ID: 1078245875

View in Genome Browser
Species Human (GRCh38)
Location 11:9573315-9573337
Sequence CCTCGCTGCTCCTCCGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078245875_1078245883 -5 Left 1078245875 11:9573315-9573337 CCAGCACCGGAGGAGCAGCGAGG No data
Right 1078245883 11:9573333-9573355 CGAGGGGGGTGCGTCCAGGCCGG No data
1078245875_1078245886 7 Left 1078245875 11:9573315-9573337 CCAGCACCGGAGGAGCAGCGAGG No data
Right 1078245886 11:9573345-9573367 GTCCAGGCCGGCTTTCGGGTCGG No data
1078245875_1078245885 3 Left 1078245875 11:9573315-9573337 CCAGCACCGGAGGAGCAGCGAGG No data
Right 1078245885 11:9573341-9573363 GTGCGTCCAGGCCGGCTTTCGGG No data
1078245875_1078245888 13 Left 1078245875 11:9573315-9573337 CCAGCACCGGAGGAGCAGCGAGG No data
Right 1078245888 11:9573351-9573373 GCCGGCTTTCGGGTCGGCTTAGG No data
1078245875_1078245882 -9 Left 1078245875 11:9573315-9573337 CCAGCACCGGAGGAGCAGCGAGG No data
Right 1078245882 11:9573329-9573351 GCAGCGAGGGGGGTGCGTCCAGG No data
1078245875_1078245884 2 Left 1078245875 11:9573315-9573337 CCAGCACCGGAGGAGCAGCGAGG No data
Right 1078245884 11:9573340-9573362 GGTGCGTCCAGGCCGGCTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078245875 Original CRISPR CCTCGCTGCTCCTCCGGTGC TGG (reversed) Intergenic
No off target data available for this crispr