ID: 1078206908

View in Genome Browser
Species Human (GRCh38)
Location 11:9238096-9238118
Sequence TGATATGAATTCAACTTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078206908 Original CRISPR TGATATGAATTCAACTTGAG TGG Intronic
902318530 1:15642620-15642642 TGATATAAAAACAACTTGATAGG + Intronic
904145465 1:28387521-28387543 TGAAATAAATTCAAATTTAGAGG - Intronic
905746221 1:40420767-40420789 TGAGATGAATCCAAATTGAGGGG + Intronic
908707404 1:66974272-66974294 TGATATGAACACAACATTAGGGG - Intronic
910460095 1:87439648-87439670 TATTATGAATTCATCTTGTGTGG + Intergenic
911418135 1:97602460-97602482 TGAAATGAATTGAATTTGAGTGG + Intronic
912914266 1:113796600-113796622 TATTATAAATTCAACTTTAGTGG - Intronic
913570453 1:120114729-120114751 TTATGTGAGTCCAACTTGAGAGG - Intergenic
914291258 1:146275707-146275729 TTATGTGAGTCCAACTTGAGAGG - Intergenic
914552302 1:148726490-148726512 TTATGTGAGTCCAACTTGAGAGG - Intergenic
919363744 1:196630475-196630497 TGATATAAATCCAACAAGAGTGG + Intergenic
921492616 1:215797075-215797097 TGATATGAAGACACTTTGAGTGG + Intronic
921765422 1:218967126-218967148 TGATATGAAATTAACTTTACAGG - Intergenic
1063993627 10:11594913-11594935 TGATTTGAATACAGCTTGATGGG + Intronic
1066736962 10:38488382-38488404 TGGAATGAAATCAACTTGAGTGG + Intergenic
1066939073 10:41867526-41867548 TGGAATGAAATCAACTCGAGTGG + Intergenic
1066939846 10:41872451-41872473 TGGAATGAAATCAACTCGAGTGG + Intergenic
1066943162 10:41893476-41893498 TGGAATGAAATCAACTCGAGGGG + Intergenic
1069441678 10:68434332-68434354 TGATATGTGTTCAAATTGATAGG - Intronic
1077974656 11:7235182-7235204 AGGTATGAATTAAACTTGGGTGG + Intergenic
1078206908 11:9238096-9238118 TGATATGAATTCAACTTGAGTGG + Intronic
1080596531 11:33778413-33778435 TGGTATAAATACAACTTGGGTGG - Intergenic
1081013989 11:37853041-37853063 TGTTTTGACTTCAACGTGAGGGG + Intergenic
1089786314 11:120909770-120909792 TGATATGAATTAAAGTGTAGAGG + Intronic
1089841031 11:121417619-121417641 TGATCTTCCTTCAACTTGAGAGG - Intergenic
1090104597 11:123838980-123839002 TGATATGTATTAAATTTAAGTGG - Intergenic
1098672092 12:73244204-73244226 TGATGTGAATTCCAAGTGAGAGG - Intergenic
1102340207 12:112115593-112115615 TGGAATGAAGTCACCTTGAGGGG + Intergenic
1104264905 12:127222463-127222485 AGATATGAAATCAACCTAAGTGG - Intergenic
1106803407 13:33280320-33280342 TGATTTGAACTCAACTGGAGTGG - Intronic
1107974728 13:45678421-45678443 TGATACCATTTCAAGTTGAGGGG + Intergenic
1108929732 13:55803471-55803493 TGATCTGAATTCAAATATAGAGG + Intergenic
1109503061 13:63263701-63263723 TGATATTAGTTGAAATTGAGAGG + Intergenic
1110535079 13:76641940-76641962 TGGTAGGAAAACAACTTGAGAGG + Intergenic
1111261995 13:85752698-85752720 TGAAATAAATTTAACTTGACTGG - Intergenic
1112667915 13:101597965-101597987 TTATATGAATTGATCTTGAGGGG - Intronic
1112716063 13:102187427-102187449 TGATTTGAATAGAACTTGTGGGG + Intronic
1113278083 13:108757269-108757291 TGTGATGAATTCACCATGAGAGG + Intronic
1114910874 14:27194198-27194220 TGATAAGAAATCAACCTAAGTGG + Intergenic
1116375666 14:44196952-44196974 TGATATGATTTCAAATGAAGAGG + Intergenic
1117760120 14:59018470-59018492 AGATATACATTAAACTTGAGTGG + Intergenic
1120064798 14:80028246-80028268 AGATATCAATTCAACGTCAGAGG + Intergenic
1120684133 14:87518219-87518241 TGATACAATTTCATCTTGAGTGG - Intergenic
1124024860 15:25956373-25956395 CAATATGAATTCAACTTTAGTGG - Intergenic
1125115316 15:36084227-36084249 TTATATGAATTCATCTTTAAAGG - Intergenic
1125154566 15:36571207-36571229 TAATATAAATTCTACTTAAGAGG - Intergenic
1133929351 16:10219665-10219687 AGATATGGAATCAACCTGAGAGG - Intergenic
1139944772 16:70632783-70632805 TACTCTGAATTCACCTTGAGAGG - Intronic
1140249828 16:73286452-73286474 TGATTTGAAATCAAATTGTGTGG + Intergenic
1145343899 17:21976460-21976482 TGGAATGGATTCAACTCGAGTGG + Intergenic
1153614625 18:6923093-6923115 TGTTATGAATAAAACTTCAGTGG - Intergenic
1155625372 18:27828299-27828321 TGATGTGAAGTCAAGTTTAGTGG - Intergenic
1158193052 18:54852759-54852781 TGATATACACACAACTTGAGGGG - Intronic
1158919209 18:62170876-62170898 TGATATGAAGAAAATTTGAGTGG + Intronic
1159046027 18:63369159-63369181 TGATATCAATGCAAGTTTAGAGG + Intergenic
1162538467 19:11278289-11278311 TCATTTGAATTGAACCTGAGAGG + Intergenic
925804589 2:7635753-7635775 TCCTAGGAATTCAACTAGAGTGG - Intergenic
926539497 2:14157577-14157599 TTATTTGAATTCAACTTCATGGG + Intergenic
931366104 2:61620473-61620495 TGAAATGACTTCAAATTTAGTGG + Intergenic
934194989 2:89831473-89831495 TGCAATGGATTCAACCTGAGTGG - Intergenic
937568426 2:123326509-123326531 TAAAATGAATTCAACTTTAAAGG + Intergenic
939556161 2:143676252-143676274 TGATATGAAGAAAATTTGAGTGG - Intronic
940030713 2:149258714-149258736 TGACAGGAATTGAACTAGAGTGG + Intergenic
943735717 2:191352018-191352040 TAATATGAATTGAAGTTGAATGG + Intronic
943881607 2:193152504-193152526 TGATATGAAATTAACTTGATGGG - Intergenic
945777733 2:214128192-214128214 TGAAATGATTATAACTTGAGAGG - Intronic
1168880385 20:1201510-1201532 TTATATGAGTTCATCTTCAGGGG + Intergenic
1169817820 20:9676745-9676767 TGATATGAAATCATCTTGATTGG + Intronic
1170732175 20:18985045-18985067 TGCTATGAATTGAACTTGCCTGG - Intergenic
1171915996 20:31062628-31062650 TGGAATGAAATCAACCTGAGTGG + Intergenic
1171916202 20:31063958-31063980 TGGAATGAAATCAACCTGAGTGG + Intergenic
1171922174 20:31157755-31157777 TGGAATGGATTCAACTCGAGTGG + Intergenic
1173317066 20:41954630-41954652 TGTTAAGATTTCAACTTCAGAGG + Intergenic
1177885335 21:26739893-26739915 TGATATTGATTCAACATTAGTGG + Intergenic
1177944648 21:27452658-27452680 TGAGATTAATTCAACTTCATGGG - Intergenic
1180530391 22:16345493-16345515 TGTTATGAAATCAACTCGAGTGG + Intergenic
1185278196 22:49958892-49958914 TGACATGAACTCAACTGTAGTGG + Intergenic
1203319256 22_KI270737v1_random:40319-40341 TGTTATGAAATCAACTCGAGTGG - Intergenic
951574975 3:24104201-24104223 TGATGTGAAGTAAACTTCAGAGG + Intergenic
952336043 3:32403903-32403925 AGAGATGAATTCAGCTGGAGTGG + Intronic
956059617 3:65336307-65336329 AGATTTGAATTCTACTTCAGTGG + Intergenic
958509264 3:95024209-95024231 TCCTATGAATACAACTTGAATGG + Intergenic
958741064 3:98072755-98072777 TCATATGAATAAAACTTCAGTGG - Intergenic
958940165 3:100303242-100303264 AGAAATGAATCCAAATTGAGTGG - Intronic
964291132 3:155181716-155181738 TGATAGGAATTCATCTTTTGAGG + Exonic
964934768 3:162069641-162069663 TTATATGACTTCAACTTAATAGG - Intergenic
967354843 3:188557128-188557150 TGAGAAGAATTCAACATAAGAGG - Intronic
967831290 3:193922244-193922266 TGATATGAGTCCAATTTCAGTGG - Intergenic
969827764 4:9771616-9771638 TAAGATGACTTCACCTTGAGTGG + Intronic
969982541 4:11173071-11173093 TGGAATTAAGTCAACTTGAGTGG + Intergenic
970038497 4:11769025-11769047 TGATACCAATTCAACTTGTATGG + Intergenic
973353129 4:49115223-49115245 TGGTATGAAATCAACCCGAGTGG - Intergenic
973353248 4:49115981-49116003 TGGTATGGAATCAACCTGAGTGG - Intergenic
973354636 4:49124357-49124379 TGGTATGGAATCAACCTGAGTGG - Intergenic
973355940 4:49132144-49132166 TGGTATGGAATCAACCTGAGTGG - Intergenic
976594412 4:86881266-86881288 TGATAACAATTCAACTTCAGTGG - Intronic
977505824 4:97902878-97902900 AGATATGAAATCAACATAAGTGG + Intronic
981089235 4:140715433-140715455 TACTATGAATTCAACTTGCTGGG - Intronic
981221473 4:142241938-142241960 TTAAATGAATCCAACTTGATTGG + Intronic
981857002 4:149306778-149306800 TGAGATGAATACAGCTAGAGGGG + Intergenic
983421532 4:167524714-167524736 TGATATTAATTCTTCTTTAGTGG + Intergenic
983542608 4:168929124-168929146 TGATATAAATTAAAAGTGAGGGG + Intronic
984371605 4:178873728-178873750 TAAGAAGAATTCAACTTGACAGG + Intergenic
984580744 4:181507167-181507189 AGTTGTGAAATCAACTTGAGAGG - Intergenic
986772080 5:10983594-10983616 TGACATGCATTCAACCAGAGAGG - Intronic
989078045 5:37585956-37585978 TGATATAGTTACAACTTGAGGGG - Intronic
989654080 5:43725591-43725613 TGATATGGAGAAAACTTGAGTGG - Intergenic
990248114 5:53883602-53883624 TGCTGTGAAATTAACTTGAGTGG - Intergenic
990389960 5:55308507-55308529 TGATATGAATTGATTTGGAGGGG + Intronic
991997059 5:72398461-72398483 AGAGAGGAATTCAACTTGGGAGG + Intergenic
992735064 5:79711310-79711332 TGATCTGCTTTCAACTTCAGAGG + Intronic
994144329 5:96376090-96376112 AAATATGAATTCACCCTGAGAGG - Intergenic
994965998 5:106671704-106671726 AGCTATGGATTCAACTTGAATGG - Intergenic
996037967 5:118780004-118780026 AGATATGAATTCAACTCCTGGGG + Intergenic
997046752 5:130328518-130328540 AGATATGAAATCAACCTAAGTGG - Intergenic
1000769540 5:165335524-165335546 TGAAATAAAGTCATCTTGAGGGG - Intergenic
1000826678 5:166053921-166053943 AGACATGTATTCAACTTGATTGG + Intergenic
1002075729 5:176707327-176707349 TGATAAGAAATGAAATTGAGAGG - Intergenic
1007817584 6:44535433-44535455 TGAAATGCTTTCAACTTGAAGGG - Intergenic
1008902484 6:56637209-56637231 TGAAAAGAAATCAACTGGAGTGG - Intronic
1010185978 6:73143629-73143651 TGATATGAATTGAAATCCAGTGG - Intronic
1012197672 6:96364278-96364300 TGCTATGAATTCAATTTGTTAGG - Intergenic
1012246215 6:96928717-96928739 TTATATGAATTCATTTGGAGTGG + Intronic
1012797984 6:103788238-103788260 TCATATGAATTCATCCTGCGGGG - Intergenic
1013517333 6:110900434-110900456 TGAGATCACTTGAACTTGAGAGG - Intergenic
1015483820 6:133745823-133745845 AGAGATGAATTCAGTTTGAGAGG + Intergenic
1016326805 6:142912382-142912404 ATATATGAATTCTACTAGAGGGG - Intronic
1016846972 6:148578198-148578220 TGATATGTATACAAATTCAGTGG - Intergenic
1016966963 6:149727869-149727891 TGATATGACAGCAAGTTGAGAGG - Intronic
1021003619 7:15365293-15365315 TGATATCAATCCAACTTTACGGG + Intronic
1022384344 7:29887778-29887800 TGAGTTGAATTTAAGTTGAGTGG - Intronic
1023225425 7:37964237-37964259 GGATATGAATTCGACCTGATGGG + Intronic
1024399599 7:48909057-48909079 TGACAAGACTTCAAGTTGAGTGG - Intergenic
1031187022 7:118494663-118494685 TGATATGAAGTCAAGTTTAATGG + Intergenic
1031381310 7:121089084-121089106 TGATATGATTAGAACCTGAGGGG - Intronic
1031544893 7:123039103-123039125 TGATATGCATTCTACTTCTGGGG - Intergenic
1031711720 7:125055686-125055708 GGCTTTGAATTCAACTTGATTGG + Intergenic
1031800158 7:126233221-126233243 TGAGATGATTTCCACCTGAGAGG + Intergenic
1032976860 7:137234823-137234845 TGAAATGATTTCAGATTGAGGGG + Intronic
1039256885 8:35728903-35728925 TGAAGTGAATTCTACTTTAGAGG + Intronic
1041121829 8:54593756-54593778 TGATATGAGTTCCACTGGTGAGG - Intergenic
1041982792 8:63882235-63882257 TGTTCTTAATGCAACTTGAGTGG - Intergenic
1042575726 8:70216738-70216760 TGATATGTGTTCAAGATGAGTGG - Exonic
1043998690 8:86851127-86851149 TGATAAGAACTCAAATTCAGTGG + Intergenic
1044163633 8:88952532-88952554 TTATATGAATTAAAGTGGAGTGG - Intergenic
1046157938 8:110318522-110318544 TGATATAAATTCAGCATGTGAGG + Intergenic
1052574879 9:30279686-30279708 TGAAATGAGTTCATTTTGAGTGG + Intergenic
1052848756 9:33362347-33362369 AGATATGAAATCAACTGAAGTGG + Intronic
1059057281 9:110996937-110996959 TGCTATGAATTCCAGCTGAGAGG - Intronic
1059770682 9:117421374-117421396 GAAGATGAATTAAACTTGAGTGG - Intergenic
1060044031 9:120325897-120325919 GGATATGAATGGAACTTGATTGG - Intergenic
1203721129 Un_GL000216v2:14180-14202 TGAAATGAAATCAATCTGAGTGG - Intergenic
1203722637 Un_GL000216v2:24733-24755 TGGAATGGATTCAACTGGAGTGG - Intergenic
1203346828 Un_KI270442v1:40834-40856 TGCTGTGAAGTCAACTGGAGTGG + Intergenic
1203352314 Un_KI270442v1:91286-91308 TGGAATGGAATCAACTTGAGTGG + Intergenic
1203352597 Un_KI270442v1:93504-93526 TGGAATGAAATCAACTTGAGTGG + Intergenic
1203352703 Un_KI270442v1:94371-94393 TGGAATGGAATCAACTTGAGTGG + Intergenic
1203352750 Un_KI270442v1:94741-94763 TGGAATGGATTCAACTAGAGTGG + Intergenic
1203352793 Un_KI270442v1:95086-95108 TGAAATGGATTCAACTAGAGTGG + Intergenic
1203352907 Un_KI270442v1:96036-96058 TGATATGGAATCAACTCGATTGG + Intergenic
1185783000 X:2865372-2865394 TAATATGAATTGAACATGACGGG - Intronic
1186193651 X:7090436-7090458 TTATATGAATTCAATTTCACAGG - Intronic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1188160200 X:26791018-26791040 TGATTTAAATTCAAATTGAATGG - Intergenic
1188855016 X:35183670-35183692 TGATCTGTATTAAACTTGACAGG + Intergenic
1189131567 X:38503289-38503311 TGATAGGCAATCAACTTGATTGG - Intronic
1194001360 X:88433581-88433603 TGATTTCTATTCAACATGAGTGG - Intergenic
1197849540 X:130843048-130843070 TGATATGATTTGAAGTTGCGGGG - Intronic
1199058517 X:143326637-143326659 TTATATGACATCAATTTGAGGGG - Intergenic