ID: 1078240367

View in Genome Browser
Species Human (GRCh38)
Location 11:9525774-9525796
Sequence CACAGCCCCCATTTTAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078240362_1078240367 22 Left 1078240362 11:9525729-9525751 CCTAGTGGAAACACAAATCCTAA 0: 1
1: 0
2: 3
3: 35
4: 297
Right 1078240367 11:9525774-9525796 CACAGCCCCCATTTTAAAGTGGG 0: 1
1: 0
2: 2
3: 13
4: 189
1078240363_1078240367 4 Left 1078240363 11:9525747-9525769 CCTAAATAAGTCCTCTGAGAATC 0: 1
1: 0
2: 0
3: 15
4: 172
Right 1078240367 11:9525774-9525796 CACAGCCCCCATTTTAAAGTGGG 0: 1
1: 0
2: 2
3: 13
4: 189
1078240364_1078240367 -7 Left 1078240364 11:9525758-9525780 CCTCTGAGAATCCTTGCACAGCC 0: 1
1: 0
2: 2
3: 14
4: 158
Right 1078240367 11:9525774-9525796 CACAGCCCCCATTTTAAAGTGGG 0: 1
1: 0
2: 2
3: 13
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078240367 Original CRISPR CACAGCCCCCATTTTAAAGT GGG Intronic
901077088 1:6561930-6561952 CACAGCCTCCATACTACAGTTGG - Intronic
902760991 1:18580671-18580693 CACGGCCCCCATCTTAAAAGTGG + Intergenic
902965564 1:19998697-19998719 CCCAGGCCCCATTCTAAACTGGG + Intergenic
906134364 1:43485874-43485896 CCCAGCCCCCATTTTAAAATTGG + Intergenic
907297928 1:53467353-53467375 AACAGCCTACTTTTTAAAGTTGG - Exonic
910140763 1:84025065-84025087 TACAGCCCCCATTTGGAAGAGGG + Intergenic
910557490 1:88551909-88551931 TACAAACCACATTTTAAAGTTGG + Intergenic
911352535 1:96772318-96772340 ACCAGTCCCCATCTTAAAGTGGG + Intronic
912641439 1:111349748-111349770 TACTGCCCACAATTTAAAGTTGG - Intronic
913064385 1:115236966-115236988 GACTGCCACCATTTTAAATTTGG + Intergenic
915472544 1:156134670-156134692 CTCAGCTCCCAGGTTAAAGTGGG + Intronic
916898188 1:169189432-169189454 CACAGCACTGATTTTAAAGTAGG - Intronic
917873682 1:179265850-179265872 CCCAGCCCCAATTTTAAAATGGG - Intergenic
918230856 1:182530126-182530148 CACAGCCCCCATTTTCAATCTGG - Intronic
919505261 1:198390446-198390468 CACCTCCCTCATTTTAAAGGTGG + Intergenic
920285368 1:204874975-204874997 CACAATCCCCATTTTATAGATGG + Intronic
921290664 1:213654025-213654047 TACAGCCCCCATTGTACAGATGG + Intergenic
921641859 1:217564357-217564379 CACAGCCTTCATTTAACAGTAGG + Intronic
923065793 1:230516148-230516170 CACATTTCCCATCTTAAAGTAGG - Intergenic
923494812 1:234514675-234514697 CAAACCCCTCATTTTACAGTTGG + Intergenic
924928336 1:248705285-248705307 CACAGTTCCCATGTCAAAGTTGG + Intergenic
1068047993 10:51912160-51912182 CAGACACACCATTTTAAAGTAGG + Intronic
1068326042 10:55488150-55488172 CCCACCCACCATTTTAAAATTGG + Intronic
1069571762 10:69498472-69498494 CACACCACCCATCTTCAAGTTGG - Intronic
1070989510 10:80719097-80719119 CACAGACCCCATCTTTCAGTAGG + Intergenic
1072914004 10:99526290-99526312 TACAACCCCCAGTCTAAAGTGGG + Intergenic
1073736809 10:106357417-106357439 CACAACCCACATTTTGAAATGGG + Intergenic
1074260708 10:111850711-111850733 CACAGCCTCCCTTTAAAATTAGG + Intergenic
1075394264 10:122115238-122115260 CACAGCCCCCACCTTCAAGGAGG + Intronic
1076658022 10:132037124-132037146 CACAGCCCCCATTTCAGGGATGG + Intergenic
1078240367 11:9525774-9525796 CACAGCCCCCATTTTAAAGTGGG + Intronic
1079064231 11:17276113-17276135 CAAACCCCTCATTTTAAAGATGG - Intronic
1080857127 11:36121985-36122007 CACAATCCCCATTTTACAGGAGG + Intronic
1081497846 11:43633580-43633602 CATAGCACACATTTTAAAGATGG + Intronic
1082921263 11:58497039-58497061 AACAGCCTCCATTAAAAAGTGGG + Intergenic
1083198414 11:61104766-61104788 CATTGGCCCCATTTTACAGTGGG + Intronic
1084266345 11:68007316-68007338 GTCAGCCCCCATTTTACAGCTGG + Intergenic
1084528095 11:69709976-69709998 CATAGCTCCCATTCTAAAGAGGG + Intergenic
1084750158 11:71199233-71199255 TAAAGCTCCCATTTTACAGTTGG - Intronic
1086026947 11:82305306-82305328 CATAGCCCCTGTTTTGAAGTAGG - Intergenic
1088552005 11:111022644-111022666 CACAGCCCTAATTTAAAAATAGG + Intergenic
1088656464 11:112004544-112004566 CGCAGCCCCAGTTTTTAAGTGGG - Intronic
1089195328 11:116691110-116691132 CATAACCCACATTTTACAGTGGG + Intergenic
1089300076 11:117493197-117493219 GACTGGCCCCATTTTAAAGCTGG - Intronic
1089323892 11:117644296-117644318 TCCAGCCCTCATTTTAAAGGCGG + Intronic
1091214575 11:133892905-133892927 CACAGCCTACATTCTAATGTAGG - Intergenic
1091451479 12:575063-575085 CCCAGCCCCAGTTTTGAAGTAGG + Intronic
1093202868 12:16210628-16210650 AACAGCCTCCATTTTAGAGAAGG + Intronic
1098392032 12:69979725-69979747 CACAACCTCCATTTTATATTTGG + Intergenic
1099628912 12:85114745-85114767 GACAGCCAACATTCTAAAGTGGG - Intronic
1100878395 12:98988930-98988952 CAAAGCCCCAATTTAAAAATAGG - Intronic
1101173471 12:102123875-102123897 CACAGCCATTATCTTAAAGTAGG - Exonic
1103262402 12:119598800-119598822 CACAACCCCCATTTACAAGGTGG - Intronic
1103558639 12:121780637-121780659 CACATCCCCCAGTTTACAGGGGG - Exonic
1103642572 12:122363812-122363834 AACAGCCCCAATTTTAGTGTGGG + Intronic
1107246880 13:38307479-38307501 CACATACCCCATTCTAATGTGGG - Intergenic
1107478321 13:40762867-40762889 CCCTCCCCCCATTTTAATGTAGG + Intronic
1111975171 13:94959108-94959130 CACTACCCCCATTTTAAAGATGG - Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112414516 13:99193260-99193282 CACAGCTCCCATTTTAAAGGAGG + Intergenic
1114465397 14:22918795-22918817 CACTGCCACGATTTTAGAGTTGG - Intronic
1115915912 14:38313745-38313767 CTTAGCCCCCATTTTTAAATGGG + Intergenic
1118055468 14:62075210-62075232 CACAGTCCCCATGTGAAAGAGGG + Exonic
1118314906 14:64720172-64720194 CACAGCCCCTTTTCTAAACTTGG + Intronic
1118926256 14:70192446-70192468 CACAAACCTCATTTTCAAGTTGG + Intergenic
1121031566 14:90662657-90662679 CATAGTTCCCATTTTACAGTGGG - Intronic
1121176781 14:91896567-91896589 CACAATCCCCATTTTACAGATGG + Intronic
1121656706 14:95602348-95602370 CACTGCCTGCATTTTAGAGTAGG - Intergenic
1121663992 14:95658184-95658206 CACAGCCCCCACTTTCAGCTGGG + Intergenic
1122508095 14:102244946-102244968 CAGAGCCCTCCTTTTTAAGTTGG - Intronic
1124450314 15:29782847-29782869 AACAACCCCCATTAGAAAGTGGG + Intronic
1126925502 15:53580788-53580810 AACAGCCACAATTTTATAGTGGG + Intronic
1129790887 15:78340114-78340136 CCCACCACCCATTTTAAAGCGGG + Intergenic
1129909847 15:79217743-79217765 CACAGACCCCATTTTATTATGGG + Intergenic
1131371068 15:91882366-91882388 CATAGCTCCCAGTTTAAGGTTGG + Intronic
1132536963 16:486987-487009 CACAGCCGCCATCTAAAATTAGG - Intronic
1133233447 16:4377049-4377071 CTCAGCCCCCATTGTGCAGTGGG - Intronic
1133360596 16:5170854-5170876 AACAGCCCCCATTTTCATCTGGG + Intergenic
1133967464 16:10541832-10541854 CATAGGCCCCATTTTAAGATGGG - Intronic
1134463725 16:14453429-14453451 CATATTCCCCATTTTAAATTAGG + Intronic
1134634145 16:15779442-15779464 CACTATCCCCATTTTAAAGCTGG + Intronic
1141663279 16:85453105-85453127 CCCTGCCCCCATTTTACAGGTGG - Intergenic
1143290619 17:5825253-5825275 CACAGCCCCAAATCTAAAGTGGG + Intronic
1144913025 17:18698629-18698651 CACAACCACCACTTAAAAGTAGG - Exonic
1146469598 17:33113246-33113268 CAGAACCCCCATTTTATAGATGG - Intronic
1146913702 17:36664788-36664810 CACTGCCCCCATTGTACAGATGG + Intergenic
1150285430 17:63951311-63951333 CACCACCCCCATTTTACAGCTGG + Intronic
1150803775 17:68302679-68302701 CACGACCCCCATTTTAAAGCAGG - Intronic
1151293483 17:73166426-73166448 CACAGCCCCTATGTAAAAGGGGG + Intronic
1153220070 18:2853614-2853636 CACTACCCCCATTTTACAGGAGG + Intronic
1154055619 18:11010649-11010671 CAGAGCCCCCCATTTCAAGTTGG - Intronic
1155096695 18:22562906-22562928 AATAGCCCCCATTTTCAAGTTGG + Intergenic
1156113705 18:33760133-33760155 CAAAGCCTGCATTTTGAAGTTGG + Intergenic
1161024032 19:2026888-2026910 CACACACCCCATTTTACAGATGG + Intronic
1163567263 19:18059114-18059136 CACCACCCCCATTTTATAGGGGG + Exonic
1164017773 19:21268031-21268053 CACAGCCTCCATTTTGAATAGGG + Intronic
1166824501 19:45600702-45600724 CCCTGCCCCCATTTTATAGATGG - Intronic
1168397392 19:56060250-56060272 CACCGCCCCCATTTCACAGATGG - Intronic
925142993 2:1562670-1562692 GGCAGGCACCATTTTAAAGTTGG + Intergenic
925870345 2:8264826-8264848 CACAGCCCCGATTCTGAACTTGG + Intergenic
926044402 2:9699068-9699090 CAGTGTCCCCATTTTAAAGAGGG + Intergenic
926371778 2:12185936-12185958 CCCAGCCCCCATGGGAAAGTGGG - Intergenic
927808267 2:26167307-26167329 GACAGCCACTATTTTAAATTAGG - Intergenic
929422321 2:41805528-41805550 AACAACCCCCATTAAAAAGTAGG + Intergenic
929991645 2:46794708-46794730 CAAATACCCAATTTTAAAGTGGG + Intergenic
930129859 2:47838703-47838725 GACAGCCCCCATTTGTAACTTGG + Intronic
931525753 2:63150853-63150875 CACATGCTACATTTTAAAGTAGG - Intronic
932133381 2:69207405-69207427 CACATCCCCCATTCTAATGTTGG - Intronic
932721333 2:74140904-74140926 CAAAGCCCAGATTTGAAAGTGGG + Intronic
935160605 2:100526625-100526647 CACAACCCCCATCTTAATTTAGG - Intergenic
935416184 2:102821735-102821757 CTCAGCCTCCATTTTTAAATAGG - Intronic
936580327 2:113694648-113694670 CACAGCCCACAGTCTAACGTCGG + Intergenic
937128373 2:119488829-119488851 CAATGTGCCCATTTTAAAGTGGG - Intronic
937223739 2:120356594-120356616 CACTGACCACATTTTCAAGTGGG + Intergenic
941317966 2:164018418-164018440 GACAAACCCCATTTTAAAGATGG - Intergenic
942013568 2:171789102-171789124 TGCTGCCCCCATTTAAAAGTAGG + Intronic
942124398 2:172809183-172809205 CACAGCCCCCAGGTTAGTGTGGG + Intronic
946831686 2:223734285-223734307 CCCAGCCTCCTCTTTAAAGTAGG + Intergenic
1169487786 20:6047868-6047890 CACAGGCCCCATTTTAGACCAGG - Intronic
1169780341 20:9302509-9302531 CACAGCCACCAGTTTCAAATTGG + Intronic
1170058755 20:12237390-12237412 CTCACCCCCCAGATTAAAGTGGG - Intergenic
1171100029 20:22374119-22374141 CATAGCCCCCATTTTAATCATGG - Intergenic
1172630866 20:36377409-36377431 AGCAGCCCCCATCTTAGAGTTGG + Intronic
1172808798 20:37632571-37632593 CACAGCCTCCCCTTTGAAGTGGG + Intergenic
1175266493 20:57706649-57706671 CCCAGCCCCCAATTTCAAGGAGG + Intronic
1175272780 20:57746589-57746611 CACTGCCTCCATGTTCAAGTGGG - Intergenic
1178150762 21:29790986-29791008 CAGACCACCCAATTTAAAGTTGG - Intronic
1179978446 21:44884145-44884167 CACAGTTACAATTTTAAAGTAGG + Intergenic
1181178186 22:21049518-21049540 CCCAGCCACCTCTTTAAAGTAGG - Intronic
1181893641 22:26087015-26087037 CACAGTCTCCATTTTATAGAAGG + Intergenic
1181947900 22:26532567-26532589 CACATCCCCCTTTTTATAATGGG + Intronic
1182714916 22:32350250-32350272 TACTGCCCCCATTGTAAAGATGG + Intergenic
1183062913 22:35346685-35346707 CCCCGCCCCCATTTTACAGAAGG + Intronic
1184116504 22:42425777-42425799 CACAGCCTGCCTCTTAAAGTTGG + Intronic
1184525500 22:45020303-45020325 GACAACCCCCAATTTAAAGGTGG - Intergenic
949170609 3:991747-991769 CACAACCACCTTTTTAAAGTAGG - Intergenic
950168210 3:10817080-10817102 CAAAGGCCCTATTTTAAACTGGG + Intronic
950678551 3:14569335-14569357 CACCCCACCCATTTTACAGTTGG + Intergenic
951196444 3:19828439-19828461 GGGAGCCCCCATTTTAAAGCCGG - Intergenic
951567624 3:24027025-24027047 CACTGATCCCATTTTATAGTTGG + Intergenic
952599284 3:35059776-35059798 CACAGCCCACATTTACAAGATGG + Intergenic
953776332 3:45820548-45820570 CACAGCCCTCTTGTTAGAGTGGG + Intergenic
954165738 3:48756079-48756101 CCCAGCCCCCATTTTCTATTAGG + Intronic
955085046 3:55694479-55694501 CATAGCCCTCATTTAGAAGTTGG + Intronic
956454058 3:69403336-69403358 CACTGTCCCCATTTTAAAACTGG + Intronic
958050513 3:88338398-88338420 CACATCTCCCATTATGAAGTGGG + Intergenic
960654376 3:119986495-119986517 AACAACCCCCATCATAAAGTGGG + Intronic
964649215 3:158992048-158992070 CACAAGCTCCATTTTAAAGATGG - Intronic
965808016 3:172562343-172562365 CCCAGCCTCAATTTTAAAATGGG - Intergenic
966422546 3:179747600-179747622 CTCAGTCCCCATTTTAAAGATGG - Intronic
967213903 3:187193992-187194014 CACAGCCCCCATTCTCATTTTGG + Intergenic
968704259 4:2070726-2070748 CACAGCCGCCACTTGAAAGAGGG + Intergenic
971470624 4:27022009-27022031 CCCTGCCCCCCTTTTAAATTTGG + Intronic
972367155 4:38386843-38386865 CACTGCCCTCATTTTACAGATGG - Intergenic
973101123 4:46272600-46272622 CCCAACCCCCATTTCAAGGTGGG - Intronic
974668658 4:64999779-64999801 CACAACCCCCATTTTTAACCAGG - Intergenic
976369478 4:84270472-84270494 GACAAACCCCATTTTCAAGTAGG + Intergenic
978485867 4:109252845-109252867 CACAGGCACCATGTGAAAGTGGG - Intronic
980456578 4:133051894-133051916 CACAGCCTCCATCTTCAAGTAGG - Intergenic
981742533 4:148017611-148017633 CACAGCTCTCATTATAATGTTGG - Intronic
986239016 5:5940270-5940292 CAAAGGCCTCATTTTAAATTTGG - Intergenic
986694415 5:10339348-10339370 CCCAGCCCCCATTTTGCTGTTGG + Intergenic
990210553 5:53478956-53478978 CCAAGCCCCCCTTTGAAAGTGGG - Intergenic
990453157 5:55956359-55956381 CACAATCTCCATTTTAAATTTGG + Intronic
990815902 5:59784700-59784722 CACATCACCCATTTTAAAACAGG - Intronic
991515991 5:67436117-67436139 CACTGCCTGCATTTTATAGTTGG - Intergenic
993904187 5:93604662-93604684 CACCTCCCCCCTTTTAAAGAGGG + Intergenic
995069450 5:107901853-107901875 CACAGCCCCCACTTTCACGGAGG - Intronic
997198586 5:131995825-131995847 TACTGCCCTCATTTTAAAGATGG - Intronic
998513340 5:142731918-142731940 CACAGTCCCCTTGTTAAAGAGGG - Intergenic
999380299 5:151116860-151116882 CAAAGCCCTCATGTTACAGTGGG - Intronic
1000435109 5:161198389-161198411 CACAGCCCCCAGGTTAAAAACGG - Intergenic
1000748797 5:165069162-165069184 AACAACCCCCATTAAAAAGTGGG - Intergenic
1001458804 5:171890024-171890046 CAAAGAACCCATTTTAAAATGGG + Intronic
1008130337 6:47713830-47713852 CACAGCAGCCATTTCAAACTGGG + Exonic
1012007021 6:93726000-93726022 CACAGGCTCTATTTTAAAGAGGG - Intergenic
1017233719 6:152098577-152098599 CCCAGCTCCCATCCTAAAGTGGG + Intronic
1019814550 7:3190017-3190039 CATTGCCCCCATTTTGTAGTTGG + Intergenic
1022412634 7:30150898-30150920 TATTGCCCCCATTTTAAAGCTGG - Intronic
1023981931 7:45075428-45075450 CAAAGGACCCATTTTACAGTGGG - Intronic
1026152792 7:67802523-67802545 GAATGCCCCCATTTTAAAGGTGG + Intergenic
1027122128 7:75529416-75529438 CACTGCACCCATCCTAAAGTTGG + Intergenic
1030100700 7:105942549-105942571 TACATCCCCCATTTTACAGGTGG - Intronic
1036604042 8:10290717-10290739 CACAGACCTCTTTTTAAACTTGG + Intronic
1043195088 8:77282327-77282349 CACTGCCCCCATTTTTATTTGGG - Intergenic
1044763166 8:95544000-95544022 CACAGCCTGAATTTTAAAATAGG + Intergenic
1045702780 8:104886056-104886078 CATAGTCCCCATTTTACAGATGG - Intronic
1048150612 8:131889969-131889991 CACAGTCTCCATTTAAGAGTCGG + Intergenic
1048438886 8:134445197-134445219 TACTGGCCCCATTTTAAAGCTGG + Intergenic
1051988120 9:23116080-23116102 CACAGCACCCTTTTTACAGTAGG + Intergenic
1056335742 9:85566848-85566870 CTCAGCCTCCTTTCTAAAGTGGG - Intronic
1057285945 9:93754373-93754395 CCCAGGCCCCATTCTAAACTGGG - Intergenic
1058096293 9:100863911-100863933 CATAACCACCATTTTAAAGATGG + Intergenic
1060788941 9:126472501-126472523 CCCACCCCCTATTTTAAAGGAGG - Intronic
1186869777 X:13759552-13759574 CACTGCTCCCATTTTACAGATGG - Intronic
1187740816 X:22353639-22353661 CACCGACCCTATTTAAAAGTAGG + Intergenic
1188363937 X:29291274-29291296 CGCAGCCCCCATTTCAAATGGGG - Intronic
1188869819 X:35359712-35359734 CCCAGACTTCATTTTAAAGTAGG - Intergenic
1192198465 X:69048132-69048154 CATAGACACCATTTTAAAGTTGG - Intergenic
1194060409 X:89189789-89189811 TTCAGCCCCAATTTTAAAGCTGG + Intergenic
1196141383 X:112266634-112266656 AACAGGGCCCCTTTTAAAGTTGG + Intergenic
1199748158 X:150789068-150789090 CTCAACCCCAATTTTAAAATGGG - Intronic
1200935063 Y:8731156-8731178 CACAGCCCTCAGATAAAAGTGGG + Intergenic
1201861398 Y:18601225-18601247 CACAGCTCCCATTTCATAGATGG + Intergenic
1201871925 Y:18719155-18719177 CACAGCTCCCATTTCATAGATGG - Intergenic