ID: 1078240866

View in Genome Browser
Species Human (GRCh38)
Location 11:9529889-9529911
Sequence GCTAGCAAACAGAACCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078240863_1078240866 6 Left 1078240863 11:9529860-9529882 CCAAAAAGACACTTGAAATAAGA No data
Right 1078240866 11:9529889-9529911 GCTAGCAAACAGAACCAGGTGGG No data
1078240861_1078240866 22 Left 1078240861 11:9529844-9529866 CCAAGGTTGAAAAATCCCAAAAA No data
Right 1078240866 11:9529889-9529911 GCTAGCAAACAGAACCAGGTGGG No data
1078240862_1078240866 7 Left 1078240862 11:9529859-9529881 CCCAAAAAGACACTTGAAATAAG No data
Right 1078240866 11:9529889-9529911 GCTAGCAAACAGAACCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078240866 Original CRISPR GCTAGCAAACAGAACCAGGT GGG Intergenic
No off target data available for this crispr