ID: 1078199496

View in Genome Browser
Species Human (GRCh38)
Location 11:9167419-9167441
Sequence TTTCAAGTAGAGGACATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078199496_1078199499 -2 Left 1078199496 11:9167419-9167441 CCTGCCATGTCCTCTACTTGAAA 0: 1
1: 0
2: 2
3: 15
4: 225
Right 1078199499 11:9167440-9167462 AATGCTCTTCTTATAGCTCCAGG 0: 1
1: 0
2: 0
3: 14
4: 131
1078199496_1078199500 -1 Left 1078199496 11:9167419-9167441 CCTGCCATGTCCTCTACTTGAAA 0: 1
1: 0
2: 2
3: 15
4: 225
Right 1078199500 11:9167441-9167463 ATGCTCTTCTTATAGCTCCAGGG 0: 1
1: 0
2: 1
3: 15
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078199496 Original CRISPR TTTCAAGTAGAGGACATGGC AGG (reversed) Intronic
902185129 1:14719313-14719335 TTTGATGTTGGGGACATGGCAGG + Intronic
902195129 1:14792679-14792701 TTTAAGGTCCAGGACATGGCTGG + Intronic
905673018 1:39805051-39805073 CTTTAAGTAGAGGACAGGGAGGG - Intergenic
906721526 1:48008825-48008847 ATTCAAGTAGAGGAAAGAGCAGG - Intergenic
907224557 1:52933075-52933097 TTTCTACTAGAAGAAATGGCTGG + Intronic
908232810 1:62122522-62122544 TTTAAAATAGAGGACACAGCAGG + Intronic
908701493 1:66907036-66907058 TTTCAAGTTGAGGAGATGATTGG - Intronic
908783640 1:67714256-67714278 GTTCAAATAGAGGGCCTGGCAGG - Intronic
913114962 1:115688587-115688609 TTTCAAGTAGAGGAAAAGCCAGG + Intronic
913261725 1:117004746-117004768 TTTCAGGTAGAAGGCATGACTGG - Intronic
913498247 1:119447914-119447936 TTTCATGCAGAGGACGGGGCAGG - Intergenic
916310045 1:163388172-163388194 TTCCATGGAGAGTACATGGCAGG - Intergenic
917057928 1:171004117-171004139 TTCCAAGCAGAGGGCAAGGCAGG + Intronic
918713478 1:187760488-187760510 TTTAAAGAAGAGGTCATGACTGG - Intergenic
919075281 1:192805955-192805977 TCTCCAGTAGAGGGCATGGTAGG + Intergenic
920759393 1:208767686-208767708 CTTGAGGTAGAGGATATGGCTGG + Intergenic
921708332 1:218348420-218348442 CATCAAGTACAAGACATGGCAGG - Intronic
922977833 1:229799791-229799813 CTTCAAGGAGCCGACATGGCTGG + Intergenic
922981576 1:229831453-229831475 TTCCAAGTGGAGGAAATGACAGG - Intergenic
923806093 1:237259617-237259639 TATTAAGTAGAGGAAATGACAGG - Intronic
924674536 1:246162176-246162198 TTTCAATTAGTGGTCATTGCGGG - Intronic
1063081021 10:2767187-2767209 TTTCAAACAGATGACAAGGCAGG - Intergenic
1063632217 10:7745035-7745057 TTACAAGTTGAGGACATGGCAGG + Intronic
1063892386 10:10643745-10643767 TTTCAGGTTGAGGAGAAGGCTGG - Intergenic
1065450445 10:25850935-25850957 TTTCAAGAAATAGACATGGCAGG - Intergenic
1066200631 10:33140193-33140215 TTACAAGAAGAGGAAAAGGCCGG - Intergenic
1073021078 10:100444445-100444467 TTTTAGGTAGAGACCATGGCAGG - Intergenic
1073555380 10:104445455-104445477 TTTCTATTAGAGGACATGGCAGG + Intronic
1073622496 10:105063744-105063766 TTTGAAGGAGGGGACATGGCTGG - Intronic
1074068775 10:110045056-110045078 TTTGAAGTAAAGTACCTGGCTGG + Intronic
1074568794 10:114606006-114606028 AGTCAAGCAGAGGCCATGGCAGG + Intronic
1074852875 10:117452950-117452972 CTTGAAGTAGATGAGATGGCTGG + Intergenic
1074972065 10:118547228-118547250 TTTTAATGAAAGGACATGGCTGG - Intergenic
1077826212 11:5810647-5810669 TTTAAGGAAGAGGAAATGGCCGG + Intronic
1078195440 11:9133319-9133341 TTTCCTGTAGGGGACATAGCAGG - Intronic
1078199496 11:9167419-9167441 TTTCAAGTAGAGGACATGGCAGG - Intronic
1083298477 11:61727905-61727927 TTCCAAGGAGAGGAGAGGGCTGG + Intronic
1084279679 11:68079807-68079829 TTCCAAGTCGAGGTCAGGGCTGG + Intronic
1085303620 11:75473015-75473037 TTCCAAGCAGAGGGAATGGCAGG + Intronic
1089606554 11:119644795-119644817 TTCCAAGTATTGGATATGGCTGG + Intronic
1090553354 11:127847090-127847112 TTTCCAGTACAGGACCTTGCAGG + Intergenic
1091471988 12:736747-736769 TTTAAAGTAGTGGTCAGGGCTGG + Intergenic
1093229029 12:16520459-16520481 TTTCAAGAAGAGCAGATGTCTGG + Intronic
1093375692 12:18424871-18424893 TTTAAAGTACAGGAAATGGTAGG - Intronic
1094479308 12:30869200-30869222 TTTCAAGAAGAAAACAAGGCTGG - Intergenic
1096798701 12:54095073-54095095 TTCCAAGTAGAGGGAGTGGCTGG + Intergenic
1098907407 12:76176319-76176341 TTTAAAATAGAGGACTGGGCCGG - Intergenic
1100137793 12:91575245-91575267 TATCAAGTAGAGGAAATGATAGG + Intergenic
1103009786 12:117449339-117449361 CTGCAAGTACAGGACATGGTGGG - Intronic
1103218987 12:119227382-119227404 TTTCAGGTGGAGGAAATAGCAGG - Intergenic
1103324800 12:120113314-120113336 TTTAAAATTGAGAACATGGCTGG - Intronic
1106072453 13:26425684-26425706 TTTCCACTACAGGACAAGGCTGG - Intergenic
1107913007 13:45123325-45123347 TTTCAAGAAGAGCTTATGGCAGG + Intronic
1111027377 13:82548443-82548465 TCTCAAGTAGAGGACAAAGCAGG + Intergenic
1111734162 13:92115952-92115974 TTACAAGAAGAGGAGATAGCTGG + Intronic
1112167522 13:96935485-96935507 TTTCAAGTATATGAAAGGGCGGG + Intergenic
1119294729 14:73523690-73523712 TTTCATGTAGAGGACACAGAAGG - Intronic
1119620049 14:76125259-76125281 TTCCAAGTAGGAGACAGGGCAGG - Intergenic
1122530028 14:102418983-102419005 CTGCAGGGAGAGGACATGGCGGG - Intronic
1125155123 15:36577271-36577293 TTTCATGTAAAAGTCATGGCAGG + Intergenic
1125234125 15:37491741-37491763 TTCCAGATAGAGGACATTGCTGG + Intergenic
1128272650 15:66325095-66325117 ATCAAAATAGAGGACATGGCCGG + Intronic
1128634411 15:69293968-69293990 CTTCAAGTACCGGACATGACAGG + Intergenic
1128820267 15:70645941-70645963 ATTCAAGCAGAAGACTTGGCTGG + Intergenic
1131229650 15:90650702-90650724 GTTCAAGGAAAGGACATGCCAGG + Intergenic
1131490803 15:92861118-92861140 TTTCATGTAGAGGACATCTGGGG - Intergenic
1131936345 15:97509799-97509821 ATCCAAAGAGAGGACATGGCTGG - Intergenic
1132043316 15:98543742-98543764 TTTAAACTAAAGGACAAGGCCGG + Intergenic
1132834802 16:1947375-1947397 TTTCATCTGCAGGACATGGCCGG + Exonic
1133194686 16:4160577-4160599 TTTCAAAATGAGGAAATGGCTGG - Intergenic
1133887666 16:9845674-9845696 TTCCAGGTAGAGGCAATGGCAGG - Intronic
1135326777 16:21531074-21531096 TCACAGGGAGAGGACATGGCTGG - Intergenic
1136337032 16:29616488-29616510 TCACAGGGAGAGGACATGGCTGG - Intergenic
1136748982 16:32616077-32616099 CATCAAGCAGAGGACATGGCAGG + Intergenic
1137238036 16:46631679-46631701 TTTCAAGCAATGGACATGGCAGG + Intergenic
1138128583 16:54458840-54458862 ATTCTAGTTGAGGAGATGGCAGG + Intergenic
1139550885 16:67672444-67672466 TTCCAGGCAGAGGACATGCCAGG + Intergenic
1141750614 16:85955537-85955559 TTTCAAGCAGAGGCCAGGGATGG + Intergenic
1142039828 16:87885824-87885846 TCACAGGAAGAGGACATGGCTGG - Exonic
1203051115 16_KI270728v1_random:875291-875313 CATCAAGCAGAGGACATGGCAGG + Intergenic
1143128292 17:4658666-4658688 TTTCAACTAGAGGACTTTGCTGG - Intergenic
1144125833 17:12202249-12202271 TTTCAAGTGGAGGCCAAGGAAGG - Intergenic
1149199718 17:54169275-54169297 TTTCAAGTAAAGGATATGGAAGG - Intergenic
1153019839 18:617735-617757 TTTCAAGTACTTCACATGGCGGG + Intronic
1158231159 18:55256965-55256987 TTCCAGGTATAGGACCTGGCTGG + Intronic
1160078810 18:75703785-75703807 CACCAAGCAGAGGACATGGCAGG - Intergenic
1160978542 19:1806147-1806169 CTTCAAGCAGAAGAAATGGCAGG - Exonic
1162164406 19:8742756-8742778 TTTGAGGTAGAGGACACGCCAGG + Intergenic
1162165478 19:8750224-8750246 TTTGAGGTAGAGGACACGCCAGG + Intergenic
1162166543 19:8757680-8757702 TTTGAGGTAGAGGACACGCCAGG + Intergenic
1162167609 19:8765136-8765158 TTTGAGGTAGAGGACACGCCAGG + Intergenic
1162168548 19:8771434-8771456 TTTGAGGTAGAGGACACGCCAGG + Intergenic
1162169618 19:8778884-8778906 TTTGAGGTAGAGGACACGCCAGG + Intergenic
1162170297 19:8784198-8784220 TTTGAGGTAGAGGACACGCCAGG + Intergenic
1163527083 19:17828061-17828083 TTTCCAGTGGAGGACACGGAAGG - Intronic
1165903144 19:39178072-39178094 TTAGAAGTGGAGGACAGGGCCGG + Intronic
1166907509 19:46123019-46123041 TTTCAAGTTGAGGTCATGCTTGG - Intronic
1168038690 19:53740660-53740682 TTTTAAGTATAGGACAAGGCTGG + Intergenic
1168532708 19:57142435-57142457 TTTCAAGTAAAGCTCAAGGCTGG - Intronic
1168563453 19:57403280-57403302 TTCCAAGTAGAGTCCATGACTGG + Intronic
925661261 2:6205594-6205616 TTCCAAGAAGAGGAAATTGCTGG + Intergenic
927134798 2:20088919-20088941 TTTCTAGCAGAGACCATGGCTGG - Intergenic
927432211 2:23036343-23036365 TTTCTTTTAGAGGACAGGGCAGG - Intergenic
927566332 2:24116556-24116578 TTTCAACCTGAGGACCTGGCCGG + Intronic
927662461 2:25004609-25004631 TTTAAAGTGCAGGACTTGGCTGG + Intergenic
928202917 2:29262524-29262546 TTTCTAGTAAAAGACAGGGCTGG - Intronic
929119536 2:38473019-38473041 TTTCAGGCAGAGGAAATAGCAGG + Intergenic
929203063 2:39258226-39258248 TTTAAAATAAAGGATATGGCTGG - Intronic
929279483 2:40062232-40062254 TTTTTAGTAGGAGACATGGCAGG + Intergenic
929744171 2:44638472-44638494 TTTCACGTAAAGCAGATGGCAGG - Intronic
931593913 2:63919183-63919205 TTTCATGTGGAAGAGATGGCTGG - Intronic
931925157 2:67064487-67064509 TTTCAAGAAGAGAAAATGGCAGG - Intergenic
933230910 2:79806296-79806318 TTTCAGGTAGATGACTTGGGAGG + Intronic
933577146 2:84082222-84082244 TTTGAAGAAGAGGTCAGGGCTGG - Intergenic
934017599 2:87905327-87905349 TTTGAAATAGAGAATATGGCAGG + Intergenic
935140345 2:100347920-100347942 TTTTAAGTACAGGGCAAGGCTGG + Intergenic
935313667 2:101810102-101810124 TTTTAAGTGAAGGAAATGGCTGG + Intronic
935707209 2:105867556-105867578 TTTCTAATGGAGGACAAGGCAGG + Intronic
940838926 2:158557032-158557054 CACCAAGTAGATGACATGGCAGG - Intronic
941270557 2:163422176-163422198 TTCCAAGAAGAAGACATGGGAGG + Intergenic
942213838 2:173698553-173698575 TTTCTAGTAGTAGACATGCCAGG + Intergenic
942489936 2:176480043-176480065 TTTCAAGAGGGGGACATGGGAGG - Intergenic
944540493 2:200749318-200749340 CTTTAAGTTCAGGACATGGCAGG - Intergenic
944575609 2:201088445-201088467 TTTCAATTAAAAGAGATGGCTGG + Intergenic
945194334 2:207224203-207224225 TTTAAAGTACAGGTCACGGCCGG - Intergenic
945818827 2:214638086-214638108 TTTCAAGAATAGCACATCGCTGG + Intergenic
946105703 2:217367779-217367801 TTCCAAGGAGAAGACATTGCTGG + Intronic
947189037 2:227482159-227482181 TTAAAAGTAGTGGACAAGGCTGG - Intronic
948904480 2:240971977-240971999 TCTCAAGGTGAGGACAGGGCAGG - Intronic
949078963 2:242081170-242081192 TTTTAAGTAGAGAGCAGGGCTGG + Intergenic
1168820833 20:772827-772849 TGTCAAGGAGAGGACATGAAGGG + Intergenic
1169082655 20:2806626-2806648 TTTGCAGGAGAGGACATGGCAGG + Intergenic
1169732970 20:8806469-8806491 TTGCAAGTAGAGGAGATGAGAGG - Intronic
1171797717 20:29579271-29579293 TTCCAAGTAGAGGGAGTGGCTGG - Intergenic
1171850530 20:30304890-30304912 TTCCAAGTAGAGGGAGTGGCTGG + Intergenic
1172670532 20:36632013-36632035 TTAGAAGTAGAGGAGATGGGGGG - Intronic
1173833057 20:46105101-46105123 TTTTAAGCAGAGGAAATGGGAGG - Intergenic
1175561973 20:59938860-59938882 TTTCAAGTAGAAGACAGGATGGG + Exonic
1175695740 20:61101579-61101601 CAGGAAGTAGAGGACATGGCTGG - Intergenic
1176378508 21:6099925-6099947 ATTCAATTATGGGACATGGCCGG + Intergenic
1179369603 21:40792418-40792440 ATTTAAGAAGAGGAGATGGCCGG - Intronic
1179744967 21:43438311-43438333 ATTCAATTATGGGACATGGCCGG - Intergenic
1180217247 21:46333135-46333157 TTTAAAGTAGAATTCATGGCCGG + Intronic
1181177611 22:21046561-21046583 TTTGTAGTAGAAGTCATGGCTGG - Intronic
1182989398 22:34752437-34752459 TTTCAGGTGGAGGAAATAGCTGG - Intergenic
1183127437 22:35797844-35797866 AGTGAAGTAGAGGACATTGCAGG - Intronic
1184093954 22:42306486-42306508 TGTCAAGTAGAGGTAATGGAGGG - Intronic
950388142 3:12675804-12675826 TTTCCAACAGAGGAAATGGCAGG - Intergenic
953411234 3:42691571-42691593 TCTCAAGGAGAGGACATTGATGG + Intronic
953519366 3:43626595-43626617 TTAAAAGTAAAGAACATGGCTGG - Intronic
953858580 3:46522076-46522098 TTTAAAAGATAGGACATGGCTGG + Intronic
956572011 3:70706724-70706746 TTTAAAGTAGAGGACATTTTTGG - Intergenic
958673503 3:97235002-97235024 TTTCAAGTAGAGGAAACTGCTGG - Intronic
959147374 3:102565263-102565285 TTATAAGAAGAGGAAATGGCCGG - Intergenic
959498758 3:107081139-107081161 TTTAAAGTAGAGTTCCTGGCCGG + Intergenic
959923057 3:111891108-111891130 TTTCAAGTAGAGGACATTAATGG + Intronic
961108367 3:124261413-124261435 TTTCAAGTAAGGGGCATAGCTGG - Intronic
967658782 3:192079830-192079852 TTTCAAGTAGCTGCCATGGGGGG - Intergenic
970333873 4:15011533-15011555 TTCCAAGTAGTGCACATTGCTGG - Intronic
970407428 4:15777440-15777462 TCCCAAGCAGAGGAAATGGCAGG - Intergenic
974493247 4:62594175-62594197 TTTCAGGTAGAGAACATTGGTGG + Intergenic
977370358 4:96126638-96126660 TTTCAAGAAAAAGACATGGCAGG + Intergenic
977660676 4:99581558-99581580 TTTCAAGTAGAGGACCCACCAGG - Intronic
978468398 4:109033657-109033679 TTTCATGAAGAGCACATAGCAGG + Intronic
978755889 4:112302512-112302534 TTTTAAGTAGAGGGCAGGGGAGG - Intronic
979494399 4:121368313-121368335 TTTAAAGTAAAGGAGATGGTAGG - Intronic
979890118 4:126081876-126081898 TTTCAAGTAGAAGAAATATCAGG + Intergenic
983377003 4:166942453-166942475 TTTTAAGTGGAGGCCAAGGCAGG - Intronic
983617988 4:169728807-169728829 TTAAAAGTAGAGGGCAGGGCCGG - Intergenic
983734886 4:171044451-171044473 TTTTAAGCAGTGCACATGGCAGG + Intergenic
989098777 5:37805707-37805729 TTTCCAGCAGAGAAAATGGCTGG + Intergenic
989246840 5:39264612-39264634 TTTCAAGCTGAGGAAGTGGCAGG - Intronic
993508841 5:88746112-88746134 TTTCAAAGAGAAGCCATGGCTGG + Intronic
997741555 5:136259298-136259320 TTCCCAGTGGAGGGCATGGCAGG - Intronic
999110017 5:149111221-149111243 TTTAAAGCAGAGGAGAGGGCAGG + Intergenic
1001778821 5:174350098-174350120 TTTTTATTAGAGGACATGCCAGG - Intergenic
1001780539 5:174365200-174365222 TTTCCATTACAGGACCTGGCTGG - Intergenic
1001990881 5:176114480-176114502 TGTCAAGCAGGGGACACGGCAGG + Exonic
1002225993 5:177723660-177723682 TGTCAAGCAGGGGACACGGCAGG - Exonic
1002267854 5:178047550-178047572 TGTCAAGCAGGGGACACGGCAGG + Exonic
1002462992 5:179385573-179385595 ATTCCAGTAGAGAACATAGCTGG - Intergenic
1005616551 6:27578552-27578574 TGTCAAGTATGGGACAGGGCAGG + Intergenic
1006101933 6:31690821-31690843 TTCCAAGGAAAAGACATGGCTGG - Intronic
1006196222 6:32244098-32244120 TTCCAAGGAGAGGTCAGGGCTGG - Intergenic
1007107326 6:39292792-39292814 TTTCATGCAGAGGAGAAGGCAGG - Intergenic
1008819674 6:55615934-55615956 TTTCAAGTGGGGGATAGGGCAGG - Intergenic
1009808489 6:68633131-68633153 ATTCAAGTAGAAGTCAGGGCAGG - Intergenic
1012645158 6:101669575-101669597 TTGCAAAGAGAAGACATGGCTGG + Intronic
1014047956 6:116915062-116915084 TTTCACGTAGAGTACATAACTGG + Intronic
1014877712 6:126681631-126681653 TATTGAGTAGAGGAGATGGCAGG + Intergenic
1015281529 6:131440026-131440048 TTTGAAGTAGTGGACATGTAGGG - Intergenic
1016733567 6:147452046-147452068 TTATTAGTAGAGGAAATGGCTGG - Intergenic
1017874868 6:158516213-158516235 TTCCAAGCTGAGGCCATGGCCGG + Intergenic
1018322340 6:162624830-162624852 TTTCAAGAAGAGAACACAGCAGG + Intronic
1020184456 7:5948166-5948188 TTTAAAGCAGAGGACCAGGCCGG - Intronic
1020298460 7:6776578-6776600 TTTAAAGCAGAGGACCAGGCCGG + Intronic
1023973239 7:45007305-45007327 ATGCATGCAGAGGACATGGCTGG - Intronic
1026975162 7:74493405-74493427 TTATAAGAAGAGGTCATGGCCGG - Intronic
1029651663 7:101897375-101897397 TTTCAAGTAGCTGACACGACAGG - Intronic
1030254103 7:107488172-107488194 TTTAAAATATAGCACATGGCAGG + Intronic
1030836747 7:114297085-114297107 TTTCAGGGAGAGGGCAGGGCAGG + Intronic
1032893193 7:136222052-136222074 TTGCAACAAGATGACATGGCAGG + Intergenic
1033393284 7:140949438-140949460 ATTCATGTAGAGGACAGGCCTGG - Intergenic
1033705843 7:143884352-143884374 TTTTATGTAAAGGAAATGGCAGG + Intronic
1035387457 7:158483839-158483861 TTTAAAGTATAGGAGTTGGCCGG + Intronic
1035537227 8:401176-401198 TTTTAAGTAGAGAGCAGGGCTGG + Intergenic
1037998214 8:23368641-23368663 TTTCCAGTAGAGTTCCTGGCAGG + Intronic
1039258820 8:35748662-35748684 TTTAAAGAAGAGGACACAGCAGG + Exonic
1040751803 8:50718563-50718585 TTACAAGAAAAGGACATGCCTGG - Intronic
1041826704 8:62102750-62102772 TCTCAAGCAGAGGCCTTGGCAGG - Intergenic
1043457223 8:80424724-80424746 TTCCAGGCAGAGGAAATGGCTGG - Intergenic
1046678721 8:117142629-117142651 TCCCAAGTAGAGGGCATTGCTGG - Intronic
1047960382 8:130007486-130007508 TTCAAAGTATATGACATGGCTGG + Intronic
1048390223 8:133956065-133956087 GTTCACCTAGAGGACATGGCAGG + Intergenic
1048488883 8:134873298-134873320 TTTAAAATACAAGACATGGCTGG - Intergenic
1052077218 9:24158123-24158145 ATTCAAGTAGAAGACTTGGATGG - Intergenic
1053133339 9:35632464-35632486 TTACAAATAGAGGAGAAGGCCGG - Intronic
1053358095 9:37464256-37464278 TATTAAGTAGAGGACATTACGGG - Intronic
1053788311 9:41668181-41668203 TTCCAAGTAGAGGGAGTGGCTGG + Intergenic
1054156830 9:61646587-61646609 TTCCAAGTAGAGGGAGTGGCTGG - Intergenic
1054176593 9:61879520-61879542 TTCCAAGTAGAGGGAGTGGCTGG + Intergenic
1054660942 9:67701286-67701308 TTCCAAGTAGAGGGAGTGGCTGG - Intergenic
1055533543 9:77212474-77212496 TTTCATTGAGAGGGCATGGCAGG - Intronic
1056719694 9:89061024-89061046 TTTCAGGCAGAGGCCAGGGCTGG + Intronic
1056753092 9:89365486-89365508 GGTCAAGCAGAGGCCATGGCCGG - Intronic
1057001361 9:91512928-91512950 TGTCAAGGTGAGGCCATGGCTGG + Intergenic
1057841806 9:98491956-98491978 CTTCAAGAAGGGGACCTGGCTGG + Intronic
1058442976 9:105027348-105027370 TTCCAAGTAGAGCACACAGCTGG - Intergenic
1059413141 9:114146385-114146407 TTTCAAGGGGAGGACAATGCGGG - Intergenic
1059969511 9:119650868-119650890 TTTCAGGTGGAGAACAAGGCAGG + Intergenic
1060873048 9:127058099-127058121 TTCCAGGCAGAGGAGATGGCTGG + Intronic
1061430019 9:130524840-130524862 TTTCTTGTAGAGGTGATGGCTGG - Intergenic
1185506544 X:635481-635503 TTTGTAGCAGAGGACAGGGCTGG - Intronic
1185569224 X:1120451-1120473 TTTCCAGTAGAGGGCATCCCTGG - Intergenic
1188525613 X:31084764-31084786 TTTCAGGTAGAAGACAGGGTTGG - Intergenic
1191256746 X:58282792-58282814 TTTCAGGGAGAGGTCAAGGCAGG - Intergenic
1193606850 X:83579578-83579600 TATCAAGTAGAGAAGATTGCTGG + Intergenic
1194133900 X:90114818-90114840 TTTCAAGTTGAGGTCATGCTTGG + Intergenic
1196390176 X:115198754-115198776 TTTCAGGGAGAGGACAGGACAGG - Intronic
1198453680 X:136793916-136793938 TTCAAAGTAGAGGTCAGGGCTGG - Intergenic
1199126883 X:144133218-144133240 TTTGAAATAGAGAATATGGCAGG - Intergenic
1199861927 X:151808740-151808762 TTTCAGGTAGAGGAGAGGGGCGG + Intergenic
1200479674 Y:3684931-3684953 TTTCAAGTTGAGGCCATGCTTGG + Intergenic