ID: 1078210382

View in Genome Browser
Species Human (GRCh38)
Location 11:9265288-9265310
Sequence TGCAGCGGCGGCGGCGCGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 796
Summary {0: 1, 1: 0, 2: 10, 3: 91, 4: 694}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078210382_1078210388 -3 Left 1078210382 11:9265288-9265310 CCCTCCGCGCCGCCGCCGCTGCA 0: 1
1: 0
2: 10
3: 91
4: 694
Right 1078210388 11:9265308-9265330 GCAGCTAGCCGAGAGCGCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 72
1078210382_1078210392 18 Left 1078210382 11:9265288-9265310 CCCTCCGCGCCGCCGCCGCTGCA 0: 1
1: 0
2: 10
3: 91
4: 694
Right 1078210392 11:9265329-9265351 GGCCCGAGCGAGCCTGGAGAAGG 0: 1
1: 0
2: 2
3: 14
4: 182
1078210382_1078210390 12 Left 1078210382 11:9265288-9265310 CCCTCCGCGCCGCCGCCGCTGCA 0: 1
1: 0
2: 10
3: 91
4: 694
Right 1078210390 11:9265323-9265345 CGCCGCGGCCCGAGCGAGCCTGG 0: 1
1: 0
2: 0
3: 21
4: 180
1078210382_1078210396 22 Left 1078210382 11:9265288-9265310 CCCTCCGCGCCGCCGCCGCTGCA 0: 1
1: 0
2: 10
3: 91
4: 694
Right 1078210396 11:9265333-9265355 CGAGCGAGCCTGGAGAAGGGCGG 0: 1
1: 0
2: 1
3: 22
4: 195
1078210382_1078210393 19 Left 1078210382 11:9265288-9265310 CCCTCCGCGCCGCCGCCGCTGCA 0: 1
1: 0
2: 10
3: 91
4: 694
Right 1078210393 11:9265330-9265352 GCCCGAGCGAGCCTGGAGAAGGG 0: 1
1: 0
2: 1
3: 14
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078210382 Original CRISPR TGCAGCGGCGGCGGCGCGGA GGG (reversed) Exonic