATGCAGTGAGTGCGG + Intronic
1119635607 14:76270834-76270856 GGGTGGGTAGGCATGGAGGGGGG + Intergenic
1120361919 14:83514903-83514925 CTGTGATTTTGCAGGGAGGGAGG + Intergenic
1120616234 14:86708356-86708378 TTGTGTGTATGCAGATATGGAGG + Intergenic
1121077948 14:91084889-91084911 TTGTGTTTATCAAGGGAGGGTGG + Intronic
1121092952 14:91195509-91195531 CTGAAGGTATGCAGGGAGGTAGG + Intronic
1121765010 14:96478735-96478757 TTGTGGGGCTGGGGGGAGGGTGG + Intronic
1122099249 14:99394252-99394274 TTGAGGGTAAGGAGGGAGGCAGG - Intergenic
1122796227 14:104207531-104207553 TTGGGGGGATGCTGTGAGGGTGG + Intergenic
1122898198 14:104770887-104770909 TTGAGGGTGTGCTGGGAGTGGGG - Intronic
1124651563 15:31477881-31477903 AGGTGGGTAGGGAGGGAGGGTGG + Exonic
1125734742 15:41916920-41916942 TTGTGTGGATGCAGGGAGTGGGG - Intronic
1125825457 15:42672636-42672658 TTGTGTGTTTGCAGAGAGGAGGG + Intronic
1126070049 15:44858298-44858320 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1127451776 15:59123677-59123699 TTGTGTGTATGTTGGGCGGGGGG + Intronic
1127735649 15:61836232-61836254 TTGTGGGCATGCACGGAGATGGG + Intergenic
1128136356 15:65266514-65266536 ATGTGGGGAAGCAGGGATGGAGG - Intronic
1128453118 15:67818588-67818610 AGGGGTGTATGCAGGGAGGGAGG + Intergenic
1129762025 15:78134744-78134766 GTGTGTGTTTGCTGGGAGGGAGG + Intronic
1129998005 15:80023406-80023428 ATGTGGGAGTGCTGGGAGGGAGG - Intergenic
1130103266 15:80910244-80910266 TTGTTGCCATGCAGGGAGGCAGG - Intronic
1130368889 15:83266252-83266274 GTGTGGGGAGGGAGGGAGGGAGG + Intronic
1132041024 15:98524729-98524751 ATTTGGATTTGCAGGGAGGGGGG + Intergenic
1132302766 15:100786805-100786827 ATGTGGATATGGAGAGAGGGCGG + Intergenic
1132645841 16:998898-998920 TGGTGGGGAAGCAGGCAGGGAGG + Intergenic
1132826886 16:1909603-1909625 TTTTGGGAATGCAGGCAGTGAGG - Intergenic
1133279248 16:4655809-4655831 TTGTCAGGAGGCAGGGAGGGTGG - Intronic
1133330498 16:4970297-4970319 TTGCGGGGAAGCAGGGAGTGGGG + Intronic
1133418014 16:5621514-5621536 TTGAGGAAATGGAGGGAGGGAGG + Intergenic
1134787873 16:16961486-16961508 TTGTGGTTAAGCAGGGAAGAGGG - Intergenic
1136092841 16:27932934-27932956 TTGTGAGTCTGCAGGTTGGGCGG - Intronic
1136100943 16:27995583-27995605 TTGTGGTTTTGCAGGGAAAGGGG - Intronic
1137677272 16:50309873-50309895 GTGTGGGTAGGCAGGGAGTGAGG + Intronic
1138490382 16:57372923-57372945 GTGTGGGTGTGCCAGGAGGGCGG + Intronic
1138656194 16:58492909-58492931 TGGTGGCTCTGCAGGGAGGAGGG - Intronic
1139851499 16:69953373-69953395 CTGAGTGGATGCAGGGAGGGGGG - Intronic
1139880475 16:70176285-70176307 CTGAGTGGATGCAGGGAGGGGGG - Intronic
1140219559 16:73033706-73033728 ATTTGGGTTTGGAGGGAGGGAGG - Intronic
1140357522 16:74319168-74319190 TGGAGGGGATGCAGGGAGGGTGG - Intergenic
1141112631 16:81282645-81282667 TGGTGGGTGAGCAGGGATGGGGG - Intronic
1141331807 16:83117764-83117786 TTGAGGGTGGGAAGGGAGGGTGG - Intronic
1142074244 16:88108223-88108245 CTGTGGGGATGCGGGGAGGGGGG + Intronic
1142521454 17:507667-507689 TTGGGGCTGTGGAGGGAGGGAGG + Intergenic
1142626130 17:1193269-1193291 TTGTGGGTATTGAGGGGGAGGGG - Intronic
1142993804 17:3749216-3749238 TTGGGGGAATGAAGGGTGGGGGG + Intronic
1143520580 17:7442061-7442083 TTGGGGGTGTGCAAGGAGTGGGG - Intronic
1143564207 17:7711848-7711870 TTATGGGTATACAGGGAGCCAGG - Intergenic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144769552 17:17752158-17752180 CCGTGGGTATGCCGGGCGGGAGG - Intronic
1145251923 17:21301463-21301485 GTGTGGGTGAGCAGGGAGGCCGG + Intronic
1145304965 17:21668960-21668982 CTGGGGGTCTGCAGGGAGGTCGG + Intergenic
1145960704 17:28885095-28885117 GTGTGGGTATGGAAGGAGAGAGG + Intronic
1146453231 17:32991091-32991113 TGGTGGGTGTGCAGGGATGTTGG - Intronic
1146481188 17:33206287-33206309 TTCTGGGATTGGAGGGAGGGAGG + Intronic
1146778751 17:35647388-35647410 TTGTGTGTGTGTGGGGAGGGGGG - Intronic
1147133921 17:38424530-38424552 TTGGGGGTAGGCAGAGAAGGAGG - Intergenic
1147262286 17:39215459-39215481 TTGTAGGGATGCTAGGAGGGAGG - Intronic
1147273143 17:39291343-39291365 TTTTTGGTAGGTAGGGAGGGAGG + Intronic
1147273145 17:39291347-39291369 TGGTAGGTAGGGAGGGAGGGAGG + Intronic
1147485045 17:40804853-40804875 TGGTGAGTGTGCAGGGAGAGAGG + Intergenic
1147512876 17:41086900-41086922 TTGTGGGGGTGGGGGGAGGGGGG + Intronic
1148675365 17:49441763-49441785 TGGTGTGGCTGCAGGGAGGGAGG - Intronic
1149159147 17:53668935-53668957 TTGAGGGAAGGAAGGGAGGGGGG + Intergenic
1149456753 17:56794475-56794497 TTGGGGGCATGCAGGGTGTGGGG + Intronic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1149998969 17:61420341-61420363 TTGTTTGTATGGAGGGAGGTGGG - Intergenic
1150502770 17:65667048-65667070 CTGGAAGTATGCAGGGAGGGTGG + Intronic
1151349939 17:73525726-73525748 TCTTGGGTAGGCAGGGATGGGGG - Intronic
1151452292 17:74205457-74205479 TTGGGGGTAGGCAGAGATGGGGG + Intronic
1152286949 17:79418293-79418315 GGGTGGGTGTGCAAGGAGGGAGG - Intronic
1152595372 17:81235331-81235353 TGGTGGGTGTGCAGTGAGGATGG - Intronic
1153841343 18:9010877-9010899 TGGTGGGGAGGGAGGGAGGGGGG + Intergenic
1153914337 18:9732509-9732531 GTGTGGGCATGCAGTGAGGTGGG + Intronic
1154222636 18:12470424-12470446 TTGTGGGTATTCAGGGACAGTGG - Intronic
1155072426 18:22328191-22328213 TTATGTATATACAGGGAGGGAGG - Intergenic
1155284020 18:24270936-24270958 TTCTGGGTTTGGAGAGAGGGTGG - Intronic
1155300473 18:24424747-24424769 TAGTGGGGCTGCTGGGAGGGAGG + Intergenic
1156261063 18:35445344-35445366 TTGTGGGGAGGGAGGGAGGTGGG + Intronic
1156288396 18:35722104-35722126 TTGTGGGTATGCAGCTGGTGGGG - Intergenic
1156850984 18:41725958-41725980 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1157430299 18:47619342-47619364 TTGAGGGGAGGCAGGGAGGGTGG - Intergenic
1157513184 18:48293257-48293279 TTGTGTGCATGCAGTGAGGAAGG - Intronic
1157517643 18:48322058-48322080 TTGGGGCTATGCAGGGATGGAGG - Intronic
1157663998 18:49470019-49470041 TGGTGGGTATGGAGGAAGGTAGG - Intergenic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1158243691 18:55406733-55406755 TTGTGGGGATGGGGGGAGGCGGG - Intronic
1158395924 18:57078316-57078338 GTGTGTGTGTACAGGGAGGGAGG - Intergenic
1159037687 18:63293328-63293350 TTGGGGCTGTGAAGGGAGGGTGG + Intronic
1160773891 19:846065-846087 TGGTGGGTGTGGTGGGAGGGCGG + Intronic
1161089661 19:2353493-2353515 TTGAGGGTCTGCAGAGAGGCCGG - Exonic
1161323917 19:3653862-3653884 CTGTGGGCAGGCAGGGAGTGTGG - Intronic
1161426936 19:4208829-4208851 TAGTGTGGATGCAGGGAGGAGGG - Intronic
1162812475 19:13172595-13172617 TTATGGGGATGCTGGGATGGCGG - Intergenic
1162861365 19:13507586-13507608 TGGTTGGGAGGCAGGGAGGGGGG + Intronic
1163284726 19:16339213-16339235 TTGTACAGATGCAGGGAGGGAGG - Intergenic
1163366054 19:16876733-16876755 TGGTGGGGGAGCAGGGAGGGAGG - Intronic
1163397090 19:17070012-17070034 CTGTGGGGATTCAGGCAGGGAGG - Intronic
1163398199 19:17076186-17076208 TTGTGGGGAGGCACGGAGGCGGG + Intronic
1163826841 19:19528814-19528836 TGGCGGGCATGCAGGGTGGGCGG + Intronic
1165057315 19:33186007-33186029 TTGTGGGAATGCAAGGCTGGAGG - Intronic
1165386317 19:35512536-35512558 ATGTGGGCTTGGAGGGAGGGAGG + Intronic
1165771077 19:38380657-38380679 TTGGGGGGAGGGAGGGAGGGAGG + Intronic
1167123952 19:47536578-47536600 TTGTTTTTATGTAGGGAGGGGGG - Intronic
1167650895 19:50728046-50728068 CTGTGGGCATGCAGAGAGAGAGG + Intergenic
1168259925 19:55187602-55187624 TGCTGGGGATGCAGGGAGAGGGG + Exonic
1168450747 19:56464718-56464740 TTGTGTGTGTTTAGGGAGGGGGG - Intronic
925027264 2:619946-619968 CTGTGGGCATGCAGGAAGAGGGG + Intergenic
925276465 2:2651668-2651690 CTGTGGGAAAGCAGGGAGGCAGG + Intergenic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925601186 2:5610234-5610256 TTGTGGGGCTGGAGGCAGGGAGG + Intergenic
926811756 2:16761014-16761036 TGGTGGGAATGCAGTGAGGAAGG - Intergenic
927889363 2:26738747-26738769 TTGCTGGGAGGCAGGGAGGGAGG + Intergenic
928618879 2:33069287-33069309 GTGTGGGTATGAATGGAGTGGGG - Intronic
930195781 2:48508531-48508553 TTGTTGGAATGCAGGAAAGGGGG + Intronic
932216482 2:69969528-69969550 CTGTGAGTATCCAGGGAGAGAGG - Intergenic
934764854 2:96874956-96874978 TTCTGGGGATGCAGTGAGGGAGG + Intergenic
934780761 2:96968380-96968402 GTGTTGGTTTGCAGGGCGGGAGG - Intronic
934786878 2:97016351-97016373 TTGTTGGGATGCAGGGAGTATGG - Intronic
935353867 2:102179977-102179999 TTGTGGGGAAGCAGGTGGGGAGG + Intergenic
935368048 2:102315279-102315301 CTGTGGGTAGACAGGGAGAGTGG - Intronic
935571178 2:104661253-104661275 TGGTGGGTAGGTAGGGAAGGGGG + Intergenic
935656660 2:105429134-105429156 TTGTGGCAGTGGAGGGAGGGTGG - Intronic
937855131 2:126666698-126666720 GTGTGTGTGTGTAGGGAGGGAGG - Intronic
939631789 2:144534445-144534467 CTTTGGGGATGCAGGGTGGGAGG - Intergenic
939705092 2:145442599-145442621 TTGTGGGGGTGGGGGGAGGGGGG + Intergenic
940710772 2:157160898-157160920 TTTTTGGTATCCAGGGAGGGAGG + Intergenic
940809727 2:158228805-158228827 TTGTGGGGTTGGGGGGAGGGGGG + Intronic
942212288 2:173683443-173683465 TGGTGGGGAGGCAGGGTGGGAGG + Intergenic
942636378 2:178011226-178011248 TTGTAAGTATGCAGGGGTGGAGG + Intronic
942660880 2:178264033-178264055 TTGTGGGTGACCAGGAAGGGAGG - Intronic
943198479 2:184787489-184787511 TGGTGGGTATGCAGAGAAAGAGG - Intronic
943927149 2:193799657-193799679 TTGTGTCTATGCAGGGAGGAGGG - Intergenic
944119577 2:196226523-196226545 TTGTTGATATGCAGTGAAGGTGG - Intronic
944646573 2:201786316-201786338 ATGTTTGTATGCATGGAGGGAGG - Intergenic
944732321 2:202529336-202529358 ATTTGGGTATGGAGGGAGGGTGG - Intronic
945224384 2:207518409-207518431 TGGTGGGCATGCAGAGAGGGAGG - Intergenic
946497747 2:220213034-220213056 ATGTGGGGATGGAGGGAGAGAGG + Intergenic
946570497 2:221018990-221019012 ATGATGGTGTGCAGGGAGGGAGG + Intergenic
947731035 2:232431806-232431828 TTGTGTGTATGCACAGGGGGCGG - Intergenic
947831687 2:233146046-233146068 TTGTGGGGCTGCGGGGAGGCTGG + Intronic
948408361 2:237739953-237739975 TTGTGGGAATGGAGGAGGGGAGG + Intronic
1168909706 20:1438088-1438110 TAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1168922993 20:1556681-1556703 ATGTGAGGATACAGGGAGGGTGG + Intronic
1169307726 20:4507542-4507564 TTGAGGGGGTGGAGGGAGGGCGG + Intergenic
1169910628 20:10645003-10645025 TTCTGGATACTCAGGGAGGGTGG - Intronic
1170007047 20:11680768-11680790 TTGTGGGCAGATAGGGAGGGAGG + Intergenic
1170907244 20:20527591-20527613 TTGGGGGTGTGGGGGGAGGGCGG - Intronic
1170935483 20:20805663-20805685 TTGTGGGTATGCAGGCAATAGGG + Intergenic
1172007342 20:31826533-31826555 GTGCGGGTATGGAGGGTGGGTGG + Intronic
1172448605 20:35006210-35006232 TTGTGGGTAGGGAGTGAGGGTGG - Intronic
1172843155 20:37914064-37914086 TGGCCGGTATCCAGGGAGGGTGG + Intronic
1174211875 20:48886152-48886174 TTGTGAATATGTAGGGATGGGGG + Intergenic
1174317189 20:49712821-49712843 TTGTGGGTACGCGAGGTGGGGGG + Intronic
1175762466 20:61570995-61571017 GTGTGGGGATGCAGAGAGTGTGG + Intronic
1175915209 20:62422850-62422872 TAGTGGGGCTGCATGGAGGGCGG + Intronic
1175926189 20:62472767-62472789 TTGTGGCTGAGCAGGGAGTGGGG - Intronic
1176285019 21:5014791-5014813 TTGTGGGTGTGCAAGGGAGGTGG - Intergenic
1177146615 21:17413453-17413475 TTTGGTGTATTCAGGGAGGGAGG + Intergenic
1177166769 21:17612637-17612659 CTGTGGGTATCGGGGGAGGGTGG - Intronic
1177262067 21:18742616-18742638 TTGTGGATATTCAGGGGAGGGGG + Intergenic
1178821208 21:35976889-35976911 TTCTGGGGAGGAAGGGAGGGAGG + Intronic
1179469917 21:41603572-41603594 TAGGGGTGATGCAGGGAGGGCGG + Intergenic
1179872162 21:44248684-44248706 TTGTGGGTGTGCAAGGGAGGTGG + Intronic
1179884271 21:44306771-44306793 CTGTGTGTGTGCAGGGAGTGGGG + Intronic
1181019772 22:20093561-20093583 ATGTGGGCATGCCAGGAGGGAGG + Intronic
1181653391 22:24274260-24274282 TTTTGGGTATGTTGAGAGGGAGG + Intronic
1181745536 22:24952957-24952979 CTCCGGGTCTGCAGGGAGGGAGG + Intronic
1181760395 22:25054450-25054472 TTCTGTGTATGCAGGGTGGGAGG + Intronic
1181967456 22:26666953-26666975 ATGTGGGGAGGGAGGGAGGGAGG + Intergenic
1182314508 22:29436024-29436046 TTGTGGGTATAGAGGCTGGGAGG + Intergenic
1182695450 22:32196027-32196049 TTGTGGGTATAGAGGCTGGGAGG - Intronic
1182758363 22:32699520-32699542 TGGTGTGTGTGCAGGGATGGGGG + Intronic
1183467616 22:37987533-37987555 TTCAGGGCAGGCAGGGAGGGAGG - Intronic
1183540303 22:38426098-38426120 TGGAGGGACTGCAGGGAGGGAGG + Intergenic
1183647002 22:39132745-39132767 GTGTGGGCAGTCAGGGAGGGAGG - Exonic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184729122 22:46363553-46363575 TTGTGAGTTTGGAGGGAGGGAGG + Intronic
1184835651 22:47019553-47019575 GTGTGGGTGTGCAGGGAGGGAGG + Intronic
1184942691 22:47780750-47780772 TTCTGGCTATGCAGTGATGGGGG + Intergenic
1185125707 22:49009585-49009607 TTGTAGGCTTGCAGGGAGGGTGG + Intergenic
1185370509 22:50458834-50458856 ATTGGGGGATGCAGGGAGGGTGG + Intronic
949465354 3:4337899-4337921 TTGGGGGTTTACTGGGAGGGAGG - Intronic
949650603 3:6154741-6154763 GTTTGGGTATCCAGGGAAGGTGG - Intergenic
950793824 3:15494603-15494625 TTGTGGGAGGGCAGGGAGTGGGG - Intronic
951291200 3:20874060-20874082 TTGTGGGGTTGGGGGGAGGGGGG - Intergenic
951655337 3:25001105-25001127 GTGTGAGGATGGAGGGAGGGAGG + Intergenic
952002337 3:28800558-28800580 TTGTGGGTAGGCTGGCAGGCTGG - Intergenic
952184956 3:30958545-30958567 GTGTGGAGATGAAGGGAGGGAGG - Intergenic
952967703 3:38631387-38631409 TTGTGGGGCTGCAGGCAGCGTGG + Intronic
952980121 3:38727536-38727558 CTGTGGCTCTGCAGGGATGGTGG + Intronic
953903717 3:46857767-46857789 AGGTGGGTAGGAAGGGAGGGAGG + Intergenic
954426822 3:50447749-50447771 TTCTGGGCAAGCAGGCAGGGAGG - Intronic
955171845 3:56573733-56573755 TAGTGGTTAGCCAGGGAGGGAGG + Intronic
955429438 3:58827408-58827430 TTGTGTGTATGTTGGGTGGGGGG + Intronic
955542735 3:59994988-59995010 TTGTGGGTACGAAAGGAGAGAGG + Intronic
957153416 3:76516286-76516308 GTGTGGGTATGGAGGTAGGATGG - Intronic
959160655 3:102720683-102720705 TTGTGGGTATGCATAGATGTGGG + Intergenic
959881491 3:111448681-111448703 TTGTTGGTGTGCAGGGGGGCAGG + Intronic
960384619 3:117007163-117007185 TTGTGGGGGTGGAGGGAGGGAGG - Intronic
960619748 3:119626513-119626535 TTGTGGGGATGCTGTGAGGCTGG + Intronic
961012694 3:123447135-123447157 CTGTGGGAATGCAGTGAGGAAGG - Intronic
961636189 3:128334727-128334749 TTCTGGGGAAGGAGGGAGGGAGG - Intronic
962844177 3:139260647-139260669 AGGGGGGTAGGCAGGGAGGGAGG + Intronic
963052254 3:141152233-141152255 CTGTGGGAATGCAGGGAGCCTGG - Intergenic
963266314 3:143243374-143243396 TTGTGAGGATGCAGGGAAAGAGG + Intergenic
963600200 3:147371984-147372006 TTGGGGGTATGGTGGGAGCGGGG + Intergenic
965023095 3:163260610-163260632 GTGGGGGGAAGCAGGGAGGGAGG - Intergenic
965404081 3:168249350-168249372 GAGTGTGTATGCTGGGAGGGGGG + Intergenic
965404535 3:168252845-168252867 TGGTGGGTATGGAGAGAGGTTGG + Intergenic
965668313 3:171119794-171119816 TTGTGGGGTTGGGGGGAGGGAGG + Intronic
965941479 3:174187856-174187878 TTGTGGGTTTGTTGGGAGGGTGG + Intronic
966064127 3:175796052-175796074 TGGTGGTTTGGCAGGGAGGGAGG + Intronic
966130586 3:176633687-176633709 CTGTGGGAATGCAGGAAGGTGGG + Intergenic
967239554 3:187424551-187424573 TTGTGGGGTGGCAGGGGGGGAGG - Intergenic
967899980 3:194440054-194440076 ATGTGGGTAGGGAGGGAGGGAGG + Intronic
968310222 3:197676823-197676845 TTTTAGGGATACAGGGAGGGGGG - Intronic
968434302 4:576715-576737 TTATGGGGATGCAGGGAGAGGGG + Intergenic
969298844 4:6285390-6285412 ATGGGGGCATCCAGGGAGGGGGG + Intronic
969523403 4:7691978-7692000 TGGGGGGCAAGCAGGGAGGGAGG - Intronic
969656396 4:8501202-8501224 TTGTGCATGTGCAGGGCGGGAGG + Intergenic
969699703 4:8761437-8761459 TTGTGGGGCTCCAGGGAGGGTGG - Intergenic
969870977 4:10104659-10104681 GTGTGTGTATGCCGGGAGGGAGG - Intronic
970558451 4:17259269-17259291 TTGTGGGGGTGGGGGGAGGGGGG - Intergenic
971537553 4:27772526-27772548 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
975343078 4:73262848-73262870 TATTGGGTTTGCAGGGATGGGGG + Intergenic
975820241 4:78263423-78263445 GTGAGCGTATGCAGGGAGGGAGG - Intronic
975985402 4:80197560-80197582 TTGGGGGGGTGGAGGGAGGGAGG - Intronic
976338232 4:83915773-83915795 TTGTTTGTTTGCAGGGTGGGAGG - Intergenic
977504261 4:97882016-97882038 TTGTGTGTGTGTGGGGAGGGGGG - Intronic
978503977 4:109436828-109436850 ATGTGGAGATGCTGGGAGGGTGG + Intronic
979041995 4:115810133-115810155 GTGAGGGTCTGCGGGGAGGGTGG + Intergenic
980101156 4:128542818-128542840 TTGTGTGGAAGCAGGGAGGCTGG - Intergenic
981909916 4:149967235-149967257 TTGTGTGTGTGCATAGAGGGCGG - Intergenic
982062707 4:151620855-151620877 TTCTCGGTGTGTAGGGAGGGTGG - Intronic
983343749 4:166500924-166500946 TTGTGTTTATGCAGGGACAGAGG + Intergenic
983926636 4:173409883-173409905 TTAAGAGTATGCAGGGAGGCTGG - Intergenic
984401583 4:179272303-179272325 TGGTGGGGAGGCAGGGAGGCAGG + Intergenic
984705594 4:182845062-182845084 ATGTGGGGACCCAGGGAGGGAGG - Intergenic
985159631 4:187031132-187031154 TTGTGGGATGGGAGGGAGGGGGG - Intergenic
985485509 5:146268-146290 GTGTGGGAAAGGAGGGAGGGGGG - Intronic
985640157 5:1059806-1059828 GAGTGAGTGTGCAGGGAGGGAGG - Intronic
985641458 5:1065266-1065288 TTGTGGGTAGGCATGGCTGGCGG - Exonic
986686751 5:10281618-10281640 TTGTGGGTTAGCATGGAGGTGGG + Intronic
987034449 5:14006015-14006037 GTGTGGGTCTGCAAGGGGGGTGG - Intergenic
987192139 5:15489381-15489403 CTGTTGGTATCCAGTGAGGGAGG + Intergenic
988820010 5:34873712-34873734 TTGTGGGTATCCAGGGATGTGGG - Intronic
989448024 5:41553906-41553928 ATGTGGGGATGCAGGGGGAGTGG + Intergenic
990182309 5:53174594-53174616 GTGTGGGAAGGGAGGGAGGGAGG - Intergenic
990497533 5:56363487-56363509 TTGTGTGTGTGCAGGGAGGAGGG - Intergenic
990908385 5:60827872-60827894 TTCTGGGTGTGCAGGAAGGATGG - Intronic
992047553 5:72909372-72909394 TTTGGGGTGGGCAGGGAGGGAGG + Exonic
992492039 5:77254910-77254932 TTTTGGGGAGACAGGGAGGGTGG + Intronic
992674518 5:79092333-79092355 TTGTGGGGATTGAGGGAGGTGGG - Intronic
992970290 5:82049395-82049417 TTGTGGGGGTGGGGGGAGGGGGG + Intronic
993045277 5:82859323-82859345 GTGTGTGTATGTTGGGAGGGAGG - Intergenic
993275399 5:85850501-85850523 CTGTGGTTATGCAGGGCAGGGGG + Intergenic
993845383 5:92935984-92936006 TCCTGGGTATGGAGGGAGGTAGG + Intergenic
994731600 5:103498385-103498407 TTTTAGGTCTGCAGGGAGGTAGG + Intergenic
995052981 5:107727388-107727410 TTGTGCGTGTGTAGGGAGAGGGG + Intergenic
995853601 5:116572513-116572535 GCGTGGCTATCCAGGGAGGGAGG - Intronic
996032456 5:118721226-118721248 TTGGGGGGAAGGAGGGAGGGGGG + Intergenic
996081816 5:119265912-119265934 TTGTGGGGATCAAGGGTGGGAGG + Intergenic
996619631 5:125484366-125484388 TTGGTGGTTTGGAGGGAGGGAGG + Intergenic
996747660 5:126858817-126858839 TGGTGGGTCAGCAGGGAGGGCGG - Intergenic
997622133 5:135305761-135305783 TTGTGGGGTGGCAAGGAGGGTGG + Intronic
998025943 5:138816510-138816532 TGGTGGGAATGCAGGGAAAGGGG - Intronic
998375517 5:141688100-141688122 TTGGTGGTTTGCAGGGAGGTAGG - Intergenic
1000441632 5:161270737-161270759 TGGTGGGCATGGAGAGAGGGGGG + Intergenic
1000613702 5:163404629-163404651 GTGTGTGTAAGGAGGGAGGGGGG - Intergenic
1001799342 5:174529725-174529747 TTGTGGGGAAGCAGGCAGTGAGG + Intergenic
1001827065 5:174753525-174753547 GTGTGTGTGTGTAGGGAGGGAGG + Intergenic
1002644352 5:180645898-180645920 TTGGGGGTGGGCAGGGAGAGGGG - Intronic
1002784146 6:388740-388762 TTCTGGGTGTACAAGGAGGGTGG - Intergenic
1002819077 6:706955-706977 GTGTGTGTATGCAGGGGGTGGGG - Intergenic
1002877051 6:1220014-1220036 CTGTAGGTATGAAGGTAGGGAGG + Intergenic
1003687489 6:8318745-8318767 ATGTGTGTATGGAGGGAGAGGGG - Intergenic
1003880481 6:10475789-10475811 TTTTGGGTTTGCAGGGGGTGGGG - Intergenic
1004031596 6:11875488-11875510 TTGTGGGCTTGGAGGGAGGGCGG - Intergenic
1004269970 6:14186256-14186278 GTGTGCGTTTTCAGGGAGGGGGG - Intergenic
1004309542 6:14532261-14532283 TTCTGGGTTTGCAGGAGGGGAGG - Intergenic
1005430407 6:25750776-25750798 TTGTGTGTGTGGGGGGAGGGGGG + Intergenic
1006175240 6:32117451-32117473 CTGTGGGTGGGCAAGGAGGGTGG - Intronic
1007374859 6:41449620-41449642 TTGGGGCCATGCAGAGAGGGCGG + Intergenic
1007515813 6:42410633-42410655 ATGTGGTGATGGAGGGAGGGGGG - Intronic
1007521648 6:42454652-42454674 GTGTGTGTGTGCTGGGAGGGAGG - Intergenic
1007615381 6:43176690-43176712 GTGGGGGAAGGCAGGGAGGGAGG - Intronic
1009522797 6:64705824-64705846 TTGTGGGGTGGGAGGGAGGGGGG + Intronic
1010127855 6:72454871-72454893 TTGTTGGTTTGCTGGGTGGGTGG - Intergenic
1010629885 6:78186679-78186701 GTATGGGGAGGCAGGGAGGGAGG - Intergenic
1011627741 6:89297054-89297076 TTGTGGGTGTGCACCGAGTGTGG - Intronic
1011879008 6:91999620-91999642 TTGTGGGTATGCTTGCATGGGGG - Intergenic
1013463972 6:110400750-110400772 TTATGGGTAATCAGGGAAGGCGG - Intronic
1014153225 6:118082942-118082964 TGGTGGGTATGCTGGGGGCGGGG - Intronic
1015499286 6:133915285-133915307 TTGTGGATATGGAGGGCTGGTGG - Intergenic
1016660891 6:146578570-146578592 TTGTGGGGTTGTGGGGAGGGGGG - Intergenic
1016874784 6:148853891-148853913 TTTTGGGTATGCAGGGGGTAGGG - Intronic
1017689257 6:156946685-156946707 TTGTTGGAATAGAGGGAGGGAGG + Intronic
1018650030 6:165985840-165985862 GTGTGGGGAAGAAGGGAGGGTGG - Intronic
1018840362 6:167512196-167512218 TTGTTGGGAGGCAGGGAGAGTGG + Intergenic
1019092723 6:169553020-169553042 GTGTGTGTATGCAGGGAGGTGGG + Intronic
1019092736 6:169553088-169553110 GTGTGTGTATGCAGGGAGGTGGG + Intronic
1019103571 6:169650737-169650759 TGGTGGGGATGGAGGGATGGAGG - Intronic
1019594811 7:1853629-1853651 GTGTGGGTGTGCAGGGCGGCGGG - Intronic
1019772935 7:2895051-2895073 ATCTGGGTCTGCAGGGAGGAGGG + Intergenic
1020036516 7:4966614-4966636 TTGTGGAGGTGCCGGGAGGGTGG + Intergenic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1020164841 7:5799668-5799690 ATGTGGAGATGCCGGGAGGGTGG - Intergenic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020556192 7:9673475-9673497 GTGTGTGTATGCAAGGAGGGTGG + Intergenic
1021121737 7:16803234-16803256 TTGTGAGTGAGGAGGGAGGGAGG + Intronic
1021309694 7:19078588-19078610 CTGTGGGTGTGTAGGGAGAGGGG + Intronic
1022010273 7:26302687-26302709 TTGTGGGTATGCAGCAAAAGTGG - Intronic
1022505875 7:30908417-30908439 TTGGGGGTGGGGAGGGAGGGAGG - Intergenic
1022886759 7:34654697-34654719 GTGTGTGTGTGTAGGGAGGGGGG + Intergenic
1024254292 7:47528288-47528310 CTGGGGGTCTGCAGGGAAGGAGG + Intronic
1024342447 7:48281218-48281240 ATATGATTATGCAGGGAGGGAGG + Intronic
1024452208 7:49560245-49560267 TTGTGGGTTGGGGGGGAGGGGGG + Intergenic
1024791316 7:52967832-52967854 ATGTGGGGATACAGGGAAGGGGG - Intergenic
1025212180 7:57026072-57026094 TTCTGAGTCTGAAGGGAGGGAGG - Intergenic
1025606667 7:63044517-63044539 TAGTAGGGATGCAGGGAAGGGGG - Intergenic
1025659774 7:63550756-63550778 TTCTGAGTCTGAAGGGAGGGAGG + Intergenic
1025943525 7:66089743-66089765 GGGTGGGCATGCGGGGAGGGTGG + Intronic
1026606395 7:71819654-71819676 TGTTGGGTTTGCAGTGAGGGAGG - Intronic
1026833102 7:73622028-73622050 TTGTTGGAAGGAAGGGAGGGAGG - Intronic
1028243786 7:88451934-88451956 TCTTGGGTATGAGGGGAGGGAGG - Intergenic
1028415790 7:90579208-90579230 ATGAGGGAATACAGGGAGGGAGG + Intronic
1029788406 7:102816758-102816780 ATGTGGGGAGGCAGGGAGGATGG - Intronic
1030183492 7:106735785-106735807 TTGTGGGTCAGAAGGGAGTGAGG - Intergenic
1031144743 7:117985394-117985416 TTGTGGGGTTGCGGGGAGGGGGG + Intergenic
1032360820 7:131253219-131253241 TTGGGGTTGGGCAGGGAGGGAGG - Intronic
1032511619 7:132477236-132477258 GTGTATGTATGCAGGGAGGTGGG - Intronic
1032799197 7:135304967-135304989 TAATAGGTTTGCAGGGAGGGAGG + Intergenic
1032851448 7:135799005-135799027 TGGTTGGTATGGAGGCAGGGTGG - Intergenic
1033193693 7:139308366-139308388 TTGTGAGTATACTGGGAGGCAGG - Intergenic
1033485169 7:141781836-141781858 TTTTAGGTAAGTAGGGAGGGAGG - Intronic
1034673125 7:152872367-152872389 TGGTGGCCATGCAGGAAGGGTGG + Intergenic
1034673181 7:152872555-152872577 TGGTGGCCATGCAGGAAGGGTGG + Intergenic
1034690526 7:153010186-153010208 TTGTGGGTCCGCAGGAAGAGGGG + Intergenic
1034753106 7:153589081-153589103 TTCTGGGTTGGCAGGGAGTGAGG - Intergenic
1034942336 7:155238567-155238589 TTGTGGGTTTACAGGGATGAGGG - Intergenic
1034971581 7:155423021-155423043 TTGAGGGTGTGTAGGGCGGGAGG - Intergenic
1035017243 7:155777389-155777411 TTGTGGGTATTGAGTGAGGTCGG - Exonic
1035384617 7:158462293-158462315 TTATGGGCCTGCTGGGAGGGAGG - Intronic
1037735911 8:21566009-21566031 TTGTGGGTGTGAACAGAGGGTGG + Intergenic
1037877765 8:22556777-22556799 TTCTGGGTGTGCTGGGAGGCAGG - Exonic
1037880770 8:22572441-22572463 TTGTGGGTATGTGGGCAGGCCGG + Exonic
1038638169 8:29303850-29303872 TTTTTAATATGCAGGGAGGGAGG - Intergenic
1039418681 8:37417831-37417853 TTGTGTGTATGCAGTGGGGAGGG - Intergenic
1040015495 8:42696028-42696050 TTGTGGGAATGCAAGGAGGAAGG - Intergenic
1040771197 8:50977889-50977911 TTGTGGGGGTGTGGGGAGGGGGG + Intergenic
1042508704 8:69589225-69589247 TTGTGGATACGCAGGGTGGAAGG - Intronic
1043023589 8:75037689-75037711 TTGAGGGTATGTGGGCAGGGTGG - Intergenic
1045154995 8:99458061-99458083 TTGTGGGGTTGGGGGGAGGGGGG - Intronic
1045535927 8:103027839-103027861 CTGTGTGTGTGCAGGGAGGGTGG - Intronic
1046631425 8:116626265-116626287 TTGTGTGTATGCAGAGCGAGAGG - Intergenic
1047484543 8:125317114-125317136 TTGAGGGTATTCTGGGAAGGTGG - Intronic
1047832273 8:128647764-128647786 ATGTAGGTGGGCAGGGAGGGAGG - Intergenic
1048695800 8:137026389-137026411 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1049224723 8:141444738-141444760 TTTTGGGCATGCAGAGAGAGTGG + Intergenic
1049353503 8:142176689-142176711 TTATGGGTGTGCAGGGAGTGGGG - Intergenic
1049514097 8:143044427-143044449 TTGTGGGTCTGCAGGGACAGGGG - Intronic
1049776476 8:144408184-144408206 TGGTGGGGATGGAGGGAGGTAGG - Intronic
1051330856 9:16023834-16023856 TTGTGGGGGTGGGGGGAGGGTGG - Intronic
1051356008 9:16240232-16240254 TTTTGGGTATTCAGGGATGGGGG - Intronic
1051507522 9:17842820-17842842 GTGAGTGTATGCTGGGAGGGAGG - Intergenic
1053518731 9:38754831-38754853 TTGTTTGAATGGAGGGAGGGAGG - Intergenic
1055347314 9:75352527-75352549 TTGTAGGGATGCAGCTAGGGCGG + Intergenic
1056660012 9:88536248-88536270 TGGTTGGTTTGCTGGGAGGGAGG + Intronic
1057698992 9:97349366-97349388 TTTTGTGTCTACAGGGAGGGGGG - Intronic
1057769663 9:97956439-97956461 TTGTTCTTATGCAGGGAGGCTGG + Intergenic
1057945461 9:99324176-99324198 TTGTGGGTTTCCAGGGATGCAGG + Intergenic
1059036876 9:110763690-110763712 GTGTGCCTGTGCAGGGAGGGAGG + Intronic
1059287840 9:113191711-113191733 TTGTGTGTGTGAAAGGAGGGAGG + Intronic
1059605570 9:115831245-115831267 TTGTGTGTGTGCGGGGAGGGGGG - Intergenic
1060725338 9:126002508-126002530 TGGTGTGTATGGAGGAAGGGTGG + Intergenic
1061623513 9:131826722-131826744 TTGTGTGTAGGGAGGGATGGGGG - Intergenic
1062254546 9:135614817-135614839 TGGTGGGAGTGCAGGGATGGAGG + Intergenic
1062588704 9:137263429-137263451 TTGGGGGGAAGGAGGGAGGGAGG - Intronic
1186137024 X:6532789-6532811 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137045 X:6532848-6532870 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137056 X:6532878-6532900 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137068 X:6532911-6532933 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137087 X:6532970-6532992 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137106 X:6533029-6533051 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137118 X:6533062-6533084 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137129 X:6533092-6533114 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137141 X:6533125-6533147 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137152 X:6533155-6533177 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137164 X:6533188-6533210 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137176 X:6533221-6533243 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137187 X:6533251-6533273 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137198 X:6533281-6533303 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137218 X:6533343-6533365 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137240 X:6533405-6533427 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137252 X:6533438-6533460 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137263 X:6533468-6533490 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137275 X:6533501-6533523 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137287 X:6533534-6533556 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137303 X:6533571-6533593 TGGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186267141 X:7844168-7844190 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267155 X:7844205-7844227 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267177 X:7844267-7844289 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267199 X:7844329-7844351 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267211 X:7844362-7844384 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267222 X:7844392-7844414 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267234 X:7844425-7844447 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267245 X:7844455-7844477 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186297738 X:8169171-8169193 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297750 X:8169204-8169226 GTGTGGGGAGGGAGGGAGGGGGG - Intergenic
1186297764 X:8169237-8169259 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297776 X:8169270-8169292 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297788 X:8169303-8169325 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297800 X:8169336-8169358 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297812 X:8169369-8169391 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297824 X:8169402-8169424 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297836 X:8169435-8169457 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297858 X:8169497-8169519 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297870 X:8169530-8169552 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297882 X:8169563-8169585 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297904 X:8169625-8169647 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297926 X:8169687-8169709 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297940 X:8169724-8169746 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297952 X:8169757-8169779 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297964 X:8169790-8169812 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297978 X:8169827-8169849 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186298004 X:8169897-8169919 TGGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186301918 X:8208564-8208586 TTGTGGATAGTCAGGGAGTGGGG - Intergenic
1186324846 X:8466535-8466557 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324882 X:8466630-8466652 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324955 X:8466838-8466860 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324967 X:8466871-8466893 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324978 X:8466901-8466923 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324989 X:8466931-8466953 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325001 X:8466964-8466986 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325014 X:8466997-8467019 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325036 X:8467059-8467081 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325117 X:8467296-8467318 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186749337 X:12605623-12605645 ATGTGGGGTTGCAGGCAGGGTGG - Intronic
1188862212 X:35271336-35271358 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1189308905 X:40006526-40006548 TTGAGGGTGTGCAGGGTGCGGGG - Intergenic
1189485779 X:41430646-41430668 TGGTGGGAATGGAGGGTGGGGGG - Intergenic
1189655118 X:43236963-43236985 TAGTGAGTATGCTGGGAAGGTGG - Intergenic
1190064071 X:47228679-47228701 TGGTGGGTAAGCAGGTAGGTGGG - Intronic
1191712012 X:64159936-64159958 TAGTGGCTAAGGAGGGAGGGAGG + Intergenic
1192213740 X:69143560-69143582 TTGGGTGGTTGCAGGGAGGGTGG + Intergenic
1192639744 X:72850445-72850467 GTGTGTGTATGGGGGGAGGGGGG - Intergenic
1192641967 X:72870360-72870382 GTGTGTGTATGGGGGGAGGGGGG + Intergenic
1195275330 X:103275806-103275828 TTCTGTGTATGTGGGGAGGGAGG - Intronic
1195280647 X:103329913-103329935 TTGTGGTTGTGCTGAGAGGGAGG - Intergenic
1195667051 X:107441018-107441040 ATGTGGCTAGGCAGAGAGGGTGG + Intergenic
1195828916 X:109033567-109033589 TTGTGGGTATGGGGGATGGGTGG + Intergenic
1196410279 X:115411285-115411307 TTGTGGTTAGGGAGGGAGGGAGG + Intergenic
1197723454 X:129760388-129760410 GTGTGTGTAGGCAGGGTGGGGGG - Intronic
1198500317 X:137238217-137238239 AAGTGGGTAGGCAGGAAGGGAGG - Intergenic
1198804617 X:140481515-140481537 CTGTGTGTAAGAAGGGAGGGAGG + Intergenic
1198977307 X:142351288-142351310 GTGTGGGTTGGAAGGGAGGGTGG - Intergenic
1201387881 Y:13463010-13463032 TTGTGGGGTTGGGGGGAGGGGGG - Intronic
1201438432 Y:13984951-13984973 AAGGTGGTATGCAGGGAGGGAGG - Intergenic
1201438458 Y:13985038-13985060 TGGTGTGTAGGGAGGGAGGGAGG - Intergenic
1201438492 Y:13985154-13985176 TGGTGTGTAGGGAGGGAGGGAGG - Intergenic
1201438598 Y:13985491-13985513 TGGTGGGTGGGCAGGGAGGGAGG - Intergenic
1201438611 Y:13985524-13985546 TGGTGTGTAGGGAGGGAGGGAGG - Intergenic
1201445962 Y:14057184-14057206 TGGTGTGTAGGGAGGGAGGGAGG + Intergenic
1201445975 Y:14057217-14057239 TGGTGGGTGGGCAGGGAGGGAGG + Intergenic
1201446081 Y:14057554-14057576 TGGTGTGTAGGGAGGGAGGGAGG + Intergenic
1201446115 Y:14057670-14057692 TGGTGTGTAGGGAGGGAGGGAGG + Intergenic
1201446141 Y:14057757-14057779 AAGGTGGTATGCAGGGAGGGAGG + Intergenic
1202198856 Y:22326125-22326147 TTTTGGTTTTGCAGAGAGGGAGG - Intronic