ID: 1078251695

View in Genome Browser
Species Human (GRCh38)
Location 11:9621968-9621990
Sequence CAATTTGCAATATAAGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078251690_1078251695 23 Left 1078251690 11:9621922-9621944 CCTATAGGTGTCCTGTTTAAAGA No data
Right 1078251695 11:9621968-9621990 CAATTTGCAATATAAGATTCAGG No data
1078251691_1078251695 12 Left 1078251691 11:9621933-9621955 CCTGTTTAAAGAGATGAATTTTT No data
Right 1078251695 11:9621968-9621990 CAATTTGCAATATAAGATTCAGG No data
1078251689_1078251695 26 Left 1078251689 11:9621919-9621941 CCTCCTATAGGTGTCCTGTTTAA No data
Right 1078251695 11:9621968-9621990 CAATTTGCAATATAAGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078251695 Original CRISPR CAATTTGCAATATAAGATTC AGG Intergenic
No off target data available for this crispr