ID: 1078237406

View in Genome Browser
Species Human (GRCh38)
Location 11:9498333-9498355
Sequence CTGAGAGAGCTCGTGGTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078237406_1078237412 14 Left 1078237406 11:9498333-9498355 CCCTAGACCACGAGCTCTCTCAG 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1078237412 11:9498370-9498392 GGCAACAAGTTTATTTACCTAGG 0: 1
1: 0
2: 1
3: 12
4: 117
1078237406_1078237410 -8 Left 1078237406 11:9498333-9498355 CCCTAGACCACGAGCTCTCTCAG 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1078237410 11:9498348-9498370 TCTCTCAGGTTTTAGTTGTCTGG 0: 1
1: 1
2: 16
3: 192
4: 1046
1078237406_1078237411 -7 Left 1078237406 11:9498333-9498355 CCCTAGACCACGAGCTCTCTCAG 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1078237411 11:9498349-9498371 CTCTCAGGTTTTAGTTGTCTGGG 0: 1
1: 1
2: 13
3: 183
4: 858

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078237406 Original CRISPR CTGAGAGAGCTCGTGGTCTA GGG (reversed) Intronic
902830588 1:19009885-19009907 CTGAGAGAGCTTGTGGCCTTGGG + Intergenic
902848110 1:19128241-19128263 CTGGGAGAGCAGGTTGTCTAGGG + Exonic
903427281 1:23263496-23263518 CTGAGAAAGCTTGTGCTCCAGGG + Intergenic
904879498 1:33684648-33684670 CTGGAAGAGCTCATTGTCTAGGG - Intronic
909392175 1:75131132-75131154 CTGAGAGAAAACGTGGTCAAAGG - Intronic
909622902 1:77686705-77686727 CTGACAGAGCTCACAGTCTAGGG + Intergenic
912958783 1:114176497-114176519 CTCAGGGAGCTCATGGCCTAGGG + Intergenic
913218110 1:116637417-116637439 CTGAAGGAGCTCATGTTCTATGG + Intronic
920088071 1:203432524-203432546 CTCAGGGAGCTCTTGGCCTAAGG + Intergenic
924214889 1:241810828-241810850 CTCAGAGAGCTTGTCTTCTAGGG - Intergenic
1063205694 10:3828639-3828661 CTCAGAGAGCTCGTGCCCCACGG - Intergenic
1065916365 10:30357517-30357539 GGCAGAGAGCTCGTGGTTTATGG + Intronic
1065917985 10:30368200-30368222 CTGAGAGAGCACGTGGTTGATGG + Intronic
1069640145 10:69949622-69949644 CTTAGAAAGCTCCTGGTCTGGGG - Intronic
1075485937 10:122822175-122822197 CTGACAGAGCCCCTGGTCCATGG + Intergenic
1076301683 10:129433263-129433285 CTGAGAGTGCTCCTGTCCTAAGG - Intergenic
1078183784 11:9034014-9034036 CTCAAGGAGCTCATGGTCTAGGG - Intronic
1078237406 11:9498333-9498355 CTGAGAGAGCTCGTGGTCTAGGG - Intronic
1080645502 11:34184873-34184895 GTGAAAGAGCTCGTGGTCTCTGG - Intronic
1080853630 11:36092784-36092806 CTGAGAGAGCTGATGGCCTGAGG + Intronic
1083730797 11:64651507-64651529 CTGAGTGGGCTCGTGTTCAATGG - Exonic
1085391858 11:76186234-76186256 CTGTAAGAGCTCTTGGTCAAGGG - Intergenic
1085840775 11:80009360-80009382 GTAACAGAGCTAGTGGTCTAGGG - Intergenic
1091601163 12:1918463-1918485 CAGACAGAGCTCATGGTCTGTGG - Exonic
1091625110 12:2115613-2115635 CTGACACAGCTCGTGGCCCAGGG - Intronic
1092254199 12:6917331-6917353 CTGAGAGAGTCTGTGGTCTCAGG + Intronic
1098063342 12:66586053-66586075 CAGAGGGAGCATGTGGTCTATGG - Intronic
1098804773 12:75009815-75009837 GGGAGAGAGCTCCTGGTCAAGGG - Intergenic
1102450855 12:113041044-113041066 CAGAGAGAGCACGTGGCCTCGGG - Intergenic
1103026915 12:117581315-117581337 CTTGGGGAGCTCGTGGTCTAGGG - Intronic
1105937934 13:25119102-25119124 CTGAGCGAGCTCGTGGGCGTCGG - Intergenic
1111641461 13:90976107-90976129 CTGAGATAGCTCCTGTGCTATGG + Intergenic
1124484119 15:30100799-30100821 GTCACAGAGCTCGTGGTTTATGG - Intergenic
1124490509 15:30152151-30152173 ATCAGGGAGCTCGTGGTTTATGG - Intergenic
1124753024 15:32386178-32386200 ATCAGGGAGCTCGTGGTTTATGG + Intergenic
1124974769 15:34521878-34521900 GTCAGGGAGCTCGTGGTTTATGG + Intergenic
1126991332 15:54380107-54380129 CTTAGAGAGCTGTTGGTCAAAGG - Intronic
1132185580 15:99799468-99799490 GTCAGAGAGCTCGTGGTTTATGG - Intergenic
1132431416 15:101765073-101765095 GTCAGAGAGCTCGTGGTTTATGG + Intergenic
1133606356 16:7391974-7391996 CAGAGAGAGCTTGTATTCTAAGG - Intronic
1139292688 16:65872760-65872782 CTTAGAGATCTCTTGATCTAGGG + Intergenic
1142010418 16:87711114-87711136 TTGAGAGAGCTCATGGGCTTTGG + Intronic
1142323929 16:89402022-89402044 CTGTGAAAGCTCCTGGTCTGTGG + Intronic
1144328175 17:14201795-14201817 CTGAGACAGCTCGTGAGCTGGGG + Intronic
1144800344 17:17921877-17921899 CTGAGAGTGCTGGTGGTGAATGG - Intronic
1144856348 17:18270486-18270508 GTGTGTGAGCTGGTGGTCTAAGG + Intergenic
1146931474 17:36781162-36781184 CTCAAGGAGCTCCTGGTCTAGGG - Intergenic
1149579775 17:57741515-57741537 CTGAGAGAGATCTTGGCCTGAGG + Intergenic
1155356557 18:24959214-24959236 CTGAGACAGCTCGAGGGCTCAGG - Intergenic
1164766749 19:30778151-30778173 CAGAGAGAGCTCGGAGCCTAGGG - Intergenic
1164814254 19:31182315-31182337 CTCAGAGAGCTCTTGTTCCAGGG + Intergenic
1167275826 19:48538720-48538742 TTGAGAGAGCTGTGGGTCTATGG + Intergenic
932344472 2:70986626-70986648 CTGAGTGATCTCGGGGTCAAGGG + Exonic
937348405 2:121142739-121142761 TTGAGAGAGCTGGTGGACAAGGG - Intergenic
938141024 2:128794721-128794743 CTCAGAGAGCTCATGGTCCAGGG + Intergenic
939857663 2:147379547-147379569 CTGAGAGAGCACGTGATATGTGG - Intergenic
940998503 2:160176348-160176370 CAGAGAGACCTAGTGGGCTAGGG - Intronic
1169697569 20:8407950-8407972 CTGAGAAAACTCGTGGTATAGGG + Intronic
1170319824 20:15083143-15083165 CTGACAAAGGTCGTGGTCTGTGG + Intronic
1170720491 20:18873537-18873559 CTGAGGGATCTCCTGGTCTGTGG + Intergenic
1171388082 20:24783608-24783630 CTGAGAGAACTGGAGGGCTAGGG - Intergenic
1173011385 20:39186105-39186127 CTGAGAGAGCTAGTAGTAGAAGG - Intergenic
1180819417 22:18815497-18815519 CTGAAGGAGCTCATGTTCTATGG + Intergenic
1181205642 22:21249942-21249964 CTGAAGGAGCTCATGTTCTATGG + Intergenic
1181551176 22:23639849-23639871 CAGAGAGGGCTCTGGGTCTAGGG - Intergenic
1183417447 22:37690770-37690792 CTGAGAGAGCAGGGGGTCTCTGG - Exonic
1183658849 22:39206763-39206785 CTGGGAGAGCTGGGGGTCTGGGG + Intergenic
1184607938 22:45585063-45585085 CTGAAAGTGCTTGTGGTTTAGGG + Intronic
1203221281 22_KI270731v1_random:45471-45493 CTGAAGGAGCTCATGTTCTATGG - Intergenic
1203269545 22_KI270734v1_random:41350-41372 CTGAAGGAGCTCATGTTCTATGG + Intergenic
951120270 3:18918421-18918443 CTTAGAGAACTCGTGTTCTGGGG - Intergenic
953384368 3:42498074-42498096 GTGAGAGAGCTCCTGCTCCAGGG - Intronic
954954576 3:54508067-54508089 CTGAGGGAGCTTGTTGTCCAAGG + Intronic
960518339 3:118626770-118626792 CTGAGTAAGCTCATGGTCTCAGG + Intergenic
961009645 3:123427134-123427156 CTGAGGGAGCTGGAGGGCTAGGG - Intronic
963045843 3:141102154-141102176 ATGAGAGGGCTCGGGGTCTGGGG + Intronic
967221242 3:187249821-187249843 CTGAGACAGCTCATGATTTAGGG - Intronic
967270508 3:187728746-187728768 CTGAGAGAGATTGTGGGCTGCGG - Intronic
973695627 4:53487741-53487763 CTTATAGAGCTCGTCCTCTAGGG + Intronic
989522561 5:42418787-42418809 CTGTGAGAGCTCTTTGACTAGGG - Intergenic
992995060 5:82324405-82324427 CTGAGATAGGCCGTGGGCTACGG + Intronic
997805955 5:136918039-136918061 ATCAAAGAGCTCATGGTCTAGGG - Intergenic
1002940389 6:1710611-1710633 CTCGGAGAGCTCCAGGTCTAGGG - Intronic
1003146088 6:3511805-3511827 CTGAGAGAGCTGGTTGTTAAAGG + Intergenic
1010042913 6:71407688-71407710 CTGAGCCAGCAGGTGGTCTAAGG - Intergenic
1010303486 6:74288716-74288738 CTGAGAGAGCCCTTGATCAAAGG - Intergenic
1011871685 6:91902167-91902189 CTGAATGAGCTCCTGGTCAAGGG - Intergenic
1012398621 6:98826488-98826510 GTGAGAGCGCTCTTGGTCTTAGG + Intergenic
1022009401 7:26295676-26295698 GTGAGAGAGCTGGGGGTCTCTGG - Intronic
1023096816 7:36669809-36669831 CTCAGAGAGCTCCTGGGCTTAGG + Intronic
1026804918 7:73423746-73423768 CTGAGAGAGGACGTGGTCTGCGG + Intergenic
1033246210 7:139718396-139718418 CTGAGAGAGAAGGTGGACTAGGG - Intronic
1033620071 7:143053932-143053954 CTGACAAAGCTCTTGGCCTAAGG + Intergenic
1033657253 7:143382147-143382169 CTGAGAGAGTTCTTGGGTTAGGG + Intronic
1035557031 8:575009-575031 CTGAGAGGGCTCCTGGCCTCTGG - Intergenic
1038906942 8:31915442-31915464 CTGACAGAGCTAGTGGGGTAGGG - Intronic
1043878046 8:85508821-85508843 CTGAAGGAGCTGGTGGTCTGAGG - Intergenic
1045336732 8:101211347-101211369 CTGAGGGAGCTCATCTTCTATGG - Intergenic
1046705443 8:117444937-117444959 CTGAGAAAGCTCCTTGTCCAAGG + Intergenic
1047957796 8:129988530-129988552 CTCAGAGAGCTTATGGTATAAGG - Intronic
1049439897 8:142604526-142604548 CAGAGAGAGGTGGTGGTCGAGGG + Intergenic
1049928769 9:435447-435469 CTGAGAGAGCAAGTTTTCTAAGG + Intronic
1050286497 9:4108190-4108212 CTGAAAGAGTTTTTGGTCTAAGG + Intronic
1051175076 9:14352515-14352537 CTGAGGGAGCCTGTGGTCTCAGG - Intronic
1053102866 9:35385962-35385984 CTGAGAGAGCACATAGACTATGG + Intronic
1057304182 9:93902935-93902957 CTGAGAGTGCTCGGGGTCCAGGG + Intergenic
1060618321 9:125039653-125039675 CTCAGACAGCTAGTGGTCTGTGG + Intronic
1061061607 9:128253436-128253458 GGCAGAGAGCTCGTGGTTTATGG + Intronic
1190159435 X:48020524-48020546 GTGAGAGGGCTGGTGGTCTGCGG - Intronic
1190175147 X:48142757-48142779 GTGAGAGGGCTGGTGGTCTGCGG - Intergenic
1199990667 X:152986086-152986108 CTGAGAGAGGTCTTGTTCTCAGG - Intergenic
1200033756 X:153315560-153315582 CTGAGAGAGGTCTTGTTCTCAGG - Intergenic