ID: 1078237104

View in Genome Browser
Species Human (GRCh38)
Location 11:9495602-9495624
Sequence TTACTGATAAATAGTGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 342}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078237104 Original CRISPR TTACTGATAAATAGTGAAGA TGG (reversed) Intronic
900470418 1:2851417-2851439 TAACTGAAAAATCATGAAGATGG + Intergenic
900814109 1:4830165-4830187 TGACTGGTAAGCAGTGAAGAAGG - Intergenic
901763526 1:11485850-11485872 TTACTAATAAGCAGTGGAGATGG + Intronic
903279955 1:22244798-22244820 TTACTGATAACCAGGGGAGAAGG + Intergenic
905991809 1:42344143-42344165 TAACTGCTAAATAGTTAAAAAGG - Intergenic
906876487 1:49544112-49544134 TTCCTGAAAAACAGTGAAAACGG - Intronic
909754846 1:79212314-79212336 TTATTGATAAATAGTGCAGATGG + Intergenic
910727481 1:90354055-90354077 TTTATGATATATAGTGAAAAGGG + Intergenic
911785857 1:101946132-101946154 TCACTGAGAAATACTGCAGAAGG + Intronic
912186754 1:107286295-107286317 TTACTGAGAAATATGAAAGAGGG - Intronic
913358022 1:117945409-117945431 TTATGGATAAATGGGGAAGATGG - Intronic
915866174 1:159501390-159501412 TTACTGAGAAATTCTTAAGATGG - Intergenic
916773941 1:167939980-167940002 TTACTGCTAAATAGTAAAATTGG + Intronic
917551415 1:176034570-176034592 TTACTGATACTTTGTCAAGAAGG - Intronic
917587577 1:176443469-176443491 TTACAGAAAAATATTGAAGAAGG + Intergenic
920806550 1:209239949-209239971 TTAATGATTTATAGTCAAGAAGG - Intergenic
921105318 1:211971180-211971202 TTACTGGTATTTAGTGCAGAGGG - Intronic
921205413 1:212844625-212844647 TTACTGAGACATAGTGGAGGGGG - Intronic
921965816 1:221087661-221087683 ATTCTGATAAATCTTGAAGATGG - Intergenic
922682760 1:227614502-227614524 TTTTTTATAAATAGGGAAGAAGG - Intronic
923454498 1:234151735-234151757 AAACTGACAAATATTGAAGATGG + Intronic
924879063 1:248137950-248137972 TTCTTGAGAAATAGTGAAGGGGG + Intergenic
924884236 1:248195274-248195296 TTCTTGAGAAATAGTGAAGGAGG + Intergenic
924892980 1:248305364-248305386 TTCTTGAGAAATAGTGAAGGAGG - Intergenic
1064869675 10:19923754-19923776 ATACTGATAAATAGTAATGGAGG - Intronic
1066043256 10:31573837-31573859 TTACTGCAAAATTGAGAAGAAGG - Intergenic
1069103068 10:64347886-64347908 TTCCTGAAAGATAGTGTAGAAGG + Intergenic
1069103275 10:64351048-64351070 TTCCTGAAAGATAGTGCAGAAGG - Intergenic
1069125793 10:64631111-64631133 TTACTTATAAATAATGAAATTGG - Intergenic
1069302041 10:66920222-66920244 TTACTCATAAATCATGAAAATGG + Intronic
1069976747 10:72219824-72219846 ACACTGATTAATAGTGAAGTGGG - Intronic
1070219055 10:74421372-74421394 TTACAGATAAATAAACAAGAGGG + Intronic
1071023538 10:81085555-81085577 TAACTGAAAAAGGGTGAAGATGG - Intergenic
1071951835 10:90712273-90712295 TTCCTAATAAAGAGAGAAGATGG + Intergenic
1072166096 10:92814515-92814537 TTACTGAGAAAAAGAGAACACGG - Intergenic
1072860708 10:99002196-99002218 TTGCTTATTAATAGTGAATATGG - Intronic
1074148312 10:110736712-110736734 TTACTGAAAAAAAGGAAAGAAGG - Intronic
1074750081 10:116577389-116577411 TCACTGTTCAATAGTCAAGAGGG + Intergenic
1078237104 11:9495602-9495624 TTACTGATAAATAGTGAAGATGG - Intronic
1078254728 11:9648293-9648315 ATACTTAAAAATAGTTAAGACGG - Intergenic
1078291631 11:10016182-10016204 TATCAGATAAATTGTGAAGAAGG + Intronic
1078630377 11:12997881-12997903 TCACTTAAAAATAGTTAAGATGG - Intergenic
1079173421 11:18117431-18117453 ATACAGATATATAGTGGAGATGG - Intronic
1081134721 11:39426071-39426093 TTTCTGATAATTAGTGATGTGGG - Intergenic
1082741080 11:56911865-56911887 TAACTGAGAAATTCTGAAGATGG - Intergenic
1085065982 11:73496504-73496526 ATACTTAAAAATAGTTAAGATGG + Intronic
1085088298 11:73687943-73687965 TTACTGACAAAAAGTGAGTAAGG - Intronic
1085760912 11:79240609-79240631 TTACTGGTAAATGGTAAAGCAGG + Intronic
1086139828 11:83484452-83484474 TTACAGATAAATGGTGATGGAGG + Intronic
1086966557 11:93033903-93033925 TTACTGAAAAATTGCTAAGAGGG - Intergenic
1087151490 11:94864118-94864140 TTACTGTAAAATACTGAAGTAGG + Intronic
1087556866 11:99732328-99732350 TTACTGATAATAAGTTTAGAAGG + Intronic
1088084986 11:105966776-105966798 ATACTGATATATAGTGAAGAAGG - Intronic
1088570416 11:111218522-111218544 TTACAGAAAAATTATGAAGATGG - Intergenic
1088778635 11:113112016-113112038 TAACTGAAAAATAATGAAGGTGG + Intronic
1090924245 11:131235628-131235650 TATGTGATGAATAGTGAAGAGGG - Intergenic
1091102499 11:132888074-132888096 TTACTGGCAAAGAGTGAAGGGGG + Intronic
1092389330 12:8061807-8061829 GTACTTAAAAATGGTGAAGATGG - Intronic
1092492433 12:8957432-8957454 TATCTGTTAAATTGTGAAGAAGG - Intronic
1092734115 12:11563482-11563504 ACACTGATAAATAGTCTAGAAGG + Intergenic
1093325062 12:17763646-17763668 TTAATGAGAAATTATGAAGAAGG + Intergenic
1093449369 12:19297724-19297746 TTACTGGTAAATTATAAAGAAGG - Intronic
1094308730 12:29053015-29053037 TTATTGATAAAGATAGAAGATGG + Intergenic
1095660574 12:44729214-44729236 TCAATGATAAATAGTGTAGGGGG + Intronic
1097660734 12:62427877-62427899 TTACTTAAAAATGGTTAAGATGG + Intergenic
1098063728 12:66589845-66589867 TTACTGTTGAATAGAGAAGTTGG - Intronic
1098512465 12:71333323-71333345 TCACTGTTAAAGAATGAAGATGG + Intronic
1098725376 12:73958210-73958232 CTACAGAGAAAAAGTGAAGAAGG - Intergenic
1100109763 12:91225856-91225878 TTACTGGAAAATCATGAAGAGGG - Intergenic
1104838053 12:131804841-131804863 TTACAGAAAAATTGTGAAGACGG + Intergenic
1105313402 13:19234380-19234402 TTCCTGATAATTAGTGATGTTGG - Intergenic
1106795295 13:33198879-33198901 TTACTGACAAATTATGAGGAAGG - Intronic
1106865069 13:33955171-33955193 TTAATGAACAAGAGTGAAGAAGG + Intronic
1107043437 13:35972488-35972510 TTTATGATAAATATTTAAGATGG + Intronic
1107124123 13:36826632-36826654 TTTCTCATAAATAGTAAAAAAGG + Intronic
1107141150 13:36999727-36999749 TTACAGATAGATAGTGGTGATGG - Intronic
1107813578 13:44223455-44223477 TTACTGAGATAAATTGAAGAAGG - Intergenic
1108334435 13:49424661-49424683 TTACAGAAAAATTGCGAAGATGG - Intronic
1108758913 13:53539026-53539048 TTACTGATAAATCTTGTAGAAGG + Intergenic
1110165402 13:72436496-72436518 TTTTTCATAAATAGTGAACATGG - Intergenic
1110910951 13:80962427-80962449 TGACTGAAATATAGTGAATAAGG - Intergenic
1111539497 13:89651890-89651912 TTCCTGATAACTAGTGATGTTGG - Intergenic
1111706489 13:91755808-91755830 TTACTGATGAAAAGTGTAGTAGG - Intronic
1112968314 13:105226750-105226772 GTTCTGATAAATACTGAGGAAGG - Intergenic
1113033418 13:106020030-106020052 TTATTGATAAAAACTGAAGATGG - Intergenic
1114254998 14:20994130-20994152 TTACTGGGAAGTAGAGAAGAGGG + Intronic
1114406784 14:22464184-22464206 TGGCTGAAAAAGAGTGAAGAGGG - Intergenic
1114545900 14:23500655-23500677 TTCCTGATAATTAGTGATGTTGG + Intronic
1114898837 14:27030394-27030416 TTCCTGATAATTAGTGATGTTGG + Intergenic
1115490817 14:33956393-33956415 TTACTGATATTTGGTGCAGAAGG + Intronic
1116644078 14:47503850-47503872 TCACAGATACATAGTGAAAAAGG - Intronic
1118090954 14:62477165-62477187 TTACTGATAAAAATTCAATAAGG - Intergenic
1119051556 14:71374198-71374220 TTCCTGATAAATACTGCAAATGG - Intronic
1120493609 14:85206633-85206655 TTACATATAAATATTAAAGAAGG + Intergenic
1122222012 14:100245491-100245513 TTAATCATATATAGTGAAAAAGG - Intronic
1122980483 14:105190122-105190144 TTACTTAGAAATGGTCAAGATGG + Intergenic
1124846065 15:33291801-33291823 TTAATAATTAATAGTGAAGTTGG - Intergenic
1125324211 15:38519673-38519695 TAACTTATAAAAAGTGAAGAAGG + Intronic
1126084467 15:44998805-44998827 ATACTGATAAGAAGTCAAGATGG - Intergenic
1126423213 15:48497936-48497958 TTCCTGACACAGAGTGAAGAGGG - Intronic
1127727754 15:61767048-61767070 ATACTGATAAATAGCTAATAGGG - Intergenic
1128544672 15:68559002-68559024 TTACTGACTAAAACTGAAGATGG - Intergenic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1130538495 15:84803641-84803663 TTACTGGTAAAAAGGGAAAAGGG + Exonic
1130616823 15:85418035-85418057 ATAATAATAAATAATGAAGATGG - Intronic
1131581510 15:93647887-93647909 TTAGTAAAAAATAGTGGAGAGGG - Intergenic
1133358484 16:5154731-5154753 TTTCTGATAAATCGTGCTGAGGG - Intergenic
1133674940 16:8062186-8062208 TTACTTATAAATAGAGAAGTGGG + Intergenic
1135843047 16:25893911-25893933 GGCCTGATAAGTAGTGAAGAAGG - Intronic
1136530243 16:30863279-30863301 TTGCTGAGAAGTAGTGAAGAGGG - Intronic
1137260211 16:46820924-46820946 TCCCTGATAATTAGTGAAGTTGG + Intronic
1137329332 16:47475286-47475308 TTGCTGATATATTTTGAAGATGG + Intronic
1137858797 16:51825016-51825038 TTGCTGACAAAAAGTGGAGAAGG - Intergenic
1139553354 16:67689338-67689360 ATACTTAAAAATAGTTAAGATGG - Intronic
1140634040 16:76889614-76889636 ATATTGATAAATATTGAAGAAGG + Intergenic
1140808464 16:78554751-78554773 TGACTCAGAAATAGAGAAGAAGG - Intronic
1141129763 16:81428066-81428088 TCACTGATAATTGTTGAAGATGG - Intergenic
1142107232 16:88310840-88310862 TTACAGAAAAATCGAGAAGATGG + Intergenic
1144348971 17:14375918-14375940 TCACTTAAAAATGGTGAAGAAGG - Intergenic
1146035885 17:29406405-29406427 TGAATGATCAATATTGAAGAGGG + Intronic
1146202319 17:30869826-30869848 ATAGAGATAAATATTGAAGAAGG - Intronic
1146449117 17:32958077-32958099 ATACTGAAAAATGGTGAATATGG - Intergenic
1147803630 17:43113179-43113201 TTACTCATAAACAGTAATGAAGG - Intronic
1148039287 17:44693647-44693669 ATACTTAAAAATAGTTAAGATGG - Intergenic
1148802764 17:50242561-50242583 ATACTTAAAAATAGTGAAGATGG - Intergenic
1149416860 17:56468875-56468897 TTGCTTATAAAAGGTGAAGAGGG - Intronic
1149455765 17:56786826-56786848 TATCTGAGAAATTGTGAAGAAGG - Intergenic
1149622725 17:58058357-58058379 TTACGGAGAGATGGTGAAGAAGG - Intergenic
1149967676 17:61182418-61182440 TTATTGATAATTATTGAAGATGG - Intronic
1151922888 17:77170991-77171013 TTATTAATAAATAGTTAACATGG + Intronic
1153091665 18:1353267-1353289 TCACTTAAAAATAGTTAAGATGG + Intergenic
1155815871 18:30308950-30308972 CTACAGAAAAATAGTGTAGATGG + Intergenic
1156381047 18:36561638-36561660 TTAGAAATAAATAGTGATGATGG - Intronic
1156717883 18:40033686-40033708 TTAGTGAGAGATAGTAAAGAAGG - Intergenic
1156877951 18:42039005-42039027 TTACTGAGAAACAGGAAAGAAGG - Intronic
1159471085 18:68857855-68857877 TTACTGAAAAATTGTGCACAGGG - Intronic
1161567270 19:5010619-5010641 CAACTGATAAATGGGGAAGAGGG - Intronic
1163708087 19:18828557-18828579 TCCCTGAAAAAGAGTGAAGAAGG + Intergenic
1163708237 19:18829946-18829968 TCCCTGAAAAAGAGTGAAGAAGG - Intergenic
1163946093 19:20536446-20536468 TCACTGATATAAAGTGAAGGAGG - Intronic
1164142997 19:22490640-22490662 CCACTGATATAAAGTGAAGAAGG + Intronic
1164266491 19:23623448-23623470 TCACTGATACAAAGTGAAGAAGG + Intronic
1165647308 19:37452980-37453002 ATAATGAAAAAGAGTGAAGAAGG - Intronic
1166265280 19:41678247-41678269 TTACTGATTAATATGGGAGAGGG - Intronic
1166404961 19:42513758-42513780 CTACTGAGATACAGTGAAGATGG - Intronic
1166669311 19:44700577-44700599 ATTCTGATAAATAGAGATGATGG - Intronic
930016226 2:46972663-46972685 TTACTGATAAATGGGAAAGTGGG + Intronic
930257868 2:49112451-49112473 TTACTGATAATTATTGAAGCTGG + Intronic
931004844 2:57837309-57837331 TTAAAAATAAATAGGGAAGAAGG + Intergenic
933537504 2:83594847-83594869 TTACTTAAAAATAGTTAAAATGG + Intergenic
934119435 2:88825717-88825739 ATACTGAAAAATGGTTAAGATGG - Intergenic
934618737 2:95791378-95791400 GTGCTGACAAATAGGGAAGAGGG + Intergenic
934642156 2:96033179-96033201 GTGCTGACAAATAGGGAAGAGGG - Intronic
934696178 2:96402267-96402289 ATACTTAAAAATAGTTAAGATGG + Intergenic
935284757 2:101554657-101554679 GTACTAATAAAAAGTGATGAAGG + Intergenic
935554842 2:104498309-104498331 TTACTGAAAAATATTGACGGTGG - Intergenic
936547514 2:113405279-113405301 TTACTGCTAAACAGTGAAAGAGG + Intergenic
937441923 2:121922883-121922905 TTACTGATAAATTGAGAGCATGG - Intergenic
937818362 2:126279078-126279100 TTCTTGATAAATAGGAAAGATGG + Intergenic
938687807 2:133757426-133757448 TTAATGATATTTAGGGAAGATGG - Intergenic
939334054 2:140802248-140802270 TTACTGACATTTAGTGGAGAAGG + Intronic
940074290 2:149723214-149723236 TTCTTGATAAGCAGTGAAGAAGG - Intergenic
940477315 2:154179396-154179418 TTACAAATAAATTGTGAAAAGGG + Intronic
941739909 2:169024448-169024470 TTATAGAAAAATTGTGAAGATGG + Intronic
942335662 2:174882407-174882429 TTGCTGAAAAATAGAAAAGATGG - Intronic
942627708 2:177920714-177920736 ATACTTAAAAATAGTGAAGATGG + Intronic
943146719 2:184055231-184055253 ATATTTATAAATAGTAAAGAGGG - Intergenic
943173427 2:184434174-184434196 TTACTGATAACTGGTGTAGTTGG + Intergenic
943176911 2:184488174-184488196 ATACTGATCAATTATGAAGATGG - Intergenic
944261890 2:197686814-197686836 TTCCTGATAATTAGTGATGTTGG + Intergenic
944342762 2:198622637-198622659 TAACTGAGAAATTGTGATGACGG + Intergenic
944462204 2:199961557-199961579 TTACTGAGATACAGAGAAGAGGG + Intronic
944582492 2:201144105-201144127 TTACTAATTATTAGTGAAAAAGG + Intronic
945443603 2:209909968-209909990 TTAGTGATAAATAGAGATTAGGG - Intronic
945535704 2:211015343-211015365 TTACTCTTAAAAAATGAAGATGG + Intergenic
945828938 2:214759820-214759842 TTAAAATTAAATAGTGAAGATGG + Intronic
947347408 2:229207567-229207589 CTACAGATAAATAGGTAAGAAGG - Intronic
947359855 2:229335791-229335813 TTACTTTTAAAGAGAGAAGAGGG - Intergenic
947596994 2:231419246-231419268 CCACTGATCAATAGTGAAGCAGG - Intergenic
947790175 2:232861751-232861773 TTACTGAGAAATTGGGAAAACGG + Intronic
948623456 2:239251224-239251246 TTATTTCTAAAAAGTGAAGATGG + Intronic
1169955812 20:11101602-11101624 TAACTGAAAGATAGTGAGGAAGG + Intergenic
1170299663 20:14868989-14869011 TTCCTGATAATTTGTGAACAAGG - Intronic
1170525544 20:17232535-17232557 CTACAAATAAAAAGTGAAGATGG - Intronic
1172220089 20:33267972-33267994 TGACTGACTAAGAGTGAAGAAGG + Intergenic
1172593915 20:36136479-36136501 TTACTTAAAAATGGTTAAGATGG - Intronic
1174142081 20:48422415-48422437 TTACTGATGCATTGAGAAGATGG - Intergenic
1177209139 21:18048127-18048149 TAACTGACAAATAGTGAAAGAGG + Intronic
1178347774 21:31846497-31846519 ATGCTAATAAATAGAGAAGAGGG - Intergenic
1180097974 21:45569428-45569450 TTACAGAAAAATTGTGAAGATGG - Intergenic
1182412544 22:30199416-30199438 CTAATGATAAATGGTGAACAAGG + Intergenic
949767752 3:7546015-7546037 TAACTGATAAATAATGAACCAGG - Intronic
951011358 3:17684387-17684409 CTACTGAAATATAGTGAAAATGG - Intronic
951374541 3:21897254-21897276 TTATTGATAAACAGGCAAGAGGG + Intronic
951626029 3:24663851-24663873 TTACTGATAAAGAGGAAAAAAGG - Intergenic
953224152 3:41001032-41001054 GTAATGAAAAATAGAGAAGAGGG + Intergenic
953370244 3:42381412-42381434 TCACTTAAAAATAATGAAGAAGG + Intergenic
957016743 3:75073451-75073473 TTAATAATAAATGATGAAGAGGG - Intergenic
959182458 3:102998902-102998924 TTATTTTTAAGTAGTGAAGAGGG - Intergenic
960203913 3:114871584-114871606 TCACTGATTATTATTGAAGAGGG - Intronic
960787014 3:121384642-121384664 TGCCTTATAAATCGTGAAGAAGG + Intronic
962165049 3:133039179-133039201 TGACTGGTAAATGGTGAGGAGGG + Intronic
962413864 3:135164959-135164981 TTTCTGATAAATAATGAAAAAGG - Intronic
963537715 3:146548632-146548654 TTTCTGATGAATAGTGATGCTGG + Intergenic
963838508 3:150080830-150080852 TTATTTTTAAATAGTGAATATGG + Intergenic
964506232 3:157403026-157403048 TTTTTGATAAATAATGAAGAAGG + Intronic
964822804 3:160792127-160792149 TTACTTTTATATAGTGAAGTAGG + Intronic
965504194 3:169494246-169494268 TTACTGATAAATTTTTGAGAGGG + Intronic
965505129 3:169507017-169507039 TTTCTTATGATTAGTGAAGAGGG - Intronic
965662801 3:171059660-171059682 TTCCTGATATATAGTGACCAAGG + Intergenic
966354879 3:179069304-179069326 TTATGGATAAAGATTGAAGAGGG - Intronic
971608535 4:28690153-28690175 TGACTGATAATTAGAGAATATGG + Intergenic
971790699 4:31166811-31166833 TTACAGACAAATTGCGAAGATGG + Intergenic
971892829 4:32546629-32546651 ATAGTGATAAGTAGTGATGATGG - Intergenic
972312605 4:37894915-37894937 TCACTAATAAATTGTGAAGGTGG - Intronic
974190872 4:58501040-58501062 TTCCTGAAAAATATTGAGGAAGG - Intergenic
974196877 4:58586350-58586372 TCCCTGATAACTAGTGAAGTTGG - Intergenic
974462984 4:62213053-62213075 TTAATGAGAAATAATGAAAAAGG - Intergenic
975072052 4:70153879-70153901 TTTCTGAAGAATAGTGGAGAAGG - Intronic
975423918 4:74203991-74204013 TTACTGAGAATTAATGAGGATGG - Intronic
976410959 4:84713113-84713135 TTACAGTTTAATAGTGAAGTTGG - Intronic
976860382 4:89658704-89658726 TTGGTGTTAAACAGTGAAGAGGG - Intergenic
978037710 4:104016422-104016444 TTACTCATAAATAATGAATTTGG - Intergenic
978253594 4:106664625-106664647 TTCCTGATGAATAATGATGATGG + Intergenic
979028545 4:115608735-115608757 TTAGTGATATCTAGAGAAGAGGG - Intergenic
979626949 4:122855641-122855663 TTTCTCATAAGTAGTGCAGATGG + Intronic
979707318 4:123735987-123736009 TTACTGAAATAAAGTAAAGAGGG - Intergenic
979710704 4:123775958-123775980 CTCCTGAGAAATAGTCAAGAAGG - Intergenic
980792766 4:137640606-137640628 AGACTTATAAATGGTGAAGAAGG + Intergenic
980868797 4:138586311-138586333 TTATTGATAAATTTTGAATAAGG + Intergenic
983445899 4:167851714-167851736 TTTGTGATAAGTAGTGAATAGGG - Intergenic
984393199 4:179165348-179165370 TTACTTAAAAATGGTTAAGATGG - Intergenic
985963305 5:3320201-3320223 TCTCTGATAAAAAGGGAAGACGG + Intergenic
987493434 5:18612231-18612253 TTACTGAATAATGGAGAAGAAGG - Intergenic
987877224 5:23693334-23693356 TAACTGATAAAAAATGAAAAGGG - Intergenic
988150457 5:27371493-27371515 GTATTGATAAATGTTGAAGATGG + Intergenic
988154845 5:27438379-27438401 TTACAGAAAAGTTGTGAAGATGG + Intergenic
989359098 5:40579099-40579121 GTGCCGATAAATAGTGAAAAGGG + Intergenic
989703172 5:44295342-44295364 TTACTGCTAGATAATGAAGCTGG - Intergenic
990275473 5:54191440-54191462 ATACTTAAAAATAGTTAAGATGG + Intronic
992654718 5:78897303-78897325 TTACTGATAGTTAGTGAGTAGGG - Intronic
994052791 5:95381441-95381463 TTACTGATAAACAGGTTAGAGGG + Intergenic
996713101 5:126563099-126563121 TTACTTAAAAATGGTTAAGATGG - Intronic
997278606 5:132621960-132621982 TGTCTAATAAAAAGTGAAGAAGG - Intronic
998187615 5:139994602-139994624 ATACTTAGAAATAGTTAAGATGG + Intronic
998887880 5:146713424-146713446 ATACTGAAAAATAGTTAAAATGG + Intronic
1000413724 5:160961356-160961378 TTTCTGATAAATAGTTCACATGG - Intergenic
1003183676 6:3812567-3812589 TTACAGATGTATATTGAAGATGG - Intergenic
1003468145 6:6401247-6401269 TCCCTGATATACAGTGAAGAGGG + Intergenic
1005575189 6:27183637-27183659 TTACTACTAAATACTTAAGACGG - Intergenic
1005799287 6:29403851-29403873 TTAGTGCTAAATAGTCTAGATGG - Intronic
1006049666 6:31332055-31332077 TTACTGGTAAATACTTAAGGCGG + Intronic
1007416346 6:41693678-41693700 TTACTGATTCATGGTGTAGAGGG - Intronic
1007882517 6:45183374-45183396 TTACTTATGCATCGTGAAGACGG - Intronic
1009948311 6:70365362-70365384 TTGCTTATAAATAGTTGAGAAGG + Intergenic
1011241274 6:85273792-85273814 TTACTTAAAAATGGTTAAGATGG - Intergenic
1011467662 6:87675123-87675145 TTCCTGTGAAATAGTGAAGGAGG - Exonic
1012016389 6:93857488-93857510 TTACTAATAACTTGTGAATAGGG + Intergenic
1012326394 6:97924321-97924343 TTACTGATCAATAGAGAGGGAGG + Intergenic
1012974150 6:105761726-105761748 GTACTGTGAAATAGTAAAGAGGG + Intergenic
1013328782 6:109076156-109076178 TTAGTGATACATAATAAAGATGG - Intronic
1014041666 6:116834293-116834315 TTACCACAAAATAGTGAAGATGG + Intergenic
1014145421 6:117992856-117992878 TTTCTGATAGATATTGTAGAGGG - Intronic
1014519795 6:122427604-122427626 TGAATGATAAATAATGAAGAAGG + Intronic
1014965350 6:127741110-127741132 TTGCTGAGAAATAGTAAAGTTGG - Intronic
1015094793 6:129402304-129402326 ATACTGATATGTAGAGAAGAGGG - Exonic
1015142003 6:129945416-129945438 TTCCTGATAATTAGTGAGAATGG + Intergenic
1015530526 6:134217214-134217236 TGACTGAAAACTAGGGAAGATGG + Intronic
1015709506 6:136124143-136124165 TTACTGATAAATGGTTACCAGGG - Intronic
1015826340 6:137316681-137316703 ATACTGCTAAATATTGTAGAAGG - Intergenic
1016072565 6:139757463-139757485 TTGCTTGGAAATAGTGAAGATGG + Intergenic
1016193065 6:141294551-141294573 TAACTGTTAAATACTGATGACGG - Intergenic
1016677113 6:146783706-146783728 TCACTGATAAATAATGCAGCTGG - Intronic
1016951357 6:149583663-149583685 TCACTGATATACAGTTAAGAGGG - Intronic
1017310907 6:152976683-152976705 TTAATGATAAATAGAAAAAAGGG + Intronic
1017563103 6:155653642-155653664 TTAATCACAAAAAGTGAAGAAGG - Intergenic
1018296605 6:162352625-162352647 TAACAGATAAATAGTGAAGCAGG + Intronic
1018404747 6:163467286-163467308 TTACTGAGATATAATGAACAAGG - Intronic
1018435640 6:163756146-163756168 TTACTCAAAAATAGTTATGATGG - Intergenic
1018912530 6:168110889-168110911 TTATTGATAAATTGTGATGCTGG + Intergenic
1020459898 7:8417511-8417533 TTTATGATAATTACTGAAGATGG - Intergenic
1020594484 7:10188421-10188443 TTACTGAAAAATTGTGTAGATGG + Intergenic
1020646472 7:10820365-10820387 TAACTGATAAACAGAGAAGCAGG + Intergenic
1021038456 7:15830565-15830587 CTACTTATAAATGATGAAGATGG + Intergenic
1021499701 7:21318990-21319012 TTACTGAAAAATAGTTTATAAGG + Intergenic
1024364117 7:48501535-48501557 TTACTCATAAATAATTCAGAGGG - Intronic
1026026542 7:66749308-66749330 TTACTGAGTAAGAGTGAATAAGG - Intronic
1026821904 7:73555672-73555694 TTTAGGATAAATACTGAAGAAGG - Intronic
1027328462 7:77065989-77066011 CCACTTAAAAATAGTGAAGATGG - Intergenic
1028976018 7:96915003-96915025 TTACTGATAACAAATGAAGAGGG - Intergenic
1029746802 7:102520177-102520199 CCACTTAAAAATAGTGAAGATGG + Intergenic
1029764735 7:102619137-102619159 CCACTTAAAAATAGTGAAGATGG + Intronic
1029919842 7:104251586-104251608 TTACTGAGGAAGAATGAAGAGGG + Intergenic
1030093863 7:105880596-105880618 TTACTGAAAAGAAGAGAAGAGGG + Intronic
1030285289 7:107820228-107820250 TAACTTCTACATAGTGAAGAGGG + Intergenic
1030814456 7:114017939-114017961 TAGCTGATGAATAGTTAAGATGG + Intronic
1031949627 7:127878783-127878805 GAAGTGAAAAATAGTGAAGAAGG + Intronic
1034109223 7:148520314-148520336 TGACTTAAAAATAGTAAAGATGG - Intergenic
1034525775 7:151660929-151660951 CTACTGAAAAATGGTTAAGATGG - Intronic
1035764678 8:2096616-2096638 TTTCTGAGAAGCAGTGAAGAAGG + Intronic
1036099191 8:5758528-5758550 TTAATGAAAAATAGGGCAGAGGG + Intergenic
1036936558 8:13008149-13008171 ATAATGATATATAGTAAAGAAGG - Intronic
1037782043 8:21876251-21876273 TTACCGATAGAAAGTGGAGAAGG - Intergenic
1038193945 8:25349074-25349096 TGACTAATAAAAAGTGAAGGAGG + Intronic
1038536419 8:28356443-28356465 TTCCTGGTACATTGTGAAGATGG - Intronic
1039012765 8:33112923-33112945 TAACTGAAAAATAGAGAAAAAGG + Intergenic
1039031132 8:33310869-33310891 TTACAAATAAATAGTGAATTGGG - Intergenic
1039111202 8:34042284-34042306 CTACTGGCAAATAGTGCAGAGGG - Intergenic
1039174823 8:34791951-34791973 TTTCTGATAAAAAATAAAGATGG + Intergenic
1039551549 8:38446708-38446730 TTTTTTATAAATAATGAAGAAGG - Intronic
1040727831 8:50404671-50404693 ATACTTAAAAATAGTTAAGATGG - Intronic
1041194740 8:55389567-55389589 TCAATGGCAAATAGTGAAGAAGG + Intronic
1041252335 8:55946615-55946637 ATACTTAAAAATAGTTAAGAGGG - Intronic
1041333717 8:56756324-56756346 TGACTTATAAATAATGAAGAGGG - Intergenic
1042124678 8:65526225-65526247 GTACTTAAAAATAGTTAAGATGG - Intergenic
1043117265 8:76273807-76273829 TTTTTGAAAAATAGTAAAGAAGG + Intergenic
1043224880 8:77713580-77713602 TTATGGATATATTGTGAAGATGG - Intergenic
1043663744 8:82781857-82781879 TAGCTGATAAATTGGGAAGATGG - Intergenic
1044478604 8:92657772-92657794 TTACTGAGGAAAAGAGAAGATGG - Intergenic
1045177900 8:99745733-99745755 ATACTGATAATTACTAAAGATGG - Intronic
1045224069 8:100227688-100227710 TTACTGATTGATAGTGAGAATGG + Intronic
1045903039 8:107307956-107307978 TAACTGATAAAAACTGGAGAAGG - Intronic
1048798586 8:138174433-138174455 TTACTGTGAGATAGTGAAGAGGG - Intronic
1049135910 8:140899553-140899575 CTACTCAAAAATATTGAAGAGGG + Intronic
1049168163 8:141139865-141139887 ATCCGGATACATAGTGAAGAAGG - Intronic
1050493861 9:6218546-6218568 TTACAGGGAAATACTGAAGAAGG + Intronic
1050674263 9:8034146-8034168 TTACCGATAAAGAATGTAGATGG - Intergenic
1050709350 9:8442511-8442533 TTACTGATAAATTGTGATAAAGG + Intronic
1050932789 9:11350677-11350699 TTGTTCATAAATAGTGCAGATGG - Intergenic
1050956055 9:11661633-11661655 TTCCTGATGATTAGTGAAGTTGG + Intergenic
1051763250 9:20493092-20493114 TTACTGCAAAATATTGAAGTAGG - Intronic
1052084911 9:24253154-24253176 AGAATGAAAAATAGTGAAGAAGG - Intergenic
1052259803 9:26501203-26501225 ATTCTGATAAAATGTGAAGATGG - Intergenic
1052490354 9:29159125-29159147 CTACTGATTCATACTGAAGATGG + Intergenic
1052791884 9:32882869-32882891 TTAATGACTAATAGGGAAGAGGG - Intergenic
1055208161 9:73758869-73758891 TTAGAGATAATTAGTGAAGCAGG - Intergenic
1055668248 9:78573705-78573727 TTACTGAAAAATAAAGAACAGGG + Intergenic
1056105274 9:83341015-83341037 TTACAGAGTAATAGGGAAGATGG - Intronic
1056105277 9:83341062-83341084 TTACAGAGTAATAGGGAAGATGG - Intronic
1059580357 9:115540286-115540308 TTACAGATAAATATTGATGTTGG - Intergenic
1060565825 9:124590738-124590760 TTACTGTGAAGTAGTGAAGTTGG - Intronic
1060899478 9:127245046-127245068 TTAGTGATAAAGAGGGAAGACGG - Intronic
1061171933 9:128962904-128962926 TTACTTAAAAATAGTTAAAATGG - Intronic
1061844958 9:133382432-133382454 CTCCTGCTAAATAGTGATGATGG + Intronic
1185810449 X:3104142-3104164 ATACTGAAAAATGGTAAAGATGG - Intronic
1186026091 X:5314572-5314594 TGACTGTTAAATAATGAATAGGG + Intergenic
1187770798 X:22693352-22693374 TTGTTGATAAATATTGAAGCTGG - Intergenic
1188069207 X:25698635-25698657 TTACTGATATTTAAGGAAGAAGG - Intergenic
1188192228 X:27186134-27186156 TTTCTTATAAATGGTGATGATGG - Intergenic
1188504534 X:30867390-30867412 TTACAGAAAAATTGAGAAGATGG - Intronic
1188814129 X:34690147-34690169 TTTCTGAAAAATAGAGAAGGAGG - Intergenic
1188996414 X:36891632-36891654 ATTCTGAAAAATAGTGGAGAAGG + Intergenic
1191820526 X:65301087-65301109 TTCCTGATCAATAGTGATGTTGG - Intergenic
1192407812 X:70904318-70904340 TTCCTGATAACTAGTGAAGTTGG - Intronic
1194072233 X:89340107-89340129 TCCCTGATAGATAGTGATGAAGG - Intergenic
1194083290 X:89494933-89494955 GTTCTGAAAAATAGAGAAGAAGG - Intergenic
1194492892 X:94573223-94573245 TAAGTGATAATTAGTGAAGTGGG - Intergenic
1194967347 X:100303728-100303750 TTGCTGAAAAAAAGGGAAGAAGG - Intronic
1196048357 X:111279628-111279650 TGACTGAAAAAAAGTGAACAGGG + Intergenic
1198687803 X:139246209-139246231 TATCTGTTAAATTGTGAAGAAGG - Intergenic
1198706080 X:139449679-139449701 TAAGTGATAAAGAATGAAGAGGG + Intergenic
1199399558 X:147381333-147381355 TAACTGGGAAATAGTGAAAAAGG + Intergenic
1199430256 X:147751367-147751389 TTAGTAATAAATAGTTGAGATGG - Intergenic
1199906096 X:152233062-152233084 TCACTGATAACTAGTGATGTTGG + Intronic
1200435941 Y:3150807-3150829 GTTCTGAAAAATAGAGAAGAAGG - Intergenic
1200726473 Y:6675858-6675880 TCCCTGATAGATAGTGATGAAGG - Intergenic
1200727625 Y:6691634-6691656 TCCCTGATAGATAGTGATGAAGG - Intergenic
1202023833 Y:20498111-20498133 ATTCTGAAAAATAGAGAAGAAGG - Intergenic
1202349799 Y:23976197-23976219 TTACTGATACATACTGCAGTAGG + Intergenic
1202520980 Y:25693922-25693944 TTACTGATACATACTGCAGTAGG - Intergenic