ID: 1078210220

View in Genome Browser
Species Human (GRCh38)
Location 11:9264788-9264810
Sequence CTGGAGGGGGGAAACGGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 275}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078210220_1078210236 18 Left 1078210220 11:9264788-9264810 CCTCATCCGTTTCCCCCCTCCAG 0: 1
1: 0
2: 0
3: 19
4: 275
Right 1078210236 11:9264829-9264851 CGCGCCCGCCCTGGTCCTCCCGG 0: 1
1: 0
2: 1
3: 17
4: 212
1078210220_1078210232 9 Left 1078210220 11:9264788-9264810 CCTCATCCGTTTCCCCCCTCCAG 0: 1
1: 0
2: 0
3: 19
4: 275
Right 1078210232 11:9264820-9264842 CCCTTCGCCCGCGCCCGCCCTGG 0: 1
1: 0
2: 4
3: 37
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078210220 Original CRISPR CTGGAGGGGGGAAACGGATG AGG (reversed) Intronic
900095022 1:936702-936724 ATGGATGGGGGACACAGATGGGG - Intronic
901331219 1:8410216-8410238 CTGGCTGGGGGACACGGCTGGGG + Intronic
902785629 1:18730928-18730950 CGGGTGGGGGGAAATGGAGGAGG + Intronic
903273991 1:22209198-22209220 CTGGAGAGGCCATACGGATGCGG - Intergenic
903288066 1:22289479-22289501 CTGGATGGGGGTGACGGAGGGGG - Intergenic
903886522 1:26544052-26544074 CTGGGGTGGGGAAAGAGATGAGG - Intronic
904050305 1:27634623-27634645 CAGGAGAGGGGAAATGGGTGGGG - Intronic
904310612 1:29627113-29627135 GTGGAGGGTGGAAAGGGAGGTGG - Intergenic
904478992 1:30782540-30782562 CTGGAGAGGGGAGACGGACAGGG + Intergenic
904738765 1:32655368-32655390 TTAAAGGGGGGAAACGGATCTGG - Intronic
904823592 1:33260311-33260333 CTGGAGGTGGCAATGGGATGCGG - Intronic
905923423 1:41733729-41733751 CTGGAAAGAGGAAAGGGATGTGG + Intronic
906277038 1:44524113-44524135 CTGGAGGGGGGCAAAGGGAGGGG + Intronic
908459713 1:64337666-64337688 CTGGAAGGTGGAAACAGATGGGG - Intergenic
909587907 1:77311983-77312005 CTGTAGGGGAGGAAGGGATGAGG - Intronic
913109189 1:115642308-115642330 CAGGAGGGGCGCAACGCATGGGG - Intronic
915249042 1:154575739-154575761 CTGGATGGAGGAGACGGAGGAGG - Intronic
915939051 1:160106863-160106885 CTGGAAGGGAGAGACTGATGGGG - Intergenic
917621523 1:176801410-176801432 CTGGAGAGGGGGAAAGGGTGGGG + Intronic
921221914 1:212979544-212979566 CTGGAGGGAGGAGGTGGATGGGG - Intronic
921379294 1:214507309-214507331 ATGGAGGGCTGAAAAGGATGGGG - Intronic
922420734 1:225459793-225459815 CTGAAGGAGGGACAGGGATGTGG + Intergenic
923205105 1:231751623-231751645 CTGGAAGAGGGGAAGGGATGGGG - Intronic
1062798048 10:358815-358837 TTGGAGGGGGCAGAGGGATGGGG + Intronic
1063341619 10:5270712-5270734 CAGAAGGGAGGAAACGGATGTGG - Intergenic
1065232326 10:23611061-23611083 TTAGAGGTGGGAAACAGATGAGG + Intergenic
1065338184 10:24676538-24676560 GGGGAGGGTGGAAAGGGATGAGG + Intronic
1067177359 10:43959488-43959510 CTGGAGAGGGAAAGGGGATGCGG - Intergenic
1067321231 10:45223110-45223132 CTGGAGGGAGGAAAGCCATGGGG + Intergenic
1067878362 10:50023955-50023977 ATGGAGGGGGGAAAAGAAGGTGG - Intergenic
1067893360 10:50153973-50153995 ATGGAGGGGGGAAAAGAAGGTGG + Intergenic
1068397944 10:56488018-56488040 CTGGAGGGGGGAGGGGGCTGGGG + Intergenic
1068962125 10:62877459-62877481 CTGGAGAGGGGAAACAGAAGGGG + Intronic
1069665163 10:70150037-70150059 CAGGAGGGGGAAAAAGGCTGGGG - Exonic
1070589295 10:77790109-77790131 CTGGTGGGGGCAGACTGATGTGG - Intergenic
1070783617 10:79150901-79150923 CAGGAGGGAGGAAGAGGATGGGG - Intronic
1071292572 10:84198108-84198130 CTGGGTGGGGGAAGCAGATGGGG - Intronic
1072069145 10:91899781-91899803 ATGTAGGGGGGAAAGGGAAGAGG - Intergenic
1073044823 10:100630737-100630759 CAGGAGGGTGGAAAAGGGTGGGG - Intergenic
1073246763 10:102096265-102096287 CTGGAGAGGGGAAACTAATTAGG - Intergenic
1075156049 10:119976628-119976650 CTGTAGCGGGGAATGGGATGTGG + Intergenic
1077934937 11:6773571-6773593 AGGGAGGGGGAAAAGGGATGGGG + Intergenic
1078210220 11:9264788-9264810 CTGGAGGGGGGAAACGGATGAGG - Intronic
1079033079 11:17000015-17000037 CTGGAGGGGGGATATGGACAGGG + Intronic
1079683503 11:23326969-23326991 GTGGAGGGGGGAGAGGGAGGGGG + Intergenic
1081766036 11:45610746-45610768 CTGCAGTGGGGAAATGGGTGAGG - Intergenic
1081980062 11:47260690-47260712 CTGGAGTGGGGAAGAGGCTGAGG + Intronic
1083614414 11:64019202-64019224 CGGGCGGGGGGAACCCGATGGGG - Intronic
1083941827 11:65900139-65900161 CTGGAGCGGGGAACCGGAGTCGG - Intronic
1084362764 11:68679724-68679746 CTGGAGGTGGGCAACGAATTTGG - Intergenic
1085289845 11:75390125-75390147 CTGGAGGGTGGAAAGGGAGTGGG - Intergenic
1086342120 11:85857385-85857407 CTGGAAGGGCGAAACAGAGGAGG + Intronic
1087159377 11:94934237-94934259 CTGGTGGGGTGAAAGGGCTGAGG + Intergenic
1087361459 11:97165702-97165724 CTGGAGTGGAGTAAGGGATGAGG + Intergenic
1088906406 11:114158469-114158491 CTGGAGGTGGGGAACAGCTGGGG - Intronic
1089215636 11:116833007-116833029 CTGGAGGGGGGCCAGGCATGAGG - Exonic
1089713874 11:120337070-120337092 CTGTAAGGGGTCAACGGATGCGG - Exonic
1090378871 11:126311053-126311075 GTGGAGGGGATAAACGAATGAGG - Intronic
1093857110 12:24118093-24118115 CTGGGGGGTGGGAAGGGATGAGG + Intergenic
1096961382 12:55581629-55581651 CTGGAGGGTGGAGAGGGAGGAGG - Intergenic
1097250146 12:57627959-57627981 CTGCAGGGGTGAAGCGGAAGAGG - Intronic
1101400327 12:104381725-104381747 CTGGAGGGAGGGAAGGCATGTGG - Intergenic
1102036306 12:109772242-109772264 CAGGAGAGGGGAAACGGGAGAGG + Intergenic
1102131053 12:110529118-110529140 CTGAAGGGGGAAATGGGATGAGG + Intronic
1102423741 12:112824436-112824458 CTGTAGGGGGGATCCAGATGAGG + Intronic
1102576688 12:113860224-113860246 CTGGAGGGGGGCCAGGGCTGGGG + Intronic
1102971521 12:117171416-117171438 CTGGAGAGGAGAAAGGGATGAGG + Intronic
1103566621 12:121819381-121819403 CTGGATGGGGGACACAGACGAGG - Intronic
1103775697 12:123364878-123364900 CGGGGGAGGGGCAACGGATGAGG + Intergenic
1104554042 12:129783971-129783993 CTGGAAGAGGGAACGGGATGGGG - Intronic
1104908409 12:132227927-132227949 CTGCAGGGAGGAGACAGATGGGG - Intronic
1105342995 13:19545517-19545539 CTGGATGGGGGAAAAGGATTGGG - Intergenic
1107773342 13:43811605-43811627 CTGGAGGGGAGGAGGGGATGTGG + Intergenic
1107822036 13:44295006-44295028 CTGGAGGGGTCAAGCGGATCTGG - Intergenic
1108506260 13:51115412-51115434 CTGTAGGGAGGAAAATGATGGGG - Intergenic
1113772108 13:112916979-112917001 CTGGAGTGGGAAGAGGGATGGGG - Intronic
1113938084 13:114005727-114005749 CCGGAGGGGAGAAAGGGATGGGG - Intronic
1114453072 14:22838852-22838874 CTGGGGGGAGGAGAGGGATGGGG + Intronic
1116258053 14:42583157-42583179 GTGGAGGTGAGAAACGGGTGAGG - Intergenic
1117294296 14:54365007-54365029 CTGAAAGGGGCAAAGGGATGTGG + Intergenic
1118522069 14:66596526-66596548 CTGGAGGGGGCCAAGGCATGAGG + Intronic
1119562513 14:75602368-75602390 CTGGAGGGGGTAGAGGGATGGGG + Intronic
1122791219 14:104185020-104185042 CTGGTGGGGGGAAGCAGATGAGG - Intergenic
1122872130 14:104643600-104643622 CTGGTGGAGGGGAAGGGATGGGG - Intergenic
1123054142 14:105561302-105561324 CTGGTGGGGGGACACGGGAGGGG - Intergenic
1123078725 14:105681719-105681741 CTGGTGGGGGGACACGGGAGGGG - Intergenic
1127515446 15:59689155-59689177 CTGGAGGGGCGAAGAGGACGAGG - Exonic
1127956022 15:63854211-63854233 CTAGAGGGGGGAAAAGGGGGAGG + Intergenic
1128875669 15:71199226-71199248 CTGAAAGGAGGAAAGGGATGGGG - Intronic
1130012205 15:80160559-80160581 CTGGTGGGGGGAGATGGAGGAGG + Intronic
1130395155 15:83494965-83494987 CTGGAAGGGGGAGAGGGAGGAGG - Intronic
1131542067 15:93282967-93282989 CTGGCTGGGGGAAGCGGCTGGGG - Intergenic
1131809712 15:96160355-96160377 TTGGAAGGGGGAAAAAGATGAGG - Intergenic
1135935771 16:26778727-26778749 CTGCAGGGGGATAACAGATGAGG + Intergenic
1138434321 16:56988857-56988879 CTGGAGGGGGCAGAAGGAAGGGG - Intergenic
1141764427 16:86049174-86049196 CAGGTGGGGAGAACCGGATGAGG - Intergenic
1142904825 17:3034564-3034586 CTGGAGAGGGGAACAGGATTGGG - Exonic
1143775590 17:9196667-9196689 CTGGAGGGGGGAATGGGGAGGGG - Intronic
1143941507 17:10547158-10547180 CTGGAGTGGGGAAAAGGAATGGG + Intronic
1146178763 17:30684009-30684031 CTATAGGGAGGAAAGGGATGGGG + Intergenic
1146476583 17:33167494-33167516 CTGGAGAAGGGAACCGGGTGGGG - Intronic
1146605115 17:34251311-34251333 CTAGAGGGAGGAGACTGATGTGG - Intergenic
1146739412 17:35268892-35268914 CAGGATGTGGGAAACAGATGAGG - Exonic
1147947178 17:44086738-44086760 CTGGAGGGGAGAATGGGAGGGGG + Intronic
1148353536 17:46958394-46958416 CTGGGGGTGGGAAACGTGTGTGG + Intronic
1149392124 17:56202568-56202590 GTGGAGGGGGGAAATGGAACAGG - Intronic
1150225512 17:63522836-63522858 CAGGAGGGGGGCTACAGATGGGG - Intergenic
1151280740 17:73072332-73072354 GAGGAAGGGGGAAAGGGATGGGG + Intronic
1151826999 17:76529262-76529284 CTAGAGGGTGTAAAGGGATGAGG + Intronic
1151953662 17:77369810-77369832 CTGGAGGGGGGTCATGGATATGG + Intronic
1152011347 17:77720540-77720562 CTGCAGAGGGGAATGGGATGTGG + Intergenic
1152104927 17:78323280-78323302 CTGGAGGGAGGAAACAGACCAGG + Intergenic
1152675171 17:81636595-81636617 CTGGAGCCGGGAAACGGGTGGGG + Intronic
1152763499 17:82122242-82122264 CTGGTGGTGGGAAACGGTTCTGG - Intronic
1154034403 18:10785555-10785577 CTAGAGTGGGGAGAGGGATGTGG - Intronic
1156171457 18:34491820-34491842 CAAGAGGGGGGAAAAGGAGGGGG - Intergenic
1156742683 18:40351474-40351496 CTGGTGGGAGGCAAGGGATGAGG + Intergenic
1157157623 18:45283043-45283065 ACGGAGGAGGGAAAAGGATGAGG - Intronic
1158587076 18:58749452-58749474 CTGGAGGGTGGAAATGGCAGGGG - Exonic
1159847403 18:73479832-73479854 CTGGAGAAGGGAGAGGGATGAGG - Intergenic
1159991218 18:74910898-74910920 CGGGAGGTGGGAAAGGGATACGG - Intronic
1160910819 19:1473011-1473033 CTGGACCGGGGCAACAGATGGGG - Exonic
1160965309 19:1744723-1744745 CTGGAGGGGGGAAGAGGAGGAGG - Intergenic
1161582636 19:5089046-5089068 CTGGAGGGTGACAACGGATGGGG + Intronic
1162013862 19:7833157-7833179 TTTGAGGGGGCAGACGGATGAGG + Intronic
1162145809 19:8611422-8611444 ATGGAGGGGGGTAAGGAATGGGG + Intergenic
1162779817 19:13001094-13001116 CTGGGGTGGGGAAAAGGAGGGGG + Intronic
1162910384 19:13844707-13844729 CTGGAGGGGCAATATGGATGGGG - Intergenic
1162979849 19:14231563-14231585 CTGTAGGGAGTAAACGGATGGGG - Intergenic
1163045535 19:14638781-14638803 GTTGAGGGGGGAAGTGGATGAGG - Intronic
1163488168 19:17601754-17601776 CTGGACGGGGGTAAGGGGTGGGG + Exonic
1163754689 19:19099652-19099674 CTGGAGATGGGGAAGGGATGTGG - Intronic
1165189210 19:34048259-34048281 CTGGAGGGGGCAAATGGAATTGG + Intergenic
1166656484 19:44615724-44615746 CTGGAAGGAGGAAAGGGACGTGG + Intronic
1166839131 19:45685754-45685776 ATGGAGGTGGGAAAGGGAGGTGG - Intergenic
1166998588 19:46731761-46731783 CTGGAGGGAGGAACAGGAGGAGG - Intronic
1167056036 19:47112211-47112233 CGAGGGGGGGGAAACGCATGAGG + Intronic
1167504433 19:49863643-49863665 CTGGAGTGAGGAAAAGGAGGGGG + Intronic
925053573 2:836293-836315 GTTGAGGGGAGAAAAGGATGAGG + Intergenic
926130939 2:10302845-10302867 CTGGAGGCGGGACCCGGAGGCGG - Intergenic
927945216 2:27131509-27131531 CTGCAGGAGGGAAAGGGAGGAGG + Intronic
928328510 2:30338969-30338991 CTGGAGAGAGGAAAGGGAGGAGG + Intergenic
929795936 2:45058392-45058414 GTGGATGGGGGACAAGGATGAGG + Intergenic
929844195 2:45504739-45504761 CTCGAGGGGGAAAAGGGAAGAGG + Intronic
930638252 2:53829198-53829220 CTGGAAGTGGGAAAACGATGAGG + Intergenic
930734481 2:54762504-54762526 CTGGAGGTGGGAGACGCTTGGGG - Intronic
931192799 2:60022089-60022111 CTGGAGGGAGGAAAGGGAGAAGG + Intergenic
931487409 2:62706405-62706427 TCGGAGGGAGGAAATGGATGGGG - Intronic
931879596 2:66554406-66554428 CTGGAGAGGGCATAGGGATGAGG + Intronic
932093055 2:68823761-68823783 CTGCAGGGGGCAAACAGAAGCGG + Intronic
932326122 2:70863001-70863023 CTGGGGTGGGGATAGGGATGTGG - Intergenic
933110067 2:78386738-78386760 CTGGTGGGGTGAAAATGATGAGG - Intergenic
934932646 2:98440739-98440761 CTGGAGGGACAAAAAGGATGTGG - Intergenic
937019295 2:118635516-118635538 CAGGAGGCGAGACACGGATGTGG - Intergenic
939189764 2:138902404-138902426 CTGGAAGGGCGAAACAGACGAGG - Intergenic
939934345 2:148271937-148271959 CTGGAGGGGAGGAAGGGATGGGG - Intronic
942089885 2:172479767-172479789 GTGGAGGTGGGAAACTGAGGGGG - Intronic
944062456 2:195583707-195583729 CTGGAAGGGAGAAACAGACGAGG - Intronic
944611513 2:201413432-201413454 CTGGAGGAGGGAAAGGGATAGGG + Intronic
945639140 2:212400241-212400263 CTGGAGTGGGGAAGAGGATTTGG + Intronic
947219649 2:227780086-227780108 CTAGAGGTGGGAAAGGAATGGGG - Intergenic
1168803833 20:661648-661670 CTGGAGGTGGGGAAGGGATGGGG + Exonic
1169097949 20:2920274-2920296 CTTGAGGCTGGAAATGGATGTGG + Intronic
1169183316 20:3590419-3590441 CTCTAGGGGGGAATAGGATGGGG - Intronic
1170017383 20:11797201-11797223 ATGGAGGGGGGAAATGGTGGTGG + Intergenic
1170184051 20:13567280-13567302 TGGGAGGGGGGAAAAGGATCAGG + Intronic
1171291192 20:23984084-23984106 CTGCAGGGGTGAGACGGAGGTGG - Intergenic
1171810470 20:29742139-29742161 CTGGAGGGCGGGGGCGGATGAGG + Intergenic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1173953435 20:47011510-47011532 CTGGAGTGGGGTAAGGGTTGGGG - Intronic
1174447902 20:50602645-50602667 CTGGAGAGGGGACACGGGAGCGG + Intronic
1175279819 20:57795494-57795516 ATGGAGGAGGGAAATGAATGTGG - Intergenic
1175647457 20:60686965-60686987 CTGGAGGAGGGAAAAGGAACAGG + Intergenic
1175654074 20:60753422-60753444 CTGGAGGGAGGCAGCGGGTGTGG - Intergenic
1176077375 20:63254549-63254571 GAGGAGGGGGGAACGGGATGCGG - Intronic
1179266210 21:39805741-39805763 CAGAAGGTGGGAAATGGATGTGG + Intergenic
1179417664 21:41211170-41211192 GTGAAGGGGGGAGAGGGATGGGG - Intronic
1179516980 21:41915173-41915195 GTGGAGGTGGGAAATGGGTGTGG - Intronic
1179919139 21:44498003-44498025 CTGGAGGGGGCAGAGGGAGGAGG + Exonic
1180927729 22:19567639-19567661 CGGGAGGTGGGAAAGGCATGGGG + Intergenic
1181869817 22:25888877-25888899 CTGGAGAAGTGAAACAGATGGGG + Intronic
1183298061 22:37043726-37043748 CTCGAGGGAGGAAACAGAGGGGG + Intergenic
1183529824 22:38347331-38347353 GTGGGAGGGGGAAACGGAAGAGG + Intronic
1183541312 22:38430954-38430976 CTGCAGGGAGGAAGTGGATGAGG - Intronic
1184660915 22:45965138-45965160 CTGGAGGTGTGAAGAGGATGTGG - Intronic
1185183575 22:49378716-49378738 CTGGAGGGAGGGAGCGCATGAGG - Intergenic
950481453 3:13246849-13246871 CTGGATGGGGGACACAGCTGGGG + Intergenic
950526716 3:13528739-13528761 GGGGAGGGGGGAAAGGGGTGGGG - Intergenic
952810642 3:37399471-37399493 TTGCAGGGGAGAAAGGGATGAGG + Exonic
952928194 3:38337458-38337480 TGGGAGGGGGGTAAGGGATGAGG + Intergenic
953033533 3:39192760-39192782 CTGGGGAGGGGAAACAGAGGGGG + Intergenic
955196999 3:56813829-56813851 TGGGAGGGAGGAAAAGGATGTGG - Intronic
955437122 3:58913258-58913280 GTGGAGGTGGCAAATGGATGGGG + Intronic
956903138 3:73737434-73737456 TTTGATGAGGGAAACGGATGGGG - Intergenic
959858513 3:111189928-111189950 CTGGAGAGGGGACAGGGAGGGGG + Intronic
960910446 3:122644225-122644247 CTGGAGATGGGAAAAGCATGGGG + Intergenic
961018280 3:123483559-123483581 CTGGTGGAGGGAAACAGTTGTGG + Intergenic
962859952 3:139390005-139390027 CTGGAGGGGGGAAACGGCGAGGG + Intergenic
964271725 3:154963889-154963911 CTGGAAAGGGTAGACGGATGTGG - Intergenic
964472533 3:157070218-157070240 CTGGAGTGGGGCAAATGATGTGG - Intergenic
965844158 3:172942037-172942059 TAGGAGGGGGGAAAAGCATGTGG + Intronic
967271536 3:187737455-187737477 GAGGAGGGAGGAAAAGGATGGGG - Intronic
969548796 4:7850422-7850444 CTGGAGGAGGGAGAGGGAAGAGG + Intronic
972533002 4:39977397-39977419 CTGGAGGGAGGGGACGGAAGGGG - Intronic
975330131 4:73103341-73103363 CTGGAGGGTGGAACAGGAGGAGG + Intronic
976446469 4:85135633-85135655 CTGGGTGGGGGAAAGGGAGGGGG + Intergenic
977088747 4:92641780-92641802 CTGGAGGAGGGAGAAGGAGGGGG - Intronic
978445925 4:108779890-108779912 CTGGAGGTGGGAAACTGGTTTGG - Intergenic
979784025 4:124692381-124692403 CTGGAGGGAGGTAATGGTTGGGG + Intronic
981884049 4:149651293-149651315 CTGGAAGGTGGAAATAGATGAGG + Intergenic
984740347 4:183155546-183155568 CTGGAGGGAGGAGACGAATTTGG + Intronic
984979929 4:185270678-185270700 CTGGAGGGAGGGAAGGAATGGGG - Intronic
987085122 5:14461055-14461077 CTGGAGGGAAGCCACGGATGCGG - Exonic
991633767 5:68682511-68682533 CTGGTGGGTGGAAAAGGGTGAGG - Intergenic
992806282 5:80341171-80341193 CTGATGGGGGAAAACGGGTGTGG - Intergenic
992947104 5:81821930-81821952 CTGGAGGAGGGCCATGGATGGGG - Intergenic
994506310 5:100646771-100646793 CTTAAGTGGGGAAACGGACGGGG - Intergenic
994792232 5:104243872-104243894 CTAGAGGTGGGAAAGGGAGGTGG - Intergenic
997384252 5:133459945-133459967 CTGGAGGCAGGAAACACATGAGG + Intronic
997476070 5:134143268-134143290 CTGGAGTGGAGAATAGGATGTGG - Intronic
997751289 5:136348269-136348291 CTGGAGGGAGTAAACAGAAGTGG - Intronic
998574389 5:143298034-143298056 CTGGAGGGAGAAAACGAGTGAGG + Intronic
999135191 5:149314025-149314047 CTGGAGGGGCAAGAAGGATGAGG + Intronic
999776085 5:154814117-154814139 CTTGAGGGGGGAAAGGGGTAGGG + Exonic
1000228252 5:159290688-159290710 CTGGAGAGGAGAAATGGAAGGGG - Intergenic
1001948499 5:175799433-175799455 CTGGAAGGTGGAAAAGGAAGGGG + Intronic
1001948772 5:175801413-175801435 ATGGAGGTGGGCAATGGATGTGG + Intronic
1002570122 5:180135474-180135496 CTGGAAGGGGGAAACGTGGGCGG - Intronic
1002710602 5:181192450-181192472 GAGGAGAGGGGAAAAGGATGAGG + Intergenic
1003459227 6:6314570-6314592 GTGGAGTGGGGAAGAGGATGAGG - Intronic
1006188298 6:32192517-32192539 CTAGAGGGGAGAAACTGGTGGGG + Exonic
1006378516 6:33684751-33684773 CTGGAGGCGGGACTCGGTTGAGG - Intronic
1007301637 6:40872137-40872159 CTGGAGTGGTGAAAAGGAAGGGG - Intergenic
1007386708 6:41524947-41524969 GCGGAGGGGGGAAGGGGATGAGG + Intergenic
1007602862 6:43094300-43094322 CTGAAGGGGGAAAACTGGTGAGG - Intronic
1011424824 6:87214897-87214919 CTGGAGGGAGGGAAGGGGTGGGG - Intronic
1012286310 6:97393057-97393079 AGGGAGGAGGGAAATGGATGTGG + Intergenic
1013366601 6:109442091-109442113 CTGGAGGTGGGGAAGGGAGGTGG - Intronic
1014270437 6:119330284-119330306 GTGGAGAGGGGTAATGGATGTGG - Intronic
1014398236 6:120953285-120953307 CTGGAAGGAGGAAACGGAGTGGG + Intergenic
1014981984 6:127955639-127955661 CTGGTGGGAGGAAAGGGAGGTGG - Intergenic
1016254608 6:142088861-142088883 CTAGAGGGGGGAAATGGCTCCGG + Intergenic
1017238295 6:152140024-152140046 CTGGCTGGGGGACACGGAGGAGG - Exonic
1017457596 6:154615890-154615912 CTGGATGGGGGCCACGTATGGGG + Intergenic
1018905490 6:168073226-168073248 CTGGAGGCTGGAATCGGGTGGGG + Intronic
1020354130 7:7258264-7258286 ATGGAAGGGGGAAAGGAATGGGG + Intergenic
1021107198 7:16651576-16651598 CTGGCTGGAGGAAAAGGATGCGG + Intronic
1022092644 7:27117645-27117667 CTGGAAGAGGGAAATCGATGAGG - Intronic
1022225769 7:28361460-28361482 CTGGGGCAGGGAAAAGGATGTGG - Intronic
1022552936 7:31259008-31259030 CGGGAGGGGAAAAAGGGATGAGG - Intergenic
1023728294 7:43166480-43166502 CTGCAGGGTGGAGATGGATGAGG + Intronic
1024803506 7:53108566-53108588 CTGAGAGGGGGAAACGGATGAGG + Intergenic
1027784732 7:82566518-82566540 CAGGAAAGGGAAAACGGATGTGG + Intergenic
1028932950 7:96434114-96434136 CTGGTGGGGGGACAGGAATGGGG - Intergenic
1030157015 7:106465564-106465586 CTGAAGGAAGGAAAGGGATGGGG + Intergenic
1031911726 7:127523872-127523894 CTGGAGGGGGGAGAGGGGAGGGG + Intergenic
1032441633 7:131946630-131946652 CTGGAGAAGGGAAACGGAGGAGG + Intergenic
1034543391 7:151774375-151774397 CAGGAGGGGGAACACAGATGGGG - Intronic
1034681738 7:152934061-152934083 CTGGTGGTGGAAAACGGCTGTGG + Intergenic
1034905549 7:154941556-154941578 CTAGAGGGTGGAATCGGCTGAGG + Intronic
1036171875 8:6494735-6494757 ATGGAGGGGAGAGAGGGATGGGG + Intronic
1036392552 8:8336897-8336919 GGGGAGGGGGGAAAGGGGTGTGG - Intronic
1037750928 8:21681960-21681982 CTGGAGGTGAGAATCGGCTGGGG + Intergenic
1038460217 8:27709819-27709841 CTGGAGGGAGGGAAAGGAAGTGG - Intergenic
1038716267 8:29993985-29994007 CTGGAGGGAGGAGATGGAAGAGG - Intergenic
1041333801 8:56757417-56757439 CTGGAGAGGGGAAATATATGAGG + Intergenic
1041336090 8:56785993-56786015 CTGTAGGGTGGAAAAGTATGTGG + Intergenic
1042926462 8:73972616-73972638 CTGGAGGTGGGAGACTGCTGAGG + Intronic
1044506149 8:93022249-93022271 GTGGAAGGGGGAGACGGAGGTGG + Intergenic
1045887517 8:107116394-107116416 CTGGAGGGGGACAACACATGAGG + Intergenic
1048275572 8:133063229-133063251 CTGGAGGGGTGGAACTTATGGGG - Intronic
1048424587 8:134311571-134311593 CTGGAGGTGGGAAACTGCAGAGG + Intergenic
1049383890 8:142331289-142331311 CAGGGGAGGGGCAACGGATGGGG - Intronic
1050552909 9:6763029-6763051 CTGGTGGGGGGGGATGGATGGGG + Intronic
1051172507 9:14332786-14332808 GTGGAGGAGAGAGACGGATGGGG + Intronic
1052739088 9:32376119-32376141 CTGGAAGGGGGATGCAGATGAGG + Intergenic
1053329821 9:37193953-37193975 CTGTAAGAGGGAAAGGGATGAGG - Intronic
1056598025 9:88023651-88023673 GTGGTGGGGGGACAGGGATGGGG + Intergenic
1056929909 9:90865790-90865812 CTGGAGGGAGGAGACAGCTGAGG - Intronic
1057017260 9:91663508-91663530 CTGGAGATGGGAAACGTCTGTGG - Intronic
1057092928 9:92276445-92276467 CTGTAGGGAGGAATGGGATGAGG + Intronic
1059067996 9:111105332-111105354 TTGGTGGAGGGAAACAGATGGGG - Intergenic
1061248098 9:129411800-129411822 CTGGAGAGGGGAAGGAGATGGGG - Intergenic
1061257309 9:129460324-129460346 CTGGAGGGGGGAGATGCAGGCGG - Intergenic
1062612330 9:137380630-137380652 GAGGAGGGGGGATACGGGTGGGG - Intronic
1062617272 9:137403510-137403532 CTGGAGGGCTGAAACGGACCTGG - Intronic
1187242114 X:17522856-17522878 CTGCAGTTGGGAAACTGATGTGG + Intronic
1188822486 X:34792605-34792627 CTTGAGGGAGGAAAAGGAAGAGG - Intergenic
1190258860 X:48785830-48785852 TTGGAGGCGGGAAACTGAGGTGG - Intergenic
1190969533 X:55335221-55335243 CAGGAAGTTGGAAACGGATGGGG - Intergenic
1196766668 X:119252230-119252252 CCAGAGGGAAGAAACGGATGGGG - Intergenic
1198517823 X:137427055-137427077 TTGGAGGGAGGAAGGGGATGGGG + Intergenic
1199735647 X:150683804-150683826 CTGGAGGAGGCAAAAAGATGAGG - Intergenic
1201144783 Y:11058235-11058257 GTGGAGGGGGGATGTGGATGGGG + Intergenic
1202589357 Y:26466201-26466223 CTGGGTGGGGGAAAAGGATTGGG + Intergenic