ID: 1078224646

View in Genome Browser
Species Human (GRCh38)
Location 11:9380920-9380942
Sequence CTGTATCCAAAAAAGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078224646_1078224650 -1 Left 1078224646 11:9380920-9380942 CCAAGCTCCTTTTTTGGATACAG No data
Right 1078224650 11:9380942-9380964 GGAATGCTGGCTCCCCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078224646 Original CRISPR CTGTATCCAAAAAAGGAGCT TGG (reversed) Intergenic
No off target data available for this crispr