ID: 1078251071

View in Genome Browser
Species Human (GRCh38)
Location 11:9617010-9617032
Sequence CAGTGTGACAGGAGTGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078251063_1078251071 15 Left 1078251063 11:9616972-9616994 CCTTGAGGTAGAAGTGTGCTTGG No data
Right 1078251071 11:9617010-9617032 CAGTGTGACAGGAGTGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078251071 Original CRISPR CAGTGTGACAGGAGTGGAGT GGG Intergenic
No off target data available for this crispr