ID: 1078246656

View in Genome Browser
Species Human (GRCh38)
Location 11:9579199-9579221
Sequence GAGGCAGTCCTGTTTCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078246656_1078246660 27 Left 1078246656 11:9579199-9579221 CCTGCATGAAACAGGACTGCCTC 0: 1
1: 0
2: 1
3: 8
4: 133
Right 1078246660 11:9579249-9579271 TAAAAGAAAATACGACTATCTGG 0: 1
1: 0
2: 3
3: 22
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078246656 Original CRISPR GAGGCAGTCCTGTTTCATGC AGG (reversed) Intronic
900769302 1:4528201-4528223 CAGTCATTTCTGTTTCATGCAGG - Intergenic
902994355 1:20212245-20212267 ACGGCAGTCCTGTTTCATCCAGG + Intergenic
903469272 1:23574411-23574433 GAGGCACTGCTGCTTCCTGCAGG + Intergenic
905241013 1:36581537-36581559 GAGCAAGTCCTGTTTCCTGCAGG - Intergenic
906238577 1:44227489-44227511 CTGGCAGTCCTGTGTCAAGCAGG - Intronic
909157885 1:72103636-72103658 GACTCAGACCTGTTTCAGGCTGG + Intronic
910510716 1:88001096-88001118 AAGGCAGTCCAGTTTCAATCAGG + Intergenic
911668851 1:100585916-100585938 GAGTCATTCCTGTTTCATGCTGG - Intergenic
915040655 1:152965755-152965777 AAGGCAGCCTTGTTTCATCCTGG - Intergenic
917118205 1:171623477-171623499 ACGGCAGCCCTGTCTCATGCTGG - Intergenic
917478169 1:175386596-175386618 GAGTCAGCCCTGTTTCTTTCTGG + Intronic
917482816 1:175426610-175426632 AAGGAAGTCCTGTTTCATCATGG + Intronic
918781723 1:188708242-188708264 GAGGGAGTCCTTGTTAATGCTGG - Intergenic
919361784 1:196605617-196605639 GAGGAAGCCCTCTTTCATGTAGG - Intronic
922653646 1:227362400-227362422 CTGGCAGTGCTGTTTCATGAAGG + Intergenic
924651365 1:245930512-245930534 GACACAGTCCTGTCTTATGCAGG + Intronic
1063451260 10:6151789-6151811 GGGGTAGACCTGTTTGATGCAGG + Intronic
1067881865 10:50052767-50052789 AAGCCAGTCCTCTTACATGCTGG - Intergenic
1070436977 10:76403067-76403089 GGGGCACTCCTGTTTGATGAAGG - Intronic
1070542868 10:77429324-77429346 GAGGCTGTCCTGTATATTGCAGG + Intronic
1070845629 10:79520854-79520876 AAGGCAGTCTTGTTTCATTTTGG - Intergenic
1070928166 10:80239460-80239482 AAGGCAGTCTTGTTTCATTTTGG + Intergenic
1071872526 10:89811047-89811069 GGGGCAGTCCTGGTTAATGCTGG + Intergenic
1072407610 10:95169552-95169574 AAGGCAGTCTTGTTTCATTTTGG - Intergenic
1072765279 10:98089925-98089947 GAGGAAGCCCTGTGGCATGCTGG - Intergenic
1073317742 10:102594669-102594691 GAAGCATTCCTTTGTCATGCAGG + Intronic
1075765600 10:124890596-124890618 AATGCAGCCCTGTTTCCTGCAGG + Intergenic
1076097718 10:127745443-127745465 GAGGCAGTCCTATACCATTCAGG - Intergenic
1076717281 10:132372663-132372685 GAGGCAGCCCTGGCTCCTGCTGG - Intronic
1076997802 11:307412-307434 GTTGCAGTCCTGCTCCATGCGGG - Intergenic
1077447034 11:2600155-2600177 GAGGAAGTCCTGTCTATTGCAGG + Intronic
1078246656 11:9579199-9579221 GAGGCAGTCCTGTTTCATGCAGG - Intronic
1079497092 11:21057317-21057339 GAGGGTGTCCTTTTTCCTGCTGG - Intronic
1080464288 11:32482264-32482286 GTGGCAGTCCTGTTTCTTAATGG + Intergenic
1082223852 11:49677230-49677252 GAGGAAGACTTGCTTCATGCAGG - Intergenic
1083407854 11:62471232-62471254 GAGGCCGTCCTGTATGTTGCAGG + Intronic
1083722595 11:64610842-64610864 GAGGCACTCAGGGTTCATGCAGG - Intronic
1083776380 11:64896116-64896138 GAGGCTGCCCTGGTTCATTCAGG - Intronic
1088390456 11:109308610-109308632 GAGGCAGAACATTTTCATGCAGG + Intergenic
1089260019 11:117217914-117217936 CAGACAATCCTGGTTCATGCTGG + Intronic
1089614121 11:119685602-119685624 CCTGCAGGCCTGTTTCATGCTGG + Intronic
1091341141 11:134814891-134814913 GAGGCACTCCTGAATCAGGCTGG + Intergenic
1094544778 12:31394405-31394427 GAGTCAGTCCAATTTCATGGGGG - Intronic
1095485496 12:42680185-42680207 GAGGCAGCACTGTCTCATCCAGG - Intergenic
1097694178 12:62761047-62761069 GAAGGAATTCTGTTTCATGCAGG + Intronic
1102062616 12:109945133-109945155 GAGGAAGTGCTGCCTCATGCAGG + Intronic
1111880916 13:93956030-93956052 GAGCCACTCCTGTCTCATCCTGG + Intronic
1113795482 13:113055258-113055280 GAGGGGGTCATGTTTGATGCTGG + Intronic
1114396089 14:22363029-22363051 GAGGCACCCCACTTTCATGCTGG + Intergenic
1114563037 14:23607190-23607212 GAGGCAGTCCCTTGTGATGCAGG - Intergenic
1118051141 14:62029378-62029400 GGGGCAGCCATGTTTCATGCTGG + Intronic
1119035007 14:71222207-71222229 CATGCAGTCATGTTTCAGGCAGG + Intergenic
1120996407 14:90421556-90421578 GAGGCCCCTCTGTTTCATGCAGG - Intergenic
1122210570 14:100171327-100171349 GAGGGAGTCCTGCTTCACGTGGG - Intergenic
1124206388 15:27724420-27724442 GACCCAGTCCTGTTGGATGCAGG + Intergenic
1124264234 15:28219374-28219396 GAGCCAGGCCTGCTTCCTGCAGG + Intronic
1129749201 15:78048776-78048798 GAGGCAGTCCGGTTGTAGGCAGG - Intronic
1131075985 15:89495249-89495271 AACGCAGTCTTTTTTCATGCAGG + Intronic
1133183488 16:4077245-4077267 AAGGCTGTGCTGTTCCATGCAGG - Intronic
1142024846 16:87806929-87806951 GAGGCAGACATGATTCAAGCAGG - Intergenic
1148352755 17:46952274-46952296 GAAGCAGGCCTGGTCCATGCAGG + Intronic
1149433716 17:56616276-56616298 GGGGCTGTCCTGTATCTTGCAGG + Intergenic
1150578338 17:66450146-66450168 GTGGAGTTCCTGTTTCATGCTGG + Intronic
1151319911 17:73346828-73346850 GAGGCAGTCATTTTTCCTGGCGG + Intronic
1153336080 18:3926222-3926244 GAGGCTGTCCTGTGTCTTGTAGG + Intronic
1155073556 18:22336395-22336417 CAGCCAGTCCTGTCTCAGGCCGG - Intergenic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1157119058 18:44891189-44891211 GAGGCAGGCCTTTCTCATGCTGG - Intronic
1162110717 19:8398227-8398249 GCAGCAGGCCTGTCTCATGCTGG - Intronic
1165321550 19:35088523-35088545 GAGGCAGTGCTGGCTCCTGCAGG + Intergenic
1166665486 19:44677473-44677495 GAGACAGTCCTGTTTCCCCCAGG + Intronic
1166746196 19:45142991-45143013 GAGGCGTTCCTGTTGCATCCTGG + Intronic
930502903 2:52245218-52245240 AAGGCAGTCCTAATTCATACTGG + Intergenic
932432993 2:71686532-71686554 GAGGCAGGCCAGTCCCATGCTGG - Exonic
934125572 2:88885976-88885998 GAGGCTGTCCTGGTTTCTGCTGG - Intergenic
934766632 2:96883543-96883565 AAGGCAGACCTGTTTCTGGCAGG + Intronic
935831416 2:107004830-107004852 GAGGCAGCCCTGAATTATGCCGG + Intergenic
937820619 2:126306432-126306454 AAGGAAATCCTGTTGCATGCTGG - Intergenic
945059070 2:205892780-205892802 GAGGCTGTCGAGTTTCATTCCGG + Intergenic
948359686 2:237411486-237411508 AAGGCGGTCTTGTTTCAAGCTGG + Intronic
948781000 2:240321730-240321752 GAGGCATCCCTGCTTCATGGTGG - Intergenic
1173450581 20:43160050-43160072 CGGGCAGGCCTGTTTCCTGCAGG - Intronic
1175754320 20:61519884-61519906 GAGGCAGTCATGTCTCAGGTGGG - Intronic
1182621633 22:31621606-31621628 GAAAAAGTCCTGTTTCCTGCAGG + Intronic
951711663 3:25590021-25590043 GGGGCCATCCTGTTTCAGGCTGG + Intronic
954779988 3:53051712-53051734 GAAGCAGGCCTGTTTTCTGCAGG + Intronic
955012392 3:55031055-55031077 GAGGCTTTCCTCTTCCATGCCGG + Intronic
955773790 3:62412709-62412731 AAGTCAGTCCTGTTGCATGGGGG + Intronic
955882104 3:63557953-63557975 GAGGCAGTGCTTTTTAAAGCTGG + Intronic
956668631 3:71665074-71665096 GAGGCAGCCCTGATGCATGGTGG + Intergenic
957831999 3:85533305-85533327 GAGGTAGTCTTTTTTGATGCAGG + Intronic
958614443 3:96473536-96473558 GAGGCTGTTATGTTTCATGGGGG + Intergenic
974358218 4:60840003-60840025 GTGACAGTCCTGTGTCATGCTGG + Intergenic
974780220 4:66544294-66544316 CAGGCAGTCCTGTGTCTTCCGGG - Intergenic
976780237 4:88750455-88750477 GAGGCACTTCTGTGTCATCCAGG + Exonic
978686325 4:111448769-111448791 GTGGCAGTCCTGCATCAAGCAGG - Intergenic
981919866 4:150076018-150076040 AAGGCAGCCCTGTTTGATGTGGG - Intergenic
985301857 4:188498546-188498568 GAGGGAGTCCTGTTTCAGAAGGG + Intergenic
989307783 5:39977500-39977522 GAATTAGTCCTGTCTCATGCTGG + Intergenic
1000099736 5:158003815-158003837 GAGGAAGTCGTCTTTCTTGCTGG + Intergenic
1001325565 5:170721236-170721258 GAGGCAGTTTTGTCCCATGCAGG + Intronic
1001867967 5:175122000-175122022 GAAGCATTCCTGTTTAATACAGG + Intergenic
1002586813 5:180253710-180253732 CAGGCAGCCCTGTTGCAGGCAGG - Intronic
1009440608 6:63673689-63673711 GAGGCATTCCAGTCTCAGGCGGG - Intronic
1012263286 6:97112077-97112099 CATACATTCCTGTTTCATGCTGG - Intronic
1014869658 6:126577260-126577282 GAGGCTGTCCTGTCACATCCAGG + Intergenic
1015249288 6:131109981-131110003 GAGGCCAGCCTGTTTCATTCAGG + Intergenic
1017419602 6:154260028-154260050 GAGACATGCATGTTTCATGCAGG + Intronic
1019655798 7:2194444-2194466 GTGACAGTCCTGTTTCATCCTGG + Intronic
1024640027 7:51320877-51320899 GAAGCAGTCCAGTTTAAAGCAGG + Intergenic
1026173285 7:67973436-67973458 GAGACAGCCCTGTTTGATCCTGG + Intergenic
1029570458 7:101365003-101365025 GAGACAGGGATGTTTCATGCTGG + Intronic
1030104259 7:105973613-105973635 GAGGCAGTCATATTGCATGAGGG - Intronic
1031073049 7:117183541-117183563 CAGGAAGTTCTGTTTCATTCTGG - Intronic
1032631074 7:133652608-133652630 GAGGGAGTCCTGGTTCAAGAAGG + Intronic
1034312858 7:150104832-150104854 GAGGAAGTGATGTTTCATCCAGG + Intergenic
1034794003 7:153995833-153995855 GAGGAAGTGATGTTTCATCCAGG - Intronic
1034830114 7:154301735-154301757 AAGGCAGTCCTATTTCATTATGG + Intronic
1039744648 8:40413367-40413389 GACCCAGTCCTCTTTCATGCTGG + Intergenic
1043986930 8:86704666-86704688 GTAGCAGTCATGTTTCAAGCTGG + Intronic
1044484205 8:92731355-92731377 GAGCCAGTCCTGTTTGATAATGG + Intergenic
1045226755 8:100254875-100254897 GAAGCAGTACTGTTTTATACAGG - Intronic
1046485429 8:114881582-114881604 GAGGCTGTCCTGTTTATTGTAGG - Intergenic
1047218173 8:122896080-122896102 GAGGCATTCCAGCTTCAGGCAGG - Intronic
1047277792 8:123418851-123418873 GAGGCTGTCCTGTGTATTGCAGG + Intronic
1047508656 8:125499494-125499516 GGGGCTGTCCTGTTCCTTGCAGG + Intergenic
1048572122 8:135665022-135665044 GAGACAGTGCAGTTTCAGGCAGG - Intergenic
1049193305 8:141301046-141301068 CAGGCAGTCCAGTTTTAGGCAGG - Intronic
1049351537 8:142167307-142167329 GAGGCAGACCTGTGTCCTGTAGG - Intergenic
1053570839 9:39304457-39304479 GAGACAGCCCTGTCTGATGCAGG - Intergenic
1053836781 9:42145373-42145395 GAGACAGCCCTGTCTGATGCAGG - Intergenic
1054092459 9:60863476-60863498 GAGACAGCCCTGTCTGATGCAGG - Intergenic
1054113874 9:61139069-61139091 GAGACAGCCCTGTCTGATGCAGG - Intergenic
1054126306 9:61314555-61314577 GAGACAGCCCTGTCTGATGCAGG + Intergenic
1054593825 9:67043119-67043141 GAGACAGCCCTGTCTGATGCAGG + Intergenic
1058583959 9:106486837-106486859 GAGGCATTCATGTGTCAAGCAGG - Intergenic
1058875598 9:109242136-109242158 GAGGCATTCATGGTGCATGCTGG - Intronic
1061198417 9:129121610-129121632 GAGGCCGTCCTGTGCCATGTAGG + Intronic
1187997242 X:24941145-24941167 GAGGCAGTGCTGTCTCATAGAGG - Intronic
1188977046 X:36688610-36688632 GAGGCACTGCTGTCTCCTGCAGG - Intergenic
1189268153 X:39731829-39731851 GAGGCCGTGCATTTTCATGCTGG + Intergenic
1197373599 X:125655211-125655233 GAGGCTGTCCTGGTTCCTGGGGG + Intergenic
1199826371 X:151504530-151504552 GAGGCAGACATGTTTCAGGTTGG - Intergenic