ID: 1078237511

View in Genome Browser
Species Human (GRCh38)
Location 11:9499655-9499677
Sequence GTGGCTCTTCACAGGCACGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078237511 Original CRISPR GTGGCTCTTCACAGGCACGA TGG (reversed) Intronic
901804279 1:11728086-11728108 GTGGCTCATTACAGGCATGGTGG - Intergenic
903267974 1:22169855-22169877 GTGGGTCTTGGCAGGCATGAAGG - Intergenic
903345976 1:22684586-22684608 GTGGGACTTTACCGGCACGAAGG - Intergenic
903795841 1:25928300-25928322 GTGGCTATTCACAGGTGTGATGG - Intergenic
904617865 1:31759746-31759768 CTGGCTATACACAGGCAGGAGGG - Intronic
905284507 1:36870549-36870571 GTGACTCTTCAAAGGCGGGAGGG - Intronic
906519960 1:46461053-46461075 GCGTCTCTTCACAGGCAGGGCGG + Intergenic
912511376 1:110192421-110192443 GAGGCTCTTCCCAGGCACCCAGG - Intronic
913347612 1:117824321-117824343 GTGGCTCTACCCAGACACAAGGG - Intergenic
914384153 1:147151341-147151363 GTGGCTCTTCACTTTCAAGATGG + Intergenic
919834984 1:201567304-201567326 GGGGCTGTCCACAGGTACGAGGG + Intergenic
920641602 1:207757009-207757031 GTGGCTCCTCACAGGCATCTAGG - Exonic
921764786 1:218958774-218958796 GGGGATCTTCATAGGCAGGAGGG - Intergenic
924755154 1:246933617-246933639 ATGGCTATTCGCAGGCACTATGG + Intergenic
1070445190 10:76492736-76492758 GTGCCTCTTCACAGGGCAGAAGG + Intronic
1070565505 10:77601069-77601091 TTGGCCCTTCACAGGCAGGAAGG + Intronic
1071097645 10:81997321-81997343 GTGACCCTGCACAGGCACGGAGG - Intronic
1071803682 10:89093186-89093208 GTGCCTCTGCACAGCCACGATGG - Intergenic
1072267327 10:93743236-93743258 GTAGCTATTCACAGGCATGATGG - Intergenic
1072520389 10:96225473-96225495 GTGGCTGTACTCAGGCATGAGGG + Intronic
1076203631 10:128577816-128577838 GTGGCACTTCCCAAGCAGGAAGG + Intergenic
1076228037 10:128796647-128796669 GTGGCTGCCCAGAGGCACGATGG - Intergenic
1077432438 11:2522444-2522466 GTGGCCCTGCAGAGGCAGGAGGG + Intronic
1077921397 11:6644483-6644505 TAGGCTCTGCACAGGCAGGAGGG - Intronic
1078237511 11:9499655-9499677 GTGGCTCTTCACAGGCACGATGG - Intronic
1080679283 11:34459130-34459152 ATGGCTCCTCACAGGCTCCATGG - Intronic
1084507716 11:69579362-69579384 TGGGGTCTTCACAGGCACCAGGG - Intergenic
1084901988 11:72316495-72316517 TTGGGTCTGCACAGGCAGGAGGG + Intronic
1085201026 11:74702453-74702475 GGGGGTCTTCTCAGGCAGGAGGG - Intronic
1085888794 11:80552800-80552822 ATGGCTCTGCCCAGGCACGGTGG - Intergenic
1088233960 11:107702591-107702613 CTGGCTCTTCCCAGTCACCACGG - Intergenic
1091010239 11:131994653-131994675 GTGGCTCTACACAGACACCTAGG + Intronic
1095651726 12:44619125-44619147 GTGGCTCTTGACAGACAGGGAGG + Intronic
1096204444 12:49708983-49709005 GTTGCTTGTCACAGGCATGATGG + Intronic
1096664354 12:53153114-53153136 GTTGCCCTTCACAGGGAGGAAGG - Intergenic
1098793644 12:74860760-74860782 GTGGCTATTCCCAGCCATGAGGG - Intergenic
1103701865 12:122852282-122852304 CAGGCTCTTCCCAGGCACAAGGG - Intronic
1105235568 13:18549239-18549261 GGGGCTTTTCACAGGCTAGAGGG - Intergenic
1106138544 13:26992211-26992233 GTGGCTCTCCCTAGGCAAGATGG + Intergenic
1107921726 13:45215830-45215852 ATGGCTCTTCAGAGGAAAGAGGG - Intronic
1110087292 13:71396794-71396816 GTGGCTATTCACATGTACAATGG - Intergenic
1118967008 14:70596306-70596328 GTGGCCCTTCACAAGCAAGAGGG + Intronic
1121012941 14:90532756-90532778 GTGGCTGAACACAGGCAGGAAGG + Exonic
1126851620 15:52800643-52800665 GTAGCTCTTCGCAGGATCGAAGG - Intergenic
1128126578 15:65197570-65197592 GTGCCTCTTCACATGCCCGGAGG + Exonic
1133183363 16:4076144-4076166 GTGGCTGTTCACAGGTGTGATGG - Intronic
1133922215 16:10163560-10163582 GTGGCTATTCACAAGCAAAACGG - Intronic
1139025083 16:62806086-62806108 GCAGCTTTTCACAGGCAAGAAGG - Intergenic
1139950022 16:70664133-70664155 GGGCGTCTTCACAGGGACGATGG + Exonic
1140997722 16:80277529-80277551 GTGGTTTCTAACAGGCACGATGG - Intergenic
1141554209 16:84826435-84826457 CTGGCTCTTCCCAGGCACATAGG - Intronic
1142021403 16:87785156-87785178 ATGGCCCTTCAAAGGCATGAGGG - Intergenic
1143692883 17:8585508-8585530 GTGGATCCTCAAAGGCACCATGG + Intronic
1148041138 17:44708498-44708520 TTGGCTCTTCACTGGCTAGACGG - Intergenic
1149985246 17:61342329-61342351 ATGGCTCTTCATAAGCACGTTGG - Intronic
1149985388 17:61343186-61343208 ATGGCTCTTCATAAGCACGTTGG + Intronic
1151320994 17:73352321-73352343 TTGCCTCTTCACAGCCCCGAGGG + Intronic
1154513971 18:15140760-15140782 GGGGCTTTTCACAGGCTAGAGGG + Intergenic
1155656153 18:28195313-28195335 AAAGCTCTTCACAGGCAGGAAGG - Intergenic
1159946031 18:74445453-74445475 GATGCCCTTCACAGGCATGAGGG + Intronic
1160524338 18:79526236-79526258 GTGACTCTTCACAAACACTAAGG - Intronic
1166090915 19:40508344-40508366 GTGGCTCTTTACACCCACCATGG + Intronic
927929950 2:27037649-27037671 GTGGCTCTGGACAGGAAAGAAGG - Exonic
938514210 2:131985368-131985390 GGGGCTTTTCACAGGCTAGAGGG + Intergenic
941094730 2:161225284-161225306 GTGGCTATTCACAGGCCTGATGG + Intronic
947334840 2:229070798-229070820 GTGGCTTTTCACTGGCACAAGGG + Intronic
948470669 2:238175833-238175855 GTGGCTATTCACAGACATGGTGG + Intronic
948645931 2:239404549-239404571 GCTGATCTTCACAGGCAGGAGGG + Intergenic
948689567 2:239693505-239693527 GTGCCACTTCACAGCCATGAGGG - Intergenic
1168935219 20:1659169-1659191 GTGGCTTTTCTAAGGCACAACGG - Intergenic
1174220729 20:48952950-48952972 GTGATTCTTCACAGGCACCAAGG - Intronic
1175031570 20:55960059-55960081 GGGGCTCTTCCCAGGCTCTAAGG + Intergenic
1176779570 21:13177524-13177546 GGGGCTTTTCACAGGCTAGAGGG - Intergenic
1179010819 21:37554747-37554769 GTGGCACTTCATGGGCACGCAGG - Intergenic
1179514701 21:41898639-41898661 GAGACTCTTGACAGGCACAAAGG + Intronic
1180022107 21:45134909-45134931 GTGGCTCTGCCCAGGCAGCAGGG - Intronic
1184447396 22:44557281-44557303 GTGGCTGCTCTCAGCCACGAAGG + Intergenic
1185392318 22:50569260-50569282 GTGGCAGCTCACAGGCATGAGGG - Exonic
951500935 3:23386294-23386316 GTGGCTCCTCACAGGGTGGAAGG + Intronic
953199304 3:40764239-40764261 GTGGCTCTACAAAGTCACCAGGG - Intergenic
954727244 3:52623238-52623260 GTGGCTATTCACAGGTGTGATGG - Intronic
968742315 4:2337463-2337485 GGGGGACTTCACAGGCACCATGG + Exonic
968881986 4:3305681-3305703 GTGGCAGTTCAGAGGCAGGAAGG + Intronic
973209088 4:47595650-47595672 GCAGCTCTTCACAGTCAAGAAGG + Exonic
973291897 4:48479192-48479214 GTGGCTATTCATAGGCATGTAGG - Intergenic
980330552 4:131404693-131404715 GTGGCTTTACTCAGGCACAATGG - Intergenic
982395487 4:154910972-154910994 GTAGTTCTTCACACACACGATGG - Intergenic
983416135 4:167457451-167457473 GAGACTCTTCACAGGCAGCAAGG - Intergenic
987569907 5:19643663-19643685 GTGGCTGTTCACAGGTAGGTTGG + Intronic
991952418 5:71959193-71959215 GAGGCTCTGCACAGGTAAGAGGG + Intergenic
996464069 5:123779339-123779361 GTGGGTCTTCAAAGGCTTGAGGG + Intergenic
996981651 5:129502999-129503021 ATAGCTCTTCACAGGCACAATGG + Intronic
997693223 5:135842164-135842186 GTGGATATTCACAGGCAAAAGGG - Intronic
998949297 5:147375698-147375720 GTGTCTGTTCACAGGAATGACGG + Intronic
1001419553 5:171576287-171576309 GTGGCTCTCCTCCAGCACGAGGG + Intergenic
1003452757 6:6251396-6251418 GTGGCCCATCACTGGCAGGAGGG + Intronic
1011587692 6:88944504-88944526 GTGGCCCTTGAAAGGCAAGATGG - Intronic
1018418606 6:163622620-163622642 GTGGCTGTTCACCTGCACTACGG - Intergenic
1019120225 6:169796672-169796694 TTCGCTCTTCCCAGGCATGAAGG + Intergenic
1019750949 7:2729385-2729407 GTGGCTCTTCACAGACCTCACGG - Exonic
1019801236 7:3089746-3089768 GTGGGTCTTGAGAGACACGAGGG - Intergenic
1024229501 7:47353527-47353549 GTGGCTCTTCACAGGTTCCAGGG - Intronic
1032094628 7:128931893-128931915 GTGCCTCTTCACTGGCTCGAAGG - Intergenic
1032113875 7:129100684-129100706 TTGGTTGTTCACAGGCACCATGG - Intergenic
1032486877 7:132294428-132294450 GTGGGTCTTCATAGGCACTTTGG + Intronic
1036968635 8:13329151-13329173 GTGGCTCATCACAGTCTAGATGG + Intronic
1037271272 8:17132962-17132984 GTGGCTCTTCACCTGGAGGAAGG - Intergenic
1040319516 8:46285592-46285614 GTGTCTCTACACAGGCACCCTGG + Intergenic
1040773964 8:51016133-51016155 ATGGCACTTCACAGGCACAAAGG - Intergenic
1042277215 8:67018473-67018495 GTGGCTATTCACAGGCATGTAGG + Intronic
1049259329 8:141630327-141630349 GTTGCTCTTCACAGCCCTGAAGG - Intergenic
1050074094 9:1845916-1845938 ATGGCTGTTCACAGGCAGGAAGG + Intergenic
1052056224 9:23910751-23910773 GTGGCTATTCACAAGCATGATGG - Intergenic
1058789593 9:108429322-108429344 GTGGCTCTGCACAATCAGGAAGG + Intergenic
1059477809 9:114561840-114561862 GTGGCTCTTCCCAGACACAGGGG - Intergenic
1061000237 9:127898830-127898852 GTGGCTCGGCACAGGCACCAGGG + Intronic
1061837803 9:133341069-133341091 GGGGCTCTGCACAGGAACGCTGG + Exonic
1061882714 9:133576038-133576060 GTGGCTTTTCCCAGACAAGAGGG + Intergenic
1062256407 9:135624466-135624488 CAGGCTCTTCACATGCACCAGGG + Exonic
1186655191 X:11604824-11604846 GTGGCCCTTCAGAGGCAAGGAGG + Intronic
1187122733 X:16424851-16424873 GTGGCTCCCCAGAGGCACAATGG - Intergenic
1197725379 X:129773001-129773023 ATGGCTCGTCACAGCCAGGAGGG + Intergenic
1199151302 X:144490099-144490121 GTGGCCATTCATAGGCCCGAAGG + Intergenic